Next Article in Journal
Crop Row Detection in the Middle and Late Periods of Maize under Sheltering Based on Solid State LiDAR
Previous Article in Journal
Efficacy of Gas-Containing Conditioning Technology on Sterilization and Preservation of Cooked Foods
Previous Article in Special Issue
Effects of Chloropicrin, Dimethyl Disulfide and Metham Sodium Applied Simultaneously on Soil-Born Bacteria and Fungi
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 12
Issue 12
10.3390/agriculture12122009
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Suppression of Tomato Bacterial Wilt Incited by Ralstonia pseudosolanacearum Using Polyketide Antibiotic-Producing Bacillus spp. Isolated from Rhizospheric Soil

by
Dinesh Singh
1,*,
Venkatappa Devappa
2,* and
Dhananjay Kumar Yadav
1
1
Division of Plant Pathology, Indian Council of Agricultural Research-Indian Agricultural Research Institute, New Delhi 110012, India
2
Department of Plant Pathology, College of Horticulture, University of Horticultural Sciences, GKVK Post, Benguluru 560065, India
*
Authors to whom correspondence should be addressed.
Agriculture 2022, 12(12), 2009; https://doi.org/10.3390/agriculture12122009
Submission received: 6 October 2022 / Revised: 12 November 2022 / Accepted: 18 November 2022 / Published: 25 November 2022
(This article belongs to the Special Issue Integrated Pest and Disease Management in Greenhouse Crops)
Browse Figures
Review Reports Versions Notes

Abstract

:
Bacillus spp. has the potential to control bacterial and fungal diseases of crops. In vitro study, Bacillus amyloliquefaciens DSBA-11 showed best to inhibit the growth of Ralstonia pseudosolanacearum as compared to Bacillus cereus JHTBS-7, B. pumilus MTCC-7092, B. subtilis DTBS-5 and B. licheniformis DTBL-6.Three primers sets from nucleotide sequences of polyketide antibiotic synthase genes viz., macrolactin, difficidin and bacillaene of B. amyloliquefaciens FZB42 were designed and standardized protocol for simultaneous detection of polyketide antibiotics-producing strains of Bacillus spp. by multiplex—PCR with products size of 792 bp, 705 bp and 616 bp respectively. All the strains of B. amyloliquefaciens contained three polyketide antibiotic synthase genes, and B. subtilis possessed difficidin and macrolactin, whereas B. cereus JHTBS-7, B. pumilus MTCC-7092 and B. licheniformis DTBL-6 did not contain any polyketide antibiotic genes. By using this technique, polyketide-producing strains of Bacillus spp. were screened within a short period with high accuracy. These polyketide synthase genes were cloned by using a T&A vector to study the role of these genes in producing antibiotics that suppressed the growth of R. pseudosolanacearum under both in vitro and in vivo conditions. Bio-efficacy of cloned products of these genes macrolactin, bacillaene, and difficidin along with parent strain B. amyloliquefaciens DSBA-11 inhibited the growth of R. pseudosolanacearum and formed 1.9 cm2, 1.9 cm2, 1.7 cm2 and 3.3 cm2 inhibition area under in vitro conditions respectively. Minimum bacterial wilt disease intensity (29.3%) with the highest biocontrol efficacy (57.72%) was found in tomato cv. Pusa Ruby (susceptible to wilt disease) was treated with B. amyloliquefaciens DSBA-11 followed by cloned products of difficidin and macrolactin under glasshouse conditions. Hence, the developed multiplex protocol might be helpful for screening polyketide antibiotics producing potential strains of Bacillus spp. from soil which can apply for managing the wilt disease of tomatoes. The polyketide antibiotics produced by bacteria might have a significant role suppression of R. pseudosolanacearum due to the disintegration of cells.

1. Introduction

Bacterial wilt caused by Ralstonia pseudosolanacearum (Formely Ralstonia solanacearum (Smith) Yabuuchi (1995) [1] is a serious disease of tomato (Solanum lycopersicum L.) in tropical, subtropical and temperature areas of the world. In India, the bacterial wilt disease has been reported mostly in coastal, hilly, as well as foothills areas, in India including in the state of Goa, Karnataka, Kerala, Maharashtra, Odisha, Jharkhand, and West Bengal, Himachal Pradesh, Jammu & Kashmir, Uttarakhand and north-eastern states [2,3]. The disease causes very heavy losses, varying from 2 to 90 % in different agro-climatic conditions in India [3]. Application of microbial antagonists is being emerged method to manage bacterial diseases in plants [4,5,6,7]. Several bacterial antagonists, viz; Pseudomonas fluorescens, P. putida, Bacillus spp. and Streptomyces, are used to control this wilt disease in tomatoes. Among them are different species of Bacillus like Bacillus amyloliquefaciens, B. subtilis, B. pumilus, B. coagulans, B. cereus, B. licheniformis, and B. vallismortis were applied for effective control of the disease [7,8,9,10]. The Bacillus spp. have more advantages over other genera of bacterial antagonists, like Pseudomonas, Pantoea and Actinomycetes, since they have resistant against desiccation and also have better survivability at higher temperatures due to possessing endospores in the cell. Bacillus spp. have the ability to promote plant growth slightly under adverse conditions [11,12,13,14].
Bacillus spp. suppress the growth of plant pathogens and reduce disease incidence in plants due to the production of several antibiotics, lysis of cells, a better competitor for resources, plant growth ability and also cause induced resistance in plants against the diseases. Bacillus species produce different kinds of antibiotics viz., iturin, bacillomycin, surfactin, polyketide and bacteriocins [15], lentibiotics [16]), cyclic lipopeptides [17]), polyketide mcrolectine [18,19]), phospholipid [20]), amino sugar [21]), and isocosmarin [22] to suppress various bacterial pathogens which cause diseases to the plants. Strains of B. amyloliquefaciens produce polyketide antibiotics viz; difficidin, bacillaene and macrolactin, which have antibacterial properties. Difficidin produced by B. subtilis and B. amyloliquefaciens is a highly unsaturated 22-membered macrocyclic polyene lactone phosphate ester and inhibits protein biosynthesis [23]. It has the ability to stimulate plant growth and suppress plant pathogenic organisms. The polyketide synthase dfn gene sequence exhibit reasonable colinearity with the polyketide structure to deduce a biosynthetic module [24]. Bacillaene gene cluster is assigned to the synthesis of the bacillaene polyketide synthase [19]. Apart from bacillaene and difficidin, a third polyketides with a macrolide-like structure, macrolactin which is produced by B. amyloliquefacins FZB42 contains three separate diene structure elements in a 24-membered lactrone ring [25]. It is found effective against bacterial pathogens [5]. Polyketides synthase difficidin, bacillaene [26], and macrolactin [27]) are found in the genome of B. amyloliquefaciens FZB42 and these gene clusters involved in the polyketides synthesis together spanning nearly 200 kb [28]. These polyketide antibiotics have a very good potential to utilize in plant disease management. There is a need to develop a technique to quickly screen potential polyketide antibiotics-producing strains of bacteria to apply for plant disease management, particularly bacterial plant diseases. In addition to this, it is also required to study the role of individual polyketide antibiotics in plant disease control, particularly the mechanism of suppression of bacterial pathogens.
The present investigations were undertaken to develop multiplex PCR-based marker for the detection of polyketides-producing strains of Bacillus spp. from soil samples and also study the role of polyketides antibiotics in the mechanism of antibiosis of Bacillus amyloliquefaciens in the suppression of bacterial wilt disease of tomato caused by R. pseudosolanacearum.

