Diet Supplementation with Prinsepiae Nux Extract in Broiler Chickens: Its Effect on Growth Performance and Expression of Antioxidant, Pro-Inflammatory, and Heat Shock Protein Genes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Prinsepiae Nux Extract (PNE) Preparation
2.2. ARE-Luciferase Reporter Assay
2.3. Experimental Design, Birds, and Management
2.4. Sample Collection
2.5. Growth Performance
2.6. Analysis of Serum Biochemical Parameters and Antioxidant Enzyme Activity
2.7. Total RNA Extraction, cDNA Synthesis, and Real-Time PCR
2.8. Statistical Analysis
3. Results
3.1. Prinsepiae Nux Extract Activates Nrf2 Signaling in Chicken Embryonic Fibroblast Cells
3.2. Effects of Prinsepiae Nux Extract on Growth Performance in Broilers
3.3. Serum Biochemical Parameters and Hepatic Antioxidant Enzyme Activities in Broilers
3.4. Effects of Prinsepiae Nux Extract on Hepatic mRNA Expression of Nrf2 Target Genes, Pro-Inflammatory Genes, and Heat Shock Protein Genes in Broilers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Renaudeau, D.; Collin, A.; Yahav, S.; de Basilio, V.; Gourdine, J.L.; Collier, R.J. Adaptation to hot climate and strategies to alleviate heat stress in livestock production. Animal 2012, 6, 707–728. [Google Scholar] [CrossRef]
- Quinteiro-Filho, W.M.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Sakai, M.; Sa, L.R.; Ferreira, A.J.; Palermo-Neto, J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010, 89, 1905–1914. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Jia, G.Q.; Zuo, J.J.; Zhang, Y.; Lei, J.; Ren, L.; Feng, D.Y. Effects of constant and cyclic heat stress on muscle metabolism and meat quality of broiler breast fillet and thigh meat. Poult. Sci. 2012, 91, 2931–2937. [Google Scholar] [CrossRef]
- Wang, R.H.; Liang, R.R.; Lin, H.; Zhu, L.X.; Zhang, Y.M.; Mao, Y.W.; Dong, P.C.; Niu, L.B.; Zhang, M.H.; Luo, X. Effect of acute heat stress and slaughter processing on poultry meat quality and postmortem carbohydrate metabolism. Poult. Sci. 2017, 96, 738–746. [Google Scholar] [CrossRef]
- Akbarian, A.; Michiels, J.; Degroote, J.; Majdeddin, M.; Golian, A.; De Smet, S. Association between heat stress and oxidative stress in poultry; mitochondrial dysfunction and dietary interventions with phytochemicals. J. Anim. Sci. Biotechnol. 2016, 7, 37. [Google Scholar] [CrossRef]
- Lu, Z.; He, X.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G.; Gao, F. Chronic Heat Stress Impairs the Quality of Breast-Muscle Meat in Broilers by Affecting Redox Status and Energy-Substance Metabolism. J. Agric. Food Chem. 2017, 65, 11251–11258. [Google Scholar] [CrossRef]
- Farag, M.R.; Alagawany, M. Physiological alterations of poultry to the high environmental temperature. J. Therm. Biol. 2018, 76, 101–106. [Google Scholar] [CrossRef]
- Hu, R.; He, Y.; Arowolo, M.A.; Wu, S.; He, J. Polyphenols as Potential Attenuators of Heat Stress in Poultry Production. Antioxidants 2019, 8, 67. [Google Scholar] [CrossRef]
- Baird, L.; Yamamoto, M. The molecular mechanisms regulating the KEAP1-NRF2 pathway. Mol. Cell. Biol. 2020, 40, e00099-20. [Google Scholar] [CrossRef]
- Levonen, A.L.; Landar, A.; Ramachandran, A.; Ceaser, E.K.; Dickinson, D.A.; Zanoni, G.; Morrow, J.D.; Darley-Usmar, V.M. Cellular mechanisms of redox cell signalling: Role of cysteine modification in controlling antioxidant defences in response to electrophilic lipid oxidation products. Biochem. J. 2004, 378, 373–382. [Google Scholar] [CrossRef]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef] [PubMed]
- Commission, T.H.P. Taiwan Herbal Pharmacopoeia, 3rd ed.; Ministry of Health and Welfare: Taipei City, Taiwan, 2018.
