D-Lactate Increases Cytokine Production in Bovine Fibroblast-Like Synoviocytes via MCT1 Uptake and the MAPK, PI3K/Akt, and NFκB Pathways
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fibroblast-Like Synoviocyte Isolation and Culture
2.2. Quantitative Real-Time PCR
2.3. Immunoblot
2.4. Quantification of Intracellular D-Lactate in bFLSs by HPLC
2.5. Determination of IL-6 and IL-8 by ELISA
2.6. Determination of IκBα Levels by Flow Cytometry
2.7. Statistical Analysis
3. Results
3.1. D-Lactate Increases the Expression of IL-6 and IL-8 in bFLSs
3.2. D-Lactate Uptake is Mediated by MCT1
3.3. Inhibition of MCT1 Reduced the Expression of IL-6 and IL-8 Induced by D-Lactate
3.4. ERK1/2, p38 MAPK and PI3K/Akt Signaling Pathways Mediate IL-6 and IL-8 Production Induced by D-Lactate
3.5. The Expression of IL-6 and IL-8 Induced by D-Lactate Is Dependent on NF-κB Activation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Danscher, A.M.; Enemark, H.L.; Andersen, P.H.; Aalbaek, B.; Nielsen, O.L. Polysynovitis after oligofructose overload in dairy cattle. J. Comp. Pathol. 2010, 142, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, J.; Benedito, J.L.; Abuelo, A.; Castillo, C. Ruminal acidosis in feedlot: From aetiology to prevention. Sci. World J. 2014, 2014, 702572. [Google Scholar] [CrossRef] [PubMed]
- Ewaschuk, J.B.; Naylor, J.M.; Zello, G.A. D-lactate in human and ruminant metabolism. J. Nutr. 2005, 135, 1619–1625. [Google Scholar] [CrossRef] [PubMed]
- Kalapos, M.P. Methylglyoxal in living organisms: Chemistry, biochemistry, toxicology and biological implications. Toxicol. Lett. 1999, 110, 145–175. [Google Scholar] [CrossRef]
- Owens, F.N.; Secrist, D.S.; Hill, W.J.; Gill, D.R. Acidosis in cattle: A review. J. Anim. Sci. 1998, 76, 275–286. [Google Scholar] [CrossRef]
- Nagaraja, T.G.; Titgemeyer, E.C. Ruminal acidosis in beef cattle: The current microbiological and nutritional outlook. J. Dairy Sci. 2007, 90 (Suppl. 1), E17–E38. [Google Scholar] [CrossRef] [Green Version]
- Harmon, D.L.; Britton, R.A.; Prior, R.L.; Stock, R.A. Net portal absorption of lactate and volatile fatty acids in steers experiencing glucose-induced acidosis or fed a 70% concentrate diet ad libitum. J. Anim. Sci. 1985, 60, 560–569. [Google Scholar] [CrossRef]
- Hidalgo, A.I.; Carretta, M.D.; Alarcon, P.; Manosalva, C.; Muller, A.; Navarro, M.; Hidalgo, M.A.; Kaehne, T.; Taubert, A.; Hermosilla, C.R.; et al. Pro-inflammatory mediators and neutrophils are increased in synovial fluid from heifers with acute ruminal acidosis. BMC Vet. Res. 2019, 15, 225. [Google Scholar] [CrossRef]
- Alarcon, P.; Hidalgo, A.I.; Manosalva, C.; Cristi, R.; Teuber, S.; Hidalgo, M.A.; Burgos, R.A. Metabolic disturbances in synovial fluid are involved in the onset of synovitis in heifers with acute ruminal acidosis. Sci. Rep. 2019, 9, 5452. [Google Scholar] [CrossRef]
- Abeysekara, S.; Naylor, J.M.; Wassef, A.W.; Isak, U.; Zello, G.A. D-Lactic acid-induced neurotoxicity in a calf model. Am. J. Physiol. Endocrinol. Metab. 2007, 293, E558–E565. [Google Scholar] [CrossRef] [Green Version]
- Danscher, A.M.; Enemark, J.M.; Telezhenko, E.; Capion, N.; Ekstrom, C.T.; Thoefner, M.B. Oligofructose overload induces lameness in cattle. J. Dairy Sci. 2009, 92, 607–616. [Google Scholar] [CrossRef] [PubMed]