2. Materials and Methods

2.1. Collection of Soil Sample and Bacterial Culture

Tomato rhizospheric soil samples were collected from five states such as Uttarakhand, Meghalaya, Jharkhand, West Bengal and Odisha and one union territory Jammu & Kashmir, of India. The plants were carefully removed from the soil and the whole plants with adherent soil were kept in plastic bags for isolation of soil DNA. Bacterial cultures viz., Ralstonia pseudosolanacearum UTT-25, Bacillus amyloliquefaciens DSBA-11, B. subtilis DTBS-5, B. cereus JHTBS-7 and B. licheniformis DTBL-6 were obtained from Division of Plant Pathology, ICAR- Indian Agricultural Research Institute, New Delhi. B. pumilus MTCC-7092 was procured from MTCC, Institute of Microbial Technology, Chandigarh, India.

2.2. Antagonistic Ability of Bacillus spp. against R. pseudosolanacearum under In Vitro Conditions

The comparative antagonistic ability of Bacillus species viz., B. amyloliquefaciens DSBA-11, B. cereus JHTBS-7, B. pumilus MTCC-7092, B. subtilis DTBS-5 and B. licheniformis DTBL-6 were studied against bacterial wilt pathogen R. pseudosolanacearum using dual culture technique as described by Singh et al. [6] under in vitro conditions. The bacteria were grown in nutrient sucrose broth medium at 28 ± 1 °C for 48 h and maintained bacterial inoculums of 0.1 OD at 600 nm by spectrophotometer (UV-VIS Spectrophotometer, Hitachi, U-2900). A 100 µL culture of R. pseudosolanacearum was spread onto the Petri plates containing nutrient sucrose agar medium to make a lawn of the bacteria on the medium with three replications. Three wells of 5 mm diameter in each Petri plate were made with the help of a sterilized cork borer and poured 40 µL of 48 h old culture of Bacillus species separately containing 0.1 OD (at 600 nm) of bacterial populations into each well. The inoculated plates were kept at 28 ± 1 °C for 48 h to form an inhibition zone. The inhibition zone formed by antagonistic bacteria was measured in diameter and converted into an inhibition zone area by using the formula πr2.

2.3. DNA Isolation from Bacteria

Soil samples were collected from the rhizosphere of tomatoes from Jharkhand, Odisha, West Bengal, Jammu and Kashmir, Meghalaya and Uttarakhand. The DNA of the soil was extracted by using PowerSoil DNA isolation Kits (MO BIO Laboratories, Inc.), Carlsbad, CA, USA. 0.25 g of soil sample was taken in PowerBead tubes and gently mixed, and 60 µL of solution C1 was added in each tube and vortex briefly as instruction described by the manufacturer. The extracted DNA was quantified by nanodrop for further use in PCR for the detection of bacteria-producing polyketides antibiotics. The genomic DNA of bacteria was extracted by the method described by Murry and Thompson (1980) [29].

2.4. Primer Designing

The three sets of primers were designed for polyketide antibiotic synthase genes viz; macrolactin, (mln-F and mln-R) difficidin (dfn-F and dfn-R) and bacillaene (bae-F and bae-R) from the full genome sequence of Bacillus amyloliquefaciens FZB-42 (Accession No. AJ634062.2) obtained from NCBI database by using Primer 3 program (www.frodo.wi.nit.edu (accessed on 12 October 2015) having product size of 792 bp, 705 bp and 616 bp respectively (Table 1). The specificity of these primers was checked by in-silico analysis using the website (www.insilico.ehu.es; accessed on 27 October 2015). The developed primers were validated for their universality cross B. amyloliquefaciens and other related groups of bacteria by primer blasting on the NCBI website (www.ncbi.nlm.nih.gov;accessed on 3 November 2015).

2.5. Standardization of Protocol for Multiplex-PCR

A PCR protocol was standardized for the simultaneous detection of polyketide antibiotic viz; difficidin, macrolactin and bacillaene-producing strains of Bacillus spp. were used to amplify from obtained template in a reaction mixture of 5 X taq buffers, 1.5 U taq polymerase (Promega), 10 mM dNTPs, 25 mM MgCl2, 1 µL of each forward and reverse primers (10 µM),1 µL of DNA (100 ng) and sterile doubled distilled water in a final volume of 25 µL. The thermocycling conditions were slightly modified and consisted of one initial denaturation step of 95 °C for 5 min, followed by 32 amplification cycles of 95 °C for 30 s, 52 °C for 45 s and 72 °C for 1 min and a final extension step of 72 °C for 8 min using a BIO-RAD C1000 thermocycler. The PCR products were resolved by using a 1.5% agarose gel stained with ethidium bromide and photographed using the gel documentation system (BIO-RAD, GEL DOCTM XRþ). The detection threshold of multiplex- PCR primer sets of polyketide genes was determined by diluting up to 10−3 of genomic DNA (100 ng) of B. amyloliquefaciens DSBA-11. 1.0 µL of aliquots was used as DNA template. The specificity of these primer sets was tested by using DNA templates of B. subtilis DTBS-5, B. licheniformis DTBL-6, B. pumilus MTCC-7092, B. cereus JHTBS-7, Pseudomonas fluorescens DTPF-3, R. pseudosolanacearum UTT-25, and Xanthomonas campestris pv. campestris along with B. amyloliquefaciens DSBA-11 for multiplex PCR as described earlier.

2.6. Screening of Polyketides Antibiotics Producing Strains of Bacillus spp.

Polyketide antibiotics-producing strains of Bacillus spp. such as B. amyloliquefaciens KCBA-1, KCBA-2JHBA-1, JHBA-2, MPBA-1, MPBA-2, UKTBA-1, UKTBA-2, UKTBA-3, DSBA-11 and DSBA-12, B. subtilis (UTTBS-1, UTTBS-2 and UTTBS-3, DTBS-4, DTBS-5, MTCC-7258), B. cereus JHTBS-7, B. pumilus MTCC-7092 and B. licheniformis were screened through multiplex PCR. The reaction was performed in a final volume of 25 µL amplification reaction mixture, and visualization was done as described previously.

2.7. Detection of Polyketides Antibiotics Producing Strains from Soil

For the detection of polyketides, antibiotics genes from extracted soil DNA was used for 25 µL of the reaction mixture of 5X taq buffers, 1.5 U taq polymerase (Promega), 10 mM dNTPs, 25 mM MgCl2, 1 µL of each forward and reverse primers (10 µM) 1 µL of DNA (100 ng) and sterile doubled distilled water in a final volume of 25 µL. The thermocycling conditions were slightly modified and consisted of initial one denaturation step of 95 °C for 5 min, followed by 32 amplification cycles of 95 °C for 30 s, 52 °C for 0.45 s and 72 °C for 1 min and a final extension step of 72 °C for 8 min using a BIO-RAD C1000 thermocycler. The PCR products were resolved by using a 1.5% agarose gel stained with ethidium bromide and photographed using the gel documentation system (BIO-RAD, GEL DOCTM XRþ).

2.8. Molecular Characteization of Polyketides Genes in B. amyloliquefaciens DSBA-11

A study on the role of bacillaene, macrolactin and difficidin polyketides synthase genes produced by B. amyloliquefaciens (DSBA-11) was done for suppression of growth of R. pseudosolanacearum. Cloning was done by using T & A cloning vector (2.7 kb) with a competent cell of E. coli strain DH5α by following standard procedure as described by Sambrook et al. [30]. PCR products of these genes were purified by using RBC PCR purified kit. Transformation from ligation reaction, 10 µL of the reaction mixture was added to pre-aliquot competent cells (50 µL) and the tubes ‘contents were gently mixed and placed on ice for 30 min. The cells were heat shocked in a dry water bath at 42 °C for 2 min. The tubes were transferred immediately on ice for 2 min. 1.0 mL of LB (without antibiotics) was added and the tubes were incubated for 1.5–2.0 h at 37 °C in the shaker (200 rpm). The pellets were resuspended in a suspension 100 µL of fresh LB broth and the suspension was spread at 1X gal transformation plate with a selective medium 100 mL of Luria agar medium containing 100 µL of 50 mg/mL ampicillin, 20 µL of IPTG (200 µg/mL) and 200 µL of X-gal (20 µg/mL). The plates were incubated at 37 °C for overnight and blue and white colonies appeared in the plate, which was confirmed by colony PCR with their respective primers of each polyketide antibiotic gene.