- Jin, R.; Lin, Z.J.; Xue, C.M.; Zhang, B. An improved association-mining research for exploring Chinese herbal property theory: Based on data of the Shennong’s Classic of Materia Medica. J. Integr. Med. 2013, 11, 352–365. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.H.; Chen, Y.S.; Lai, K.H.; Lu, C.K.; Chang, H.S.; Wu, H.C.; Yen, F.L.; Chen, L.Y.; Lee, J.C.; Yen, C.H. Prinsepiae Nux Extract Activates NRF2 Activity and Protects UVB-Induced Damage in Keratinocyte. Antioxidants 2022, 11, 1755. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.S.; Chang, H.S.; Hsiao, H.H.; Chen, Y.F.; Kuo, Y.P.; Yen, F.L.; Yen, C.H. Identification of Beilschmiedia tsangii Root Extract as a Liver Cancer Cell-Normal Keratinocyte Dual-Selective NRF2 Regulator. Antioxidants 2021, 10, 544. [Google Scholar] [CrossRef]
- Wu, H.C.; Cheng, M.J.; Yen, C.H.; Chen, Y.A.; Chen, Y.S.; Chen, I.S.; Chang, H.S. Chemical Constituents with GNMT-Promoter-Enhancing and NRF2-Reduction Activities from Taiwan Agarwood Excoecaria formosana. Molecules 2020, 25, 1746. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.H.; Chen, Z.W.; Liu, J.Y.; Ye, J.C. Dietary supplementation of Ocimum gratissimum improves growth performance and immune response in broilers under high ambient temperature. J. Anim. Sci. 2023, 101, skad212. [Google Scholar] [CrossRef]
- Council, N.R. Nutrient Requirements of Poultry, 9th ed.; The National Academies Press: Washington, DC, USA, 1994; p. 176. [Google Scholar]
- Wang, S.; Wu, H.; Zhu, Y.; Cui, H.; Yang, J.; Lu, M.; Cheng, H.; Gu, L.; Xu, T.; Xu, L. Effect of Lycopene on the Growth Performance, Antioxidant Enzyme Activity, and Expression of Gene in the Keap1-Nrf2 Signaling Pathway of Arbor Acres Broilers. Front. Vet. Sci. 2022, 9, 833346. [Google Scholar] [CrossRef]
- Bai, X.; Wang, K.; Khan, R.U.; Zhang, C.; Hu, H. Effect of Glutamine on the Growth Performance, Oxidative Stress, and Nrf2/p38 MAPK Expression in the Livers of Heat-Stressed Broilers. Animals 2023, 13, 652. [Google Scholar] [CrossRef]
- Chueh, C.C.; Lin, L.J.; Lin, W.C.; Huang, S.H.; Jan, M.S.; Chang, S.C.; Chung, W.S.; Lee, T.T. Antioxidant capacity of banana peel and its modulation of Nrf2-ARE associated gene expression in broiler chickens. Ital. J. Anim. Sci. 2019, 18, 1394–1403. [Google Scholar] [CrossRef]
- Li, H.; Li, X.; Wang, J.H. Chemical constituents of Nux Prinsepiae Uniflorae. J. Shenyang Pharm. Univ. 2006, 23, 209–211. [Google Scholar]
- Li, N.; Li, H.; Meng, D.L.; Li, X. Chemical constituents of Nux Prinsepiae(II). J. Shenyang Pharm. Univ. 2009, 26, 871–873. [Google Scholar]