- Bartok, B.; Firestein, G.S. Fibroblast-like synoviocytes: Key effector cells in rheumatoid arthritis. Immunol. Rev. 2010, 233, 233–255. [Google Scholar] [CrossRef] [PubMed]
- Bottini, N.; Firestein, G.S. Duality of fibroblast-like synoviocytes in RA: Passive responders and imprinted aggressors. Nat. Rev. Rheumatol. 2013, 9, 24–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turner, J.D.; Filer, A. The role of the synovial fibroblast in rheumatoid arthritis pathogenesis. Curr. Opin. Rheumatol. 2015, 27, 175–182. [Google Scholar] [CrossRef] [PubMed]
- Harris, E.D., Jr. Rheumatoid arthritis. Pathophysiology and implications for therapy. N. Engl. J. Med. 1990, 322, 1277–1289. [Google Scholar] [CrossRef]
- Tolboom, T.C.; van der Helm-Van Mil, A.H.; Nelissen, R.G.; Breedveld, F.C.; Toes, R.E.; Huizinga, T.W. Invasiveness of fibroblast-like synoviocytes is an individual patient characteristic associated with the rate of joint destruction in patients with rheumatoid arthritis. Arthritis Rheum. 2005, 52, 1999–2002. [Google Scholar] [CrossRef]
- De Oliveira, P.G.; Farinon, M.; Sanchez-Lopez, E.; Miyamoto, S.; Guma, M. Fibroblast-Like Synoviocytes Glucose Metabolism as a Therapeutic Target in Rheumatoid Arthritis. Front. Immunol. 2019, 10, 1743. [Google Scholar] [CrossRef] [Green Version]
- Zou, Y.; Zeng, S.; Huang, M.; Qiu, Q.; Xiao, Y.; Shi, M.; Zhan, Z.; Liang, L.; Yang, X.; Xu, H. Inhibition of 6-phosphofructo-2-kinase suppresses fibroblast-like synoviocytes-mediated synovial inflammation and joint destruction in rheumatoid arthritis. Br. J. Pharm. 2017, 174, 893–908. [Google Scholar] [CrossRef] [Green Version]
- Bakker, J.; Schieveld, S.J.; Brinkert, W. [Serum lactate level as a indicator of tissue hypoxia in severely ill patients]. Ned. Tijdschr. Geneeskd. 2000, 144, 737–741. [Google Scholar]
- Verma, I.; Kaur, S.; Goyal, S.; Goyal, S.; Multani, J.S.; Narang, A.P. Diagnostic value of lactate levels in acute abdomen disorders. Indian J. Clin. Biochem. 2014, 29, 382–385. [Google Scholar] [CrossRef] [Green Version]
- Alarcon, P.; Manosalva, C.; Conejeros, I.; Carretta, M.D.; Munoz-Caro, T.; Silva, L.M.R.; Taubert, A.; Hermosilla, C.; Hidalgo, M.A.; Burgos, R.A. d(-) Lactic Acid-Induced Adhesion of Bovine Neutrophils onto Endothelial Cells Is Dependent on Neutrophils Extracellular Traps Formation and CD11b Expression. Front. Immunol. 2017, 8, 975. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, J.; Li, S.; Jiang, L.; Li, Y.; Zhang, X.; Song, Q.; Hayat, M.A.; Zhang, J.T.; Wang, H. Laminar Inflammation Responses in the Oligofructose Overload Induced Model of Bovine Laminitis. Front. Vet. Sci. 2020, 7, 351. [Google Scholar] [CrossRef] [PubMed]
- Thoefner, M.B.; Wattle, O.; Pollitt, C.C.; French, K.R.; Nielsen, S.S. Histopathology of oligofructose-induced acute laminitis in heifers. J. Dairy Sci. 2005, 88, 2774–2782. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neuenschwander, H.M.; Moreira, J.J.; Vendruscolo, C.P.; Fulber, J.; Seidel, S.R.T.; Michelacci, Y.M.; Baccarin, R.Y.A. Hyaluronic acid has chondroprotective and joint-preserving effects on LPS-induced synovitis in horses. J. Vet. Sci. 2019, 20, e67. [Google Scholar] [CrossRef] [Green Version]
- Berenbaum, F. Signaling transduction: Target in osteoarthritis. Curr. Opin. Rheumatol. 2004, 16, 616–622. [Google Scholar] [CrossRef]
- Yamanishi, Y.; Firestein, G.S. Pathogenesis of rheumatoid arthritis: The role of synoviocytes. Rheum. Dis. Clin. N. Am