2.9. Bio-Efficacy of Cloned Product under In Vitro Conditions

The dual culture method was used to study the comparative antagonistic ability of cloned product of polyketide synthase antibiotic genes, including macrolactin, bacillaene and difficidin (white colonies), non-cloned (blue colonies) along with parent strain B. amyloliquefaciens DSBA-11 against R. pseudosolanacearum UTT-25 under in vitro conditions. R. pseudosolanacearum was grown in a CPG broth medium for 48 h at 28 ± 1 °C [6] and maintained bacterial population (0.1 OD at 600 nm). 100 μL of bacterial culture was spread onto the Petri plates containing nutrient agar medium to make a lawn of bacteria. 0.5 cm diameter of three wells in each Petri plate was made with a sterilized cork borer and 40 μL of 48 h old culture of (cloned) products of these genes (non-cloned) product and DSBA-11 grown in the Luria broth contained a population of bacteria 0.1 OD was poured into each well separately. The plates were incubated at 28 ± 1 °C for 48 h and the inhibition zone was recorded. The value of the inhibition zone was converted into area of inhibition zone as described by Singh et al. [6].

2.10. Bacterial Viability Test

The R. pseudosolanacearum culture was treated with 10 and 50 µg/mL of cloned macrolactin, bacillaene, difficidin, B. amyloliquefaciens DSBA-11 and a mixture of these three polyketide antibiotic synthase genes to see the growth variation at different intervals 24 h, 48 h, 72 h, and 96 h after treatments and OD at 600 nm was taken by using UV-VIS Spectrophotometer, Hitachi (U-2900).

2.11. Mechanisms of Suppression of Bacterial Wilt Disease of Tomato

The cloned product of macrolactin, difficidin and bacillaene genes, B. amyloliquefaciens (DSBA-11) and non cloned product were tested against R. pseudosolanacearum under controlled conditions at National Phytotron Facility, IARI New Delhi. 21 days old tomato cv. Pusa Ruby seedlings were transplanted in the 6′ plastic pots having autoclaved soil mixture of peat moss, vermiculite and sand in the ratio of 2:1:1 at 25–30 °C. R. pseudosolanacearum UTT-25, B. amyloliquefaciens (DSBA-11), cloned and non-cloned colonies of bacteria were scraped from the plates containing LA (Luria Agar) medium and suspended in sterile distilled water and maintained the population of bacteria (0.1 OD at 600 nm). A 40 mL of 48 h old culture of R. pseudosolanacearum UTT-25 was inoculated at the root zone of each plant after 5 days of transplanting. Subsequently, 25 mL of 48 h old culture of antagonistic B. amyloliquefaciens (DSBA-11), cloned and non-cloned product of three polyketide antibiotic genes was inoculated at the root zone of each plant. The plants inoculated with R. pseudosolanacearum and un-inoculated plants were also maintained as the positive and negative control. Wilt disease intensity was recorded at 3 days intervals, up to 30 days. The wilt disease intensity and rating were calculated as per described by Schaad et al. [31], and biological control efficacy (BCE) of antagonistic bacteria was calculated as per Guo et al. [32], and Singh et al. [7].

2.11.1. Purification of Cloned Product of Polyketides Antibiotic Synthase Gene

To purify the cloned polyketide antibiotic genes of B. amyloliquefaciens DSBA-11, the colony was grown in an LB medium and incubated for 48 h. After that the liquid culture was eluted in 100% methanol by using GC/MS analysis on a Focus GC/MS (Thermo) equipped and DB-5 capillary column (30 m × 0.25 mm i.d., film thickness 0.25 μm). Chromatographic conditions were as follows: helium as carrier gas at a flow rate of 1 mL/min; injection volume was 1.0 μL (1000 ppm in acetone); injector temperature was 240 °C, respectively. The column temperature was held at 60 °C for 5 min., and programmed at 3 °C/min to 220 °C and held for 10 min with split mode (1:20). The MS transfer line and source temperatures were 240 °C and 220 °C. The analysis was carried out in EI mode at 70 eV with the mass range of 30–450 a.m.u at 1 scan/s. The individual cloned polyketides antibiotic genes were purified and the extracts were used for the bio-efficacy test against R. pseudosolanacearum.

2.11.2. TEM Studies

Transmission electron microscopy (TEM) analysis was used to determine the effect of the eluted cloned product of polyketide genes macrolactin; difficidin, and bacillaene on Ralstonia pseudosolanacearum UTT-25 cells at the ultra structural levels. R. pseudosolanacearum UTT-25 was treated with 50 µg/mL of these antibiotics along with parent B. amyloliquefaciens DSBA-11 and allowed them to grow for 14 h at 28 ± 1 °C. One drop of the sample was embedded on a copper grid having 400-mess for 1–2 min and thoroughly washed with sterile distilled water and then negative stain with 2% uranyl acetate and dried it. The grid was visualized under transmission electron microscope (TEM) model no-Jeol-1011.

2.11.3. Statistical Analysis

The data was analyzed using Fisher’s least significant differences (LSD) to determine the significant differences between treatments at p< 0.05 level.

3. Results

3.1. In Vitro Studyon Antagonistic Ability of Bacillus spp. against R. pseudosolanacearum

Five Bacillus species viz., Bacillus amyloliquefaciens DSBA-11, B. cereus JHTBS-7, B. pumilus MTCC-7092, B. subtilis DTBS-5 and B. licheniformis DTBL-6 were used against R. pseudosolanacearum UTT-25 under in vitro conditions. A significant variation (CD value (5%): 0.355, CV: 7.14%) was recorded among the species of Bacillus to form an inhibition area against R. pseudosolanacearum. Maximum inhibition area against R. pseudosolanacearum was recorded in the treatment of B. amyloliquefaciens DSBA-11 (3.30 cm2) followed by B. subtilis DTBS-5 and B. licheniformis DTBL-6 after 48 h of incubation at 28 ± 1 °C (Figure 1).

3.2. Primer Specificity and Sensitivity

The primer sets viz. Mln-F &Mln-R, Dfn-F &Dfn-R and Bae-F & Dfn-R-based on the nucleotide sequence of macrolactin, difficidin and bacillaene genes of B. amyloliquefaciens amplified at 792 bp, 705 bp, and 616 bp respectively (Table 1). To check the specificity these primer sets, three banding pattern in B. amyloliquefaciens strains were obtained at 792 bp, 705 bp and 616 bp by amplifying macrolactin, difficidin, and bacillaene polyketide synthase genes respectively. B. subtilis strains DTBS-4 & DTBS-5 amplified macrolectin, and difficidin synthase genes at 792 bp and 705 bp, respectively. However, these primer pairs of polyketide antibiotic synthase genes did not give amplification with other Bacillus spp. like B. pumilus MTCC 7092, B. licheniformis DTBL-6 and B. cereus JHTBS-7, P. fluorescens DTPF-3, R. pseudosolanacearum UTT-25 (Figure 2). Thus, these three sets of primers-based on macrolactin, difficidin and baciallene genes were specific for the detection of B. amyloliquefaciens. The diluted genomic DNA of B. amyloliquefaciens was used for the sensitivity of polyketide antibiotic synthase-based primers. These polyketide antibiotic synthase genes-based primers were able to detect low to 0.1 ng DNA concentrations of B. amyloliquefaciens (Figure 3).