- Zhou, H.; Zhao, R.; Yang, J. Two new alkaloid galactosides from the kernel of Prinsepia uniflora. Nat. Prod. Res. 2013, 27, 687–690. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zheng, X.; Hu, H.; Zhao, J. Study on Extracts Constituents of Nux Prinsepiae Uniflorae. In Medicine Sciences and Bioengineering; Wang, M., Ed.; CRC Press: London, UK, 2015; pp. 741–744. [Google Scholar]
- Imran, M.; Salehi, B.; Sharifi-Rad, J.; Aslam Gondal, T.; Saeed, F.; Imran, A.; Shahbaz, M.; Tsouh Fokou, P.V.; Umair Arshad, M.; Khan, H. Kaempferol: A key emphasis to its anticancer potential. Molecules 2019, 24, 2277. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Hu, M.J.; Wang, Y.Q.; Cui, Y.L. Antioxidant activities of quercetin and its complexes for medicinal application. Molecules 2019, 24, 1123. [Google Scholar] [CrossRef] [PubMed]
- Zwolak, I. Protective Effects of Dietary Antioxidants against Vanadium-Induced Toxicity: A Review. Oxidative Med. Cell. Longev. 2020, 2020, 1490316. [Google Scholar] [CrossRef]
- Li, W.; Sun, K.; Hu, F.; Chen, L.; Zhang, X.; Wang, F.; Yan, B. Protective effects of natural compounds against oxidative stress in ischemic diseases and cancers via activating the Nrf2 signaling pathway: A mini review. J. Biochem. Mol. Toxicol. 2021, 35, e22658. [Google Scholar] [CrossRef]
- Dong, Y.; Stewart, T.; Bai, L.; Li, X.; Xu, T.; Iliff, J.; Shi, M.; Zheng, D.; Yuan, L.; Wei, T.; et al. Coniferaldehyde attenuates Alzheimer’s pathology via activation of Nrf2 and its targets. Theranostics 2020, 10, 179–200. [Google Scholar] [CrossRef]
- Ma, W.F.; Duan, X.C.; Han, L.; Zhang, L.L.; Meng, X.M.; Li, Y.L.; Wang, M. Vanillic acid alleviates palmitic acid-induced oxidative stress in human umbilical vein endothelial cells via Adenosine Monophosphate-Activated Protein Kinase signaling pathway. J. Food Biochem. 2019, 43, e12893. [Google Scholar] [CrossRef]
- Varì, R.; Scazzocchio, B.; Santangelo, C.; Filesi, C.; Galvano, F.; D’Archivio, M.; Masella, R.; Giovannini, C. Protocatechuic acid prevents oxLDL-induced apoptosis by activating JNK/Nrf2 survival signals in macrophages. Oxidative Med. Cell. Longev. 2015, 2015, 351827. [Google Scholar] [CrossRef]
- Meeran, M.F.N.; Laham, F.; Azimullah, S.; Sharma, C.; Al Kaabi, A.J.; Tariq, S.; Adeghate, E.; Goyal, S.N.; Ojha, S. beta-Caryophyllene, a natural bicyclic sesquiterpene attenuates beta-adrenergic agonist-induced myocardial injury in a cannabinoid receptor-2 dependent and independent manner. Free Radic. Biol. Med. 2021, 167, 348–366. [Google Scholar] [CrossRef]