3.3. Screening of Polyketides Antibiotics Producing Strains of Bacillus spp. through Multiplex PCR

A combination of two bands of macrolactin + bacillaene, bacillaene + difficidin and difficidin + macrolactin was also observed. However, the amplification of such type of banding pattern was lower. The positive control of B. amyloliquefaciens DSBA-11 and DSBA-12 showed amplification with these three primers sets and negative control did not produce any band. Out of twenty-three isolates of Bacillus spp., 11 isolates of B. amyloliquefaciens, 6 isolates of B. subtilis, three strains of B. cereus, one strain each of B. pumilus and B. licheniformis were screened using multiplex PCR. All the 11 isolates of B. amyloliquefaciens from different hosts namely KCBA-1, KCBA-2, JHBA-1, JHBA-2, MPBA-1, MPBA-2, UKBA-1, UKBA-2, UKBA-3, DSBA-11 andDSBA-12 were amplified at 792 bp, 702 bp and 616 bp (Table 2) and produced all three antibiotics; while B. subtilis isolates including UTTBS-1, UTTBS-2, UTTBS-3, DTBS-4, DTBS-5, B. subtilis MTCC 7258, were amplified two set of primers based on macrolactin and difficidin genes. Other species of Bacillus like B. pumilus, MTCC-7092, B. cereus JHTBS-7 and B. licheniformis DTBL-6, did not show amplification of these genes (Figure 4; Table 3).

3.4. Detection of Polyketides Gene from Soil DNA

Eighty-five samples were collected from six states of India to detect polyketide-producing strains of Bacillus spp. Maximum 73.3% of soil samples collected from West Bengal showed potential to amplify with all these primers followed by Uttarakhand (70.0%) and Jammu and Kashmir (66.7%) (Table 3; Figure 5).

3.5. Bio-Efficacy of Cloned Product of Polyketides Antibiotics Producing Gene under In Vitro Conditions

The polyketides antibiotic synthase gene difficidin, macrolactin and bacillaene of B. amyloliquefaciens was cloned cloning and confirmed by colony PCR by using their respective genes with the standard PCR protocol with their respective primers to amplified at 792 bp 705 bp and 616 bp respectively. The cloned product of these genes suppressed the growth of R. pseudosolanacearum significantly under in vitro conditions. Maximum growth inhibition of R. pseudosolanacearum was found in parent B. amyloliquefaciens DSBA-11 3.30 cm2 of inhibition zone of R. pseudosolanacearum. However, the cloned product of bacillaene, macrolactin and difficidin formed 1.9, 1.9 and 1.7 cm2 of inhibition zone area under in vitro conditions, respectively (Figure 6B–D). However, these genes alone made less inhibition zone as compared to their parent. A significant variation in the growth of R. pseudosolanacearum was recorded in different antibiotic treatments. The growth of bacteria was increased by increasing the duration of incubation in all the treatments, including control significantly (Table 4).

3.6. Morphological and Ultrastructural Changes of R. pseudosolanacearum Cells in the Presence of Polyketide Antibiotics

Visualization of the cellular damage caused to R. pseudosolanacearum UTT-25 at the ultrastructural level by difficidin, macrolactin and bacillaene was undertaken through TEM analysis (Figure 7). In this study, untreated control cell of R. pseudosolanacearum UTT-25 appeared intact, typically rod-shaped with smooth exterior (Figure 7A). Upon exposure to difficidin, macrolactin and bacillaene antibiotics, the cells of R. pseudosolanacearum became loose and diffused with their normal shape and even ruptured (Figure 7B–F). After treatment of R. pseudosolanacearum UTT-25 with these polyketide antibiotics, the lysis of the bacterial cells was clearly visible and resulted in plasmolysis and efflux of intracellular components.

3.7. Effect of Polyketide Antibiotic-Producing B. amyloliquefaciens for Control of Bacterial Wilt

The mechanism of suppression of wilt disease in tomato, the cloned product of bacillaene, difficidin and macrolactin genes along with their parent B. amyloliquefaciens DSBA-11 and the non-cloned product was inoculated to the plant. A minimum 29.3% of wilt intensity in tomato plants was recorded in treated with B. amyloliquefaciens DSBA-11 under glasshouse conditions. The treatment of cloned product of difficidin, macrolactin and bacillaene synthase genes of B. amyloliquefaciens DSBA-11 significantly suppressed 39.3, 46.0, and 50.7% of wilt intensity in tomato cv Pusa Ruby after 30 days of R. pseudosolanacearum UTT-25 inoculation respectively (Table 4). However, the wilt intensity was found to be lower in cloned products of polyketide antibiotic synthase genes than control (69.3%). The non-cloned colony of bacteria slightly showed low wilt intensity in tomato as compared to control but lower than the cloned product.

3.8. Effect of Macrolactin, Difficidin and Bacilysin on Viability of R. pseudosolanacearum Cells

Growth of R. pseudosolanacearum UTT-25 treated with crude ethyl acetate extract of polyketide of these antibiotics genes produced by B. amyloliquefaciens DSBA-11 and its cloned products in broth culture was measured by using optical density measurements at 600 nm (Table 5). Minimum growth of R. pseudosolanacearum was found at 50 µg/mL of a mixtures of macrolactin + difficidin + bacillaene 0.063 OD (at 600 nm) after 24 h of incubation followed by B. amyloliquefaciens DSBA-11 (0.071 OD) and difficidin (0.071 OD) under in vitro conditions. The growth of R. pseudosolanacearum UTT-25 was inhibited by increasing the concentration of polyketide antibiotic products.

4. Discussion

Bacterial wilt of solanaceous crop caused by Ralstoniapseudosolanacearum UTT-25 is a serious problem across the world. For the control of wilt disease, we selected Bacillus spp. particularly polyketide antibiotic-producing strains of Bacillus spp. as earlier, it was reported that Bacillus spp. produced 200 peptide antibiotics (Lisboa et al. [33]), and approximately 8.5% genome of B. amyloliquefaciens FZB 42 are dedicated to secondary metabolite production (Chen et al. [5]. Selection of potential antibiotic-producing strains of Bacillus spp., the individual gene had been targeted to design primer for detection like iturin. (6)], and bacillaene [34]. In this study, we targeted three polyketide antibiotic synthase genes viz., macrolactin, difficidin and bacillaene for developing a multiplex-PCR protocol to detect polyketide antibiotic-producing strains of Bacillus spp. We developed and standardized a protocol for detecting and screening of polyketide-producing strains of Bacillus spp. by using multiplex—PCR, based on these genes, which is rapid, accurate and highly sensitive. To the best of our knowledge, this is the first attempt to develop a protocol for simultaneous detection of these three polyketide antibiotic-producing strains of Bacillus spp. particularly B. amyloliquefaciens. We screened polyketide antibiotic-producing strains of Bacillus spp. including B. amyloliquefaciens, B. subtilis, B. cereus, B. pumilus, and B. licheniformis using multiplex- PCR and among them, the Isolates of B. amyloliquefaciens contained macrolactin, bacillaene and difficidin polyketide synthase antibiotic genes, while B. subtilis contained difficidin and macrolactin synthase antibiotic genes. In contrast to our results, Butchner et al. [34] reported that approximately 80 kb pksX gene cluster in B. subtilis encode an unusual hybrid polyketide that has been linked to the production of the uncharacterized antibiotic bacillaene.
The most attention has been paid to polyketide antibiotics such as bacillaene, difficidin and macrolactin for their role in the inhibition of bacterial growth and inducing plant resistance against the bacterial pathogen [35] and difficidin and bacilysin [36]. Antibiotics produced by the strains of different bacterial genera, biosynthetic genes have been cloned partially and sequenced. However, B. amyloliquefaciens FZB 42 is a producer of three families of lipopeptides, surfactin, bacillomycin D, and fengycin, which are well-known secondary metabolites with mainly antifungal and bacterial activities. They are also produced by numerous B. subtilis strains. Furthermore, three giant gene clusters containing genes with homology to polyketide synthase (PKS) genes have been identified but did not assign functional roles. Polyketides belong to a large family of secondary metabolites that include many bioactive compounds with antibacterial, immune suppressive, antitumor, or other physiologically relevant bioactivities. Three functional gene clusters directing the synthesis of difficidin, bacillaene, and macrolactin have been identified in B. amyloliquefaciens strains as earlier reported by Chen et al. [5]. Further, polyketide mega synthesis responsible for synthesis of bacillaene, macrolactin and difficidin are encoded by these giant gene clusters that are located at different sites of the B. amyloliquefaciens genome [35]. Difficidin inhibits protein synthesis and possibly also damages the cell membrane [36,37]. Polyketide synthase (PKSs) gene clusters has also been identified that directed the synthesis of polyketides (PKs), e.g., macrolactin (mln), bacillaene (bae), and difficidin in B. amyloliquefaciens subsp. plantarum FZB42 [38]. The present study showed the antagonistic ability of cloned products of macrolactin, bacillaene and difficidin along with parent DSBA-11, which showed an inhibitory effect on the growth of R. pseudosolanacearum and also suppressed wilt disease in tomatoes. We cloned macrolactin, difficidin and bacillaene genes of B. amyloliquefaciens DSBA-11 and we observed that the product of these genes and parent DSBA-11 damaged the cell wall and cell membrane of R. pseudosolanacearum, which were visualized under TEM (Figure 4). Similar results have also been reported by Wu et al. [36]. The findings were corroborative to earlier reports on difficidin, which acts as antibacterial activity against Xanthomonas oryzae pv. oryzae and X. oryzae pv. oryzicola causing bacterial leaf blight and bacterial streak disease in rice, respectively. Although, no significant variation was found in the cloned products to inhibit the growth of R. pseudosolanacearum under in vitro conditions. However, difficidin was found to be the best among these tested polyketide antibioticsto suppress the bacterial wilt disease in tomatoes. Moreover, these cloned products showed less biocontrol efficacy than parent strain DSBA-11 (57.22%). A similar finding was earlier reported by Chen et al. [35] against E. amylovora, causing fire blight in pears and apples. They stated that difficidin is the most efficient antibacterial compound in FZB42. Our present finding reveals that the B. amyloliquefaciens DSBA-11 contains these three polyketide antibiotics, which are able to inhibit the growth of R. pseudosolanacearum under in vitro conditions by forming an inhibition zone and reduce wilt disease in tomatoes significantly. Further, structural and functional characterization of these polyketide antibiotic synthase genes is required for a detailed study.

5. Conclusions

The following conclusions can be drawn from the study results:
1. Bacillus amyloliquefaciens DSBA-11 showed the best antagonistic ability against R. pseudosolanacearum UTT-25 under in vitro and in vivo conditions.
2. A multiplex—PCR protocol based on polyketide synthase genes i.e.,macrolactin, difficidin and bacillaene genes, was developed to identify and detect potential antagonistic strains of B. amyloliquefaciens within a short period of time with high accuracy and sensitivity.
3. Bacillus amyloliquefaciens DSBA-11 provides a potential option to use these polyketide antibiotics as an alternative to chemical bactericides to control wilt disease of solanaceous crops.
4. There is a need to study the mechanism of polyketide antibiotic synthase genes viz., macrolactin, difficidin and bacillaene using high throughput molecular techniques.

Author Contributions

D.S. conceived and designed the experiments. V.D. did the planning and edited the manuscript. D.K.Y. performed most of the experiments such as screening of antibiotics genes and cloning of polyketide antibiotic synthase genes. All authors have read and agreed to the published version of the manuscript.

Funding

The funds received from the Outreach project on Phytophthora, Fusarium and Ralstonia Diseases of Horticultural and Field Crops sponsored by ICAR, New Delhi for conducting various experiments.