- Yu, X.; Cui, L.; Zhang, Z.; Zhao, Q.; Li, S. alpha-Linolenic acid attenuates doxorubicin-induced cardiotoxicity in rats through suppression of oxidative stress and apoptosis. Acta Biochim. Biophys. Sin. 2013, 45, 817–826. [Google Scholar] [CrossRef] [PubMed]
- Vigliante, I.; Mannino, G.; Maffei, M.E. OxiCyan®, a phytocomplex of bilberry (Vaccinium myrtillus) and spirulina (Spirulina platensis), exerts both direct antioxidant activity and modulation of ARE/Nrf2 pathway in HepG2 cells. J. Funct. Foods 2019, 61, 103508. [Google Scholar] [CrossRef]
- Alam, S.-I.; Kim, M.-W.; Shah, F.A.; Saeed, K.; Ullah, R.; Kim, M.-O. Alpha-linolenic acid impedes cadmium-induced oxidative stress, neuroinflammation, and neurodegeneration in mouse brain. Cells 2021, 10, 2274. [Google Scholar] [CrossRef] [PubMed]
- Duangjan, C.; Rangsinth, P.; Zhang, S.; Wink, M.; Tencomnao, T. Anacardium occidentale L. Leaf Extracts Protect against Glutamate/H2O2-Induced Oxidative Toxicity and Induce Neurite Outgrowth: The Involvement of SIRT1/Nrf2 Signaling Pathway and Teneurin 4 Transmembrane Protein. Front. Pharmacol. 2021, 12, 627738. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Wang, R.; Liu, J.; Wang, W.; Chen, Y.; Cai, W. Effects of novel microecologics combined with traditional Chinese medicine and probiotics on growth performance and health of broilers. Poult. Sci. 2022, 101, 101412. [Google Scholar] [CrossRef]
- Ye, C.; Qu, Q.; Bai, L.; Chen, J.; Cai, Z.; Sun, J.; Liu, C.; Shi, D. Effect of Traditional Chinese Medicine on the Gut Microbiota in Heat-Stressed Laying Hens. Front. Vet. Sci. 2022, 9, 905382. [Google Scholar] [CrossRef]
- Tang, L.P.; Liu, Y.L.; Ding, K.N.; Hou, X.J.; Qin, J.J.; Zhang, Y.A.; Liu, H.X.; Shen, X.L.; He, Y.M. Chai Hu oral liquid enhances the immune functions of both spleen and bursa of Fabricius in heat-stressed broilers through strengthening TLR4-TBK1 signaling pathway. Poult. Sci. 2021, 100, 101302. [Google Scholar] [CrossRef]
- Liang, W.; Li, H.; Zhou, H.; Wang, M.; Zhao, X.; Sun, X.; Li, C.; Zhang, X. Effects of Taraxacum and Astragalus extracts combined with probiotic Bacillus subtilis and Lactobacillus on Escherichia coli-infected broiler chickens. Poult. Sci. 2021, 100, 101007. [Google Scholar] [CrossRef]
- Song, X.; Li, Y.; Chen, S.; Jia, R.; Huang, Y.; Zou, Y.; Li, L.; Zhao, X.; Yin, Z. Anticoccidial Effect of Herbal Powder “Shi Ying Zi” in Chickens Infected with Eimeria tenella. Animals 2020, 10, 1484. [Google Scholar] [CrossRef]
- Kim, Y.J.; Chung, T.H.; Choi, I.H. Influence of supplemental Schisandra chinensis powder on growth performance, serum cholesterol, and meat quality of broilers. Acta Agric. Scand. A Anim. Sci. 2013, 63, 175–182. [Google Scholar]