Acknowledgments

The authors are grateful to the Indian Council of Agricultural Research, New Delhi, to giving financial assistance under outreach project on Phytophthora, Fusarium and Ralstonia Diseases of Horticultural and Field Crops sponsored by ICAR, New Delhi for conducting these experiments. The authors are also thankful to the Head, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi, for helping throughout the experimentation.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Yabuuchi, E.; Kosako, Y.; Yano, I.; Hotta, I.; Nishiucliy, Y. Transfer of two Burkholderia and an Alcaligenes species to Ralstonia General Nov: Proposal of Ralstoniapikettii (Ralston, Palleroni and Doudoroff 1973) Comb. Nov, Ralstonia solanacearum (Smith1896) Comb. Nov. Microbiol. Immunol. 1995, 39, 897–904. [Google Scholar] [CrossRef] [PubMed]
  2. Devi, R.L.; Menon, M.R. Seasonal incidence of bacterial wilt of tomato. Indian J. Microbiol. 1980, 20, 13–15. [Google Scholar]
  3. Singh, D.; Sinha, S.; Yadav, D.K.; Sharma, J.P.; Srivastava, D.K. Characterization of biovar/races of Ralstonia solanacearum, the incitant of bacterial wilt in solanaceous crops. Indian Phytopath 2010, 63, 261–265. [Google Scholar]
  4. Myint, L.; Ranamukhaarachchi, S.L. Development of biological control of Ralstonia solanacearum through antagonistic microbial populations. Inter. J. Agric. Biol. 2006, 8, 657–660. [Google Scholar]
  5. Chen, X.H.; Koumoutsi, A.; Scholz, R.; Borriss, R. More than anticipated-production of antibiotics and other secondary metabolites by Bacillus amyloliquefaciens FZB42. J. Mol. Microbiol. Biotechnol. 2009, 16, 14–24. [Google Scholar] [CrossRef] [PubMed]
  6. Singh, D.; Yadav, D.K.; Shweta, S.; Mondal, K.K.; Singh, G.; Pandey, R.R.; Singh, R. Genetic diversity of iturin producing strains of Bacillus species antagonistic to Ralstonia solanacearum causing bacterial wilt disease in tomato. Afr. J. Microbiol. Res. 2013, 7, 5459–5470. [Google Scholar]
  7. Singh, D.; Yadav, D.K.; Chaudhary, G.; Rana, V.S.; Sharma, R.K. Potential of Bacillus amyloliquefaciens for biocontrol of bacterial wilt of tomato incited by Ralstoniapseudosolanacearum. J. Plant Pathol. Microbiol. 2016, 7, 327. [Google Scholar] [CrossRef]
  8. Nguyen, M.T.; Ranamukhaarachchi, S.L. Soil-borne antagonists for biological control of bacterial wilt disease caused by Ralstonia solanacearum in tomato and pepper. J. Plant Pathol. 2010, 92, 395–406. [Google Scholar]
  9. Nguyen, M.T.; Ranamukhaarachch, S.L.; Hannaway, D.B. Efficacy of antagonist strains of Bacillus megaterium, Enterobacter cloacae, Pichia guilliermondii and Candida ethanolica against bacterial wilt disease of tomato. J. Phytol. 2011, 3, 1–10. [Google Scholar]
  10. Tan, S.; Jiang, Y.; Song, S.; Huang, J.; Ling, N.; Xu, Y.; Shen, Q. Two Bacillus amyloliquefaciens strains isolated using the competitive tomato root enrichment method and their effects on suppressing Ralstonia solanacearum and promoting tomato plant growth. Crop Prot. 2013, 43, 134–140. [Google Scholar] [CrossRef]
  11. Haas, D.; Geneviève, D. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat. Rev. Microbiol. 2005, 4, 307–319. [Google Scholar] [CrossRef]
  12. Nihorimbere, V.; Ongena, M.; Cawoy, H.; Brostaux, Y.; Kakana, P.; Jourdan, E.; Thonart, P. Beneficial effects of Bacillus subtilis on field-grown tomato in Burundi: Reduction of local Fusarium disease and growth promotion. Afr. J. Microbiol. Res. 2010, 4, 1135–1142. [Google Scholar]
  13. Zhang, R.S.; Liu, Y.F.; Luo, C.P.; Wang, X.Y.; Liu, Y.Z.; Qiao, J.Q.; Yu, J.J.; Chen, Z.Y. Bacillus amyloliquefaciens lX-11, a potential biocontrol agent against rice bacterial leaf streak. J. Plant Pathol. 2012, 94, 609–619. [Google Scholar]
  14. Chowdhury, S.P.; Dietel, K.; Rändler, M.; Schmid, M.; Junge, H.; Borriss, R.; Hartmann, A.; Grosch, R. Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere bacterial community. PLoS ONE 2013, 8, e68818. [Google Scholar] [CrossRef] [Green Version]
  15. Rea, M.C.; Sit, C.S.; Clayton, E.; O’Connor, P.M.; Whittal, R.M.; Zheng, J.; Vederas, J.C.; Ross, R.P.; Hill, C. Thuricin CD, a post translationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile. Proc. Natl. Acd. Sci. USA 2010, 107, 9352–9357. [Google Scholar] [CrossRef] [Green Version]
  16. Stein, T. Bacillus subtilis antibiotics: Structures, syntheses and specific functions. Mol. Microbiol. 2005, 56, 845–857. [Google Scholar] [CrossRef]
  17. Ramarathnam, R.; Bo, S.; Chen, Y.; Fernando, W.D.; Xuewen, G.; De Kievit, T. Molecular and biochemical detection of fengycin and bacillomycin D producing Bacillus spp., antagonistic to fungal pathogens of canola and wheat. Can. J. Microbiol. 2007, 53, 901–911. [Google Scholar] [CrossRef] [Green Version]
  18. Arguelles-Arias, A.; Ongena, M.; Halimi, B.; Lara, Y.; Brans, A.; Joris, B.; Fickers, P. Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens. Microbial. Cell Factories 2009, 8, 63–74. [Google Scholar] [CrossRef]
  19. Chen, X.H.; Scholz, R.; Borriss, M.; Junge, H.; Mögel, G.; Kunz, S.; Borriss, R. Difficidin and bacilysin produced by plant-associated Bacillus amyloliquefaciens Dare efficient in controlling fire blight disease. J. Biotechnol. 2009, 140, 38–44. [Google Scholar] [CrossRef] [Green Version]
  20. Tamehiro, N.; Okamoto-Hosoya, Y.; Okamoto, S.; Ubukata, M.; Hamada, M.; Hiroshi, N.; Ochi, K. Bacilysocin, a novel phospholipid antibiotic produced by Bacillus subtilis 168. Antimicrob. Agents Chemother. 2002, 46, 315–320. [Google Scholar] [CrossRef] [Green Version]
  21. Inaoka, T.; Ochi, K. Glucose uptake pathway-specific regulation of synthesis of neotrehalosadiamine, a novel auto inducer produced in Bacillus subtilis. J. Bacteriol. 2007, 189, 65–75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Pinchuk, I.V.; Bressollier, P.; Sorokulova, I.B.; Verneuil, B.; Urdaci, M.C. Amicoumacin antibiotic production and genetic diversity of Bacillus subtilis strains isolated from different habitats. Res. Microbiol. 2002, 153, 269–276. [Google Scholar] [CrossRef] [PubMed]
  23. Wilson, K.; Flor, J.E.; Schwartz, R.E.; Joshua, H.; Smith, J.L.; Pelak, B.A.; Liesch, J.M.; Hensens, O.D. Difficidin and oxydifficidin: Novel broad spectrum antibacterial antibiotics produced by Bacillus subtilis. II. Isolation and physico-chemical characterization. J. Antibiot. 1987, 40, 1682–1691. [Google Scholar]
  24. Chen, X.H.; Vater, J.; Piel, J.; Franke, P.; Scholz, R.; Schneider, K.; Koumoutsi, A.; Hitzeroth, G.; Grammel, N.; Strittmatter, A.W.; et al. Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB42. J. Bact. 2006, 188, 4024–4036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Gustafson, K.; Roman, M.; Fenical, W. The macrolactins, a novel class of antiviral and cytotoxic macrolides from a deep-sea marine bacterium. J. Am. Chem. Soc. 1989, 111, 7519–7524. [Google Scholar] [CrossRef]
  26. Hofemeister, J.; Conrad, B.; Adler, B.; Hofemeister, B.; Feesche, J.; Kucheryava, N.; Steinborn, G.; Franke, P.; Grammel, N.; Zwintscher, A.; et al. Genetic analysis of the biosynthesis of non-ribosomal peptide- and polyketide-like antibiotics, iron uptake and biofilm formation by Bacillus subtilis A1/3. Mol. Genet. Genom. 2004, 272, 363–378. [Google Scholar] [CrossRef]
  27. Jaruchoktaweechai, C.; Suwanborirux, K.; Tanasupawatt, S.; Kittakoop, P.; Menasveta, P. New macrolactins from a marine Bacillus sp. Sc026. J. Nat. Prod. 2000, 63, 984–986. [Google Scholar] [CrossRef]
  28. Koumoutsi, A.; Chen, X.H.; Henne, A.; Liesegang, H.; Hitzeroth, G.; Franke, P.; Vater, J.; Borriss, R. Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciensstrain FZB42. J. Bacteriol. 2004, 186, 1084–1096. [Google Scholar] [CrossRef] [Green Version]
  29. Murry, M.G.; Thompson, W.F. Rapid isolation of high molecular weight DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef]
  30. Sambrook, J.; Fritsch, E.R.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
  31. Schaad, N.W.; Jones, J.B.; Chun, W. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, 3rd ed.; American Phytopathological Society: St Paul, MN, USA, 2001; p. 373. [Google Scholar]
  32. Guo, J.H.; Qi, H.Y.; Guo, Y.H.; Ge, H.L.; Gong, L.Y.; Zhang, L.X.; Sun, P.H. Biocontrol of tomato wilt by plant growth promoting rhizobacteria. Biol. Control 2004, 29, 66–72. [Google Scholar] [CrossRef]
  33. Lisboa, M.P.; Bonatto, D.; Bizani, D.; Henriques, J.A.; Brandelli, A. Characterization of a bacteriocin-like substance produced by Bacillus amyloliquefaciens isolated from the Brazilian Atlantic forest. Int. Microbiol. 2006, 9, 111–118. [Google Scholar]
  34. Butcher, R.A.; Schroeder, F.C.; Fischbach, M.A.; Straight, P.D.; Kolter, R.; Walsh, C.T.; Clardy, J. The identification of bacillaene, the product of the pks X megacomplex in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 2007, 104, 1506–1509. [Google Scholar] [CrossRef] [Green Version]
  35. Chen, X.H.; Koumoutsi, A.; Scholz, R.; Eisenreich, A.; Schneider, K.; Heinemeyer, I.; Morgenstern, B.; Voss, B.; Hess, W.R.; Reva, O.; et al. Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nat. Biotechnol. 2007, 25, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
  36. Wu, L.; Wu, H.; Chen, L.; Yu, X.; Borriss, R.; Gao, X. Difficidin and bacilysin from Bacillus amyloliquefaciens FZB42 have antibacterial activity against Xanthomonas oryzae rice pathogens. Sci. Rep. 2015, 5, 12975. [Google Scholar] [CrossRef] [Green Version]
  37. Zweerink, M.; Edison, A. Difficidin and oxydifficidin: Novel broad spectrum antibacterial antibiotics produced by Bacillus subtilis. III. Mode of action of difficidin. J. Antibiotic 1987, 40, 1692–1697. [Google Scholar] [CrossRef] [Green Version]
  38. FazleRabbee, M.; Baek, K.H. Antimicrobial activities of lipopeptides and polyketides of Bacillus velezensis for agricultural applications. Molecules 2020, 25, 4973. [Google Scholar] [CrossRef]
Agriculture 12 02009 g001 550
Figure 1. The antagonistic ability of Bacillus spp. against R. pseudosolanacearum under in vitro conditions.
Figure 1. The antagonistic ability of Bacillus spp. against R. pseudosolanacearum under in vitro conditions.
Agriculture 12 02009 g001
Agriculture 12 02009 g002 550
Figure 2. Simultaneous amplification of three polyketide antibiotic synthase genes i.e., difficidin, macrolactin and bacillaene of Bacillus at 705 bp, 792 bp and 616 bp using multiplex—PCR for primer specificity, respectively. Lane 1; M. 100 bp DNA Ladder: Lane 1: B. amyloliquefaciens DSBA-11; 2: B. amyloliquefaciens DSBA-12; 3: B. subtilis (DTBS-4); 4 B. subtilis DTBS-5; 5: B. pumilus MTCC-7092; 6: B. licheniformis DTBL-6; 7: B. cereus (JHTBS-7); 8: Pseudomonas fluorescens DTPF-3; 9: R. pseudosolanacearum UTT-25; 10: -ve control.
Figure 2. Simultaneous amplification of three polyketide antibiotic synthase genes i.e., difficidin, macrolactin and bacillaene of Bacillus at 705 bp, 792 bp and 616 bp using multiplex—PCR for primer specificity, respectively. Lane 1; M. 100 bp DNA Ladder: Lane 1: B. amyloliquefaciens DSBA-11; 2: B. amyloliquefaciens DSBA-12; 3: B. subtilis (DTBS-4); 4 B. subtilis DTBS-5; 5: B. pumilus MTCC-7092; 6: B. licheniformis DTBL-6; 7: B. cereus (JHTBS-7); 8: Pseudomonas fluorescens DTPF-3; 9: R. pseudosolanacearum UTT-25; 10: -ve control.
Agriculture 12 02009 g002
Agriculture 12 02009 g003 550
Figure 3. Sensitivity of the primers designed based on three polyketide antibiotic synthase genes i.e., difficidin, macrolactin and bacillaene of Bacillus amplified at 705 bp, 792 bp and 616 bp using multiplex–PCR, respectively. Lane M: 100 bp DNA Ladder: Lane 1: 100 ng/µL DNA of B. amyloliquefaciens (DSBAS-11); 2: 10 ng/µL; 3: 1.0 ng/µL; 4: 0.1 ng/µL 5: -ve control.
Figure 3. Sensitivity of the primers designed based on three polyketide antibiotic synthase genes i.e., difficidin, macrolactin and bacillaene of Bacillus amplified at 705 bp, 792 bp and 616 bp using multiplex–PCR, respectively. Lane M: 100 bp DNA Ladder: Lane 1: 100 ng/µL DNA of B. amyloliquefaciens (DSBAS-11); 2: 10 ng/µL; 3: 1.0 ng/µL; 4: 0.1 ng/µL 5: -ve control.
Agriculture 12 02009 g003
Agriculture 12 02009 g004 550
Figure 4. Detection Bacillus species using multiplex- PCR based on polyketides genes i.e., difficidin, macrolactin and bacillaene of Bacillus amplified at 705 bp, 792 bp and 616 bp respectively. Lane M. 100 bp DNA Ladder: lane 1: KCBA-1, 2: KCBA-2, 3: JHBA-1, 4: JHBA-2, 5: MPBA-1, 6: MPBA-2, 7: UKBA-1, 8: UKBA-2, 9: UKBA-3,10: B. amyloliquefaciens DSBA-11, 11: B. amyloliquefaciens DSBA-11 12: UTTBS-1, 13: UTTBS-2, 14: UTTBS-3, 15: DTBS-4, 16: DTBS-5, 17: B. subtilis MTCC 7258, 18: B. cereus JHTBS-7, 19: B. pumilus MTCC-7092, 20: B. licheniformis DTBL -6, 21: Negative control.
Figure 4. Detection Bacillus species using multiplex- PCR based on polyketides genes i.e., difficidin, macrolactin and bacillaene of Bacillus amplified at 705 bp, 792 bp and 616 bp respectively. Lane M. 100 bp DNA Ladder: lane 1: KCBA-1, 2: KCBA-2, 3: JHBA-1, 4: JHBA-2, 5: MPBA-1, 6: MPBA-2, 7: UKBA-1, 8: UKBA-2, 9: UKBA-3,10: B. amyloliquefaciens DSBA-11, 11: B. amyloliquefaciens DSBA-11 12: UTTBS-1, 13: UTTBS-2, 14: UTTBS-3, 15: DTBS-4, 16: DTBS-5, 17: B. subtilis MTCC 7258, 18: B. cereus JHTBS-7, 19: B. pumilus MTCC-7092, 20: B. licheniformis DTBL -6, 21: Negative control.
Agriculture 12 02009 g004
Agriculture 12 02009 g005 550
Figure 5. Detection of Bacillus species from soil samples collected from different states of India by using multiplex- PCR based on polyketide antibiotic synthase genes i.e., difficidin, macrolactin and bacillaene of Bacillus amplified at 705 bp, 792 bp and 616 bp respectively. Lane; M. 100 bp DNA Ladder: lane 1–2: B. amyloliquefaciens DSBA-11 and DSBA-12; 3: West Bengal; 4: Jharkhand; 5: Odisha; 6: Meghalaya; 7: Uttarakhand; 8: J&K; 9: -ve control.
Figure 5. Detection of Bacillus species from soil samples collected from different states of India by using multiplex- PCR based on polyketide antibiotic synthase genes i.e., difficidin, macrolactin and bacillaene of Bacillus amplified at 705 bp, 792 bp and 616 bp respectively. Lane; M. 100 bp DNA Ladder: lane 1–2: B. amyloliquefaciens DSBA-11 and DSBA-12; 3: West Bengal; 4: Jharkhand; 5: Odisha; 6: Meghalaya; 7: Uttarakhand; 8: J&K; 9: -ve control.