Weeks of Age | ||
---|---|---|
Ingredients | Starter Diet 1~21 days | Finisher Diet 22~35 Days |
Corn, ground | 47.5 | 52.6 |
Soybean meal, CP 43% | 38.5 | 38.2 |
Fish meal, CP 65% | 5 | 0 |
Soybean oil | 5.5 | 5.5 |
Dicalcium phosphate, pulverized | 1.2 | 1.2 |
Limestone | 1.2 | 1.4 |
Salt | 0.3 | 0.3 |
L-methionine | 0.2 | 0.2 |
Vitamin-mineral Premix a | 0.2 | 0.2 |
Choline-Cl, 50% | 0.2 | 0.2 |
Calculated nutrient value | ||
Crude protein, % | 23.1 | 20.3 |
Metabolizable energy, kcal/kg | 3196 | 3218 |
Calcium, % | 1.07 | 0.95 |
Available phosphorus, % | 0.49 | 0.35 |
Analysis value | ||
Crude protein, % | 23.13 | 21.53 |
Crude fat, % | 8.35 | 6.59 |
Crude fiber, % | 2.46 | 2.23 |
Calcium, % | 1.28 | 0.96 |
Total Phosphorus, % | 0.68 | 0.55 |
Gene | Primer Sequence (From 5′ to 3′) | Product Size (bp) | NCBI Genebank | |
---|---|---|---|---|
β-actin | F | CCTGGCACCTAGCACAATGA | 128 | NM_205518.2 |
R | ACTCCTGCTTGCTGATCCAC | |||
Ho1 | F | GGCAGAGATCCCATGTCCTG | 72 | NM_205344.2 |
R | GGATGCTTCTTGCCAACGGC | |||
Nqo1 | F | AACCTCTTTCAACCACGCCA | 113 | NM_001277619.2 |
R | GTGAGAGCACGGCATTGAAC | |||
Gclc | F | GGACGCTATGGGGTTTGGAA | 122 | XM_419910.7 |
R | AGGCCATCACAATGGGACAG | |||
Nrf2 | F | GAGATCGAGCTGCCACCC | 93 | NM_001396905.1 |
R | AAAAACTTCACGCCTTGCCC | |||
Cat | F | TCAGGAGATGTGCAGCGTTT | 109 | NM_001031215.2 |
R | TCTTACACAGCCTTTGGCGT | |||
Sod2 | F | AAGGAGCAGGGACGTCTACA | 85 | NM_204211.2 |
R | TCCCAGCAATGGAATGAGACC | |||
Hsp90 | F | GGTTGCCAACTCAGCCTTTG | 92 | NM_001397317.1 |
R | GCTGCACGCAGTATTCATCG | |||
Hsf1 | F | TGAGGCAAGACAACGTCACC | 73 | NM_001305256.1 |
R | GAGTCCATGCTCTCCTGCTTT | |||
Il-6 | F | AGGACGAGATGTGCAAGAAGT | 78 | NM_204628.2 |
R | TTGGGCAGGTTGAGGTTGTT | |||
Il-1β | F | TGCCTGCAGAAGAAGCCTCG | 137 | NM_204524.2 |
R | CTCCGCAGCAGTTTGGTCAT |
Treatments | ||||
---|---|---|---|---|
Items † | Control | 0.1% PNE # | 1% PNE | Commercial Electrolyte |
Body weight, g | ||||
1 day old | 39.4 ± 1.8 | 39.8 ± 1.6 | 39.3 ± 1.8 | 40.6 ± 1.8 |
21 days old | 888.2 ± 63.9 | 893.1 ± 78.7 | 903.4 ± 79.9 | 917.5 ± 84.4 |
35 days old | 2168.5 ± 219.2 | 2176.2 ± 199.2 | 2193.5 ± 174.6 | 2193.7 ± 267.7 |
1~21 days | ||||
ADFI, g/bird/d | 58.4 ± 5.0 | 58.4 ± 6.1 | 58.1 ± 4.3 | 54.9 ± 3.1 |
ADG, g/bird/d | 40.4 ± 0.4 | 40.6 ± 2.2 | 41.1 ± 2.1 | 41.8 ± 0.6 |
FCR, F/G | 1.44 ± 0.12 | 1.44 ± 0.16 | 1.41 ± 0.13 | 1.31 ± 0.06 |
22~35 days | ||||
ADFI, g/bird/d | 172.5 ± 6.2 | 157.9 ± 20.6 | 146.3 ± 8.0 * | 133.6 ± 10.6 ** |
ADG, g/bird/d | 91.5 ± 5.9 | 91.6 ± 5.8 | 92.2 ± 5.7 | 91.2 ± 8.4 |
FCR, F/G | 1.89 ± 0.10 | 1.72 ± 0.13 | 1.59 ± 0.09 ** | 1.47 ± 0.07 *** |
1~35 days | ||||
ADFI, g/bird/d | 104.0 ± 2.5 | 96.7 ± 10.2 | 91.1 ± 4.9 * | 85.8 ± 5.3 ** |
ADG, g/bird/d | 60.8 ± 2.3 | 61.0 ± 3.3 | 61.5 ± 3.1 | 61.5 ± 3.7 |
FCR, F/G | 1.71 ± 0.08 | 1.58 ± 0.09 | 1.48 ± 0.10 ** | 1.40 ± 0.07 *** |
Treatments | |||||
---|---|---|---|---|---|
Items † | Control | 0.1% PNE # | 1% PNE | Commercial Electrolyte | p-Value |
Plasma | |||||
GLU, mg/dL | 271.3 ± 6.1 ‡ | 274.0 ± 6.8 | 280.2 ± 5.2 | 291.2 ± 4.1 | 0.09 |
SGOT, U/L | 244.3 ± 19.7 | 237.7 ± 8.7 | 243.5 ± 8.4 | 360.8 ± 58.6 * | 0.03 |
SGPT, U/L | 10.7 ± 0.9 | 11.0 ± 0.7 | 12.0 ± 0.7 | 17.8 ± 3.6 | 0.05 |
T-P, g/dL | 3.2 ± 0.1 | 3.6 ± 0.2 | 3.0 ± 0.2 | 3.3 ± 0.1 | 0.11 |
ALB, g/dL | 1.4 ± 0.0 | 1.4 ± 0.0 | 1.3 ± 0.0 | 1.4 ± 0.0 | 0.15 |
GLO, g/dL | 1.8 ± 0.1 | 2.2 ± 0.2 | 1.8 ± 0.2 | 2.0 ± 0.1 | 0.19 |
Alk-P, IU/L | 1666.8 ± 289.7 | 1867.7 ± 95.4 | 1537.8 ± 286.4 | 1156.3 ± 169.7 | 0.19 |
CHOL, mg/dL | 114.3 ± 6.1 | 117.8 ± 7.3 | 129.3 ± 9.9 | 116.8 ± 1.6 | 0.44 |
HDL-C, mg/dL | 50.8 ± 1.8 | 52.2 ± 2.3 | 56.3 ± 3.9 | 52.5 ± 0.7 | 0.46 |
LDL-C, mg/dL | 24.2 ± 2.7 | 24.7 ± 2.7 | 28.0 ± 1.9 | 24.0 ± 1.2 | 0.55 |
Ca, mg/dL | 10.6 ± 0.2 | 11.3 ± 0.3 | 10.6 ± 0.2 | 9.5 ± 1.1 | 0.25 |
P, mg/dL | 6.1 ± 0.1 | 6.3 ± 0.2 | 6.7 ± 0.3 | 5.7 ± 0.7 | 0.37 |
Catalase, nmol/min/mL | 10.8 ± 2.2 | 9.8 ± 1.5 | 13.1 ± 2.3 | 14.8 ± 1.4 | 0.27 |
Liver | |||||
SOD, U/mL | 4.2 ± 0.2 | 4.2 ± 0.3 | 3.9 ± 0.2 | 4.5 ± 0.3 | 0.44 |
Catalase, nmol/min/mL | 2480.3 ± 307.8 | 2486.3 ± 409.5 | 3318.7 ± 231.9 | 2213.1 ± 568.7 | 0.17 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tran, H.-L.; Chen, Y.-S.; Hung, H.-W.; Shih, B.-L.; Lee, T.-Y.; Yen, C.-H.; Lin, J.-B. Diet Supplementation with Prinsepiae Nux Extract in Broiler Chickens: Its Effect on Growth Performance and Expression of Antioxidant, Pro-Inflammatory, and Heat Shock Protein Genes. Animals 2024, 14, 73. https://doi.org/10.3390/ani14010073
Tran H-L, Chen Y-S, Hung H-W, Shih B-L, Lee T-Y, Yen C-H, Lin J-B. Diet Supplementation with Prinsepiae Nux Extract in Broiler Chickens: Its Effect on Growth Performance and Expression of Antioxidant, Pro-Inflammatory, and Heat Shock Protein Genes. Animals. 2024; 14(1):73. https://doi.org/10.3390/ani14010073
Chicago/Turabian StyleTran, Hong-Loan, Yi-Siao Chen, His-Wen Hung, Bor-Ling Shih, Tsung-Yu Lee, Chia-Hung Yen, and Jeng-Bin Lin. 2024. "Diet Supplementation with Prinsepiae Nux Extract in Broiler Chickens: Its Effect on Growth Performance and Expression of Antioxidant, Pro-Inflammatory, and Heat Shock Protein Genes" Animals 14, no. 1: 73. https://doi.org/10.3390/ani14010073