Agriculture 12 02009 g005
Agriculture 12 02009 g006 550
Figure 6. Inhibition zone formed by clone product of polyketide antibiotic synthase genes of Bacillus amyloliquefaciens DSBA-11 against R. pseudosolanacearum. (A) B. amyloliquefaciens DSBA-11 (Wild strain) (B) clone of difficidin gene (C) clone of macrolactin gene (D) bacillaene gene.
Figure 6. Inhibition zone formed by clone product of polyketide antibiotic synthase genes of Bacillus amyloliquefaciens DSBA-11 against R. pseudosolanacearum. (A) B. amyloliquefaciens DSBA-11 (Wild strain) (B) clone of difficidin gene (C) clone of macrolactin gene (D) bacillaene gene.
Agriculture 12 02009 g006
Agriculture 12 02009 g007 550
Figure 7. Ultrastructural effect of 50 μg/mL concentration of difficidin, bacillaene and macrolactin, of B. amyloliquefaciens DSBA-11 and mixture of difficidin, bacillyene, macrolactin on R. pseudosolanacearum cells after 14 h determined by TEM. (A) an untreated R. solanacearum cell (B) R. pseudosolanacearum treated with macrolactin (C) R. pseudosolanacearum treated with difficidin (D) R. pseudosolanacearum treated with bacillaene (E) R. pseudosolanacearum treated with Parent B. amyloliquefaciens DSBA-11 (F) R. pseudosolanacearum treated with a mixture of bacillaene, macrolactin and difficidin. Bars: 0.5 µm.
Figure 7. Ultrastructural effect of 50 μg/mL concentration of difficidin, bacillaene and macrolactin, of B. amyloliquefaciens DSBA-11 and mixture of difficidin, bacillyene, macrolactin on R. pseudosolanacearum cells after 14 h determined by TEM. (A) an untreated R. solanacearum cell (B) R. pseudosolanacearum treated with macrolactin (C) R. pseudosolanacearum treated with difficidin (D) R. pseudosolanacearum treated with bacillaene (E) R. pseudosolanacearum treated with Parent B. amyloliquefaciens DSBA-11 (F) R. pseudosolanacearum treated with a mixture of bacillaene, macrolactin and difficidin. Bars: 0.5 µm.
Agriculture 12 02009 g007
Table
Table 1. List of polyketides primer sets used for multiplex PCR under this study.
Table 1. List of polyketides primer sets used for multiplex PCR under this study.
Primer.Sequence (5′-3′)Target GeneAnnealing TempProduct Size
Mln-F
Mln-R		CGGTGATCATGAGCGCTTTG TCGGTCTGCTTTCTCAACCCMacrolactin50 °C792 bp
Dfn-F
Dfn-R		GGAAATGCCTTTAATGACC GGAGCTGAATCAATTGAAGCDifficidin50 °C705 bp
Bae-F
Bae-R		GTCTTACCTCGATTGCTGTG CATAGGTCACGATATCCACCBacillaene52 °C616 bp
Table
Table 2. List of soil DNA sample used for the detection of polyketides genes by multiplex-PCR.
Table 2. List of soil DNA sample used for the detection of polyketides genes by multiplex-PCR.
Soil SamplePlaceNo of Soil Samples TestedAll Three GenesPolyketides Genes
Bae + DfnDfn + MlnMln + Bae
1Jharkhand1662.5 (10)37.5 (6)0.00.0
2Odisha1258.3 (7)16.0 (2)8.4 (1)16.8 (2)
3West Bengal1573.3 (11)0.013.3 (2)13.3 (2)
4Jammu & Kashmir766.7 (4)16.7 (1)16.7 (1)16.7 (1)
5Meghalaya560.0 (3)0.020.0 (1)20.0 (1)
6Uttarakhand2070.0 (14)5.0 (1)10.0 (2)15.0 (3)
7B. amyloliquefaciens DSBA-11 and DSBA-12 (positive)−+0.00.00.0
Total75
Table
Table 3. Screening of polyketide antibiotics producing strains of Bacillus spp. isolated from rhizospheric soil of solanaceous crops.
Table 3. Screening of polyketide antibiotics producing strains of Bacillus spp. isolated from rhizospheric soil of solanaceous crops.
Polyketides Producing Strain of Bacillus spp.No of Isolates TestedHostPlacePolyketides Genes
BaeDfnMln
B. amyloliquefaciensKCBA-1, KCBA-2Chilli rhizosphereKarnataka+++
JHBA-1, JHBA-2Brinjal rhizosphereJharkhand+++
MPBA-1, MPBA-2Potato rhizosphereMeghalaya+++
UKTBA-1, UKTBA-2, UKTBA-3Tomato rhizosphereUttarakhand+++
DSBA-11, DSBA-12Delhi+++
B. subtilisUTTBS-1, UTTBS-2 UTTBS-3, DTBS-4, DTBS-5Tomato rhizosphereUttarakhand & Delhi−++
B. subtilisMTCC 7258−MTCC Chandigarh−++
B. cereusJHTBS-7Brinjal rhizosphereJharkhand−−−
B. pumilusMTCC-7092−MTCC Chandigarh−−−
B. licheniformis −Bacteriology, Div. of plant pathology−−−
Table
Table 4. Formation of inhibition zone and reduction of bacterial wilt disease intensity by-product of polyketide antibiotics synthase gene cloned and parent strain of B. amyloliquefaciens DSBA-11.
Table 4. Formation of inhibition zone and reduction of bacterial wilt disease intensity by-product of polyketide antibiotics synthase gene cloned and parent strain of B. amyloliquefaciens DSBA-11.
TreatmentsInhibition Zone (Area in cm2) Wilt Disease Intensity (%)Biocontrol Efficacy (%)
B. amyloliquefaciens DSBA-11 (Parent)3.3 a29.3 f57.72
Cloned product ofbacillaene (bae)1.9 c50.7 c26.83
Cloned product ofmacrolactin (mln)1.9 c46 d33.62
Cloned product of difficidin (dfn)1.7 c39.3 e43.23
R. solanacearum UTT-250.0 b69.3 a-
Non-clonedproduct0.0 b66.7 b-
Dissimilar alphabetical letters in each column have significant statistical differences (p ≤ 0.05) at the level using Tuckeys multiple range test (TMRT).
Table
Table 5. Effect of crude ethyl acetate extracts of polyketide antibiotics of B. amyloliquefaciens DSBA-11 and its cloned product on the growth of R. pseudosolanacearum under in vitro conditions.
Table 5. Effect of crude ethyl acetate extracts of polyketide antibiotics of B. amyloliquefaciens DSBA-11 and its cloned product on the growth of R. pseudosolanacearum under in vitro conditions.
TreatmentConcentration
(µg/mL)		Growth of R. pseudosolanacearum OD Value at 600 nm
24 h48 h72 h96 h
Macrolactin10 µg/mL0.168 bc0.197 c0.244 c0.250 c
50 µg/mL0.075 cd0.077 d0.093 gh0.095 f
Difficidin10 µg/mL0.190 b0.275 b0.334 b0.339 b
50 µg/mL0.071 cd0.082 d0.110 ef0.116 ef
Bacillaene10 µg/mL0.181 b0.247 b0.252 c0.255 c
50 µg/mL0.077 cd0.088 d0.133 e0.136 e
Macrolactin + Difficidin + Bacillaene10 µg/mL0.074 cd0.086 d0.090 gh0.094 f
50 µg/mL0.063 d0.070 d0.076 g0.079 f
B. amyloliquefaciens DSBA-1110 µg/mL0.128 bcd0.170 c0.190 d0.195 d
50 µg/mL0.071 cd0.080 d0.102 gh0.107 ef
Control 1.76 a2.603 a2.88 a2.98 a
Means followed by the same letter within a column are not significantly different as determined by LSD test (α = 0.05). Data present means of the experiment within 3 replications each.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Singh, D.; Devappa, V.; Yadav, D.K. Suppression of Tomato Bacterial Wilt Incited by Ralstonia pseudosolanacearum Using Polyketide Antibiotic-Producing Bacillus spp. Isolated from Rhizospheric Soil. Agriculture 2022, 12, 2009. https://doi.org/10.3390/agriculture12122009

AMA Style

Singh D, Devappa V, Yadav DK. Suppression of Tomato Bacterial Wilt Incited by Ralstonia pseudosolanacearum Using Polyketide Antibiotic-Producing Bacillus spp. Isolated from Rhizospheric Soil. Agriculture. 2022; 12(12):2009. https://doi.org/10.3390/agriculture12122009

Chicago/Turabian Style

Singh, Dinesh, Venkatappa Devappa, and Dhananjay Kumar Yadav. 2022. "Suppression of Tomato Bacterial Wilt Incited by Ralstonia pseudosolanacearum Using Polyketide Antibiotic-Producing Bacillus spp. Isolated from Rhizospheric Soil" Agriculture 12, no. 12: 2009. https://doi.org/10.3390/agriculture12122009

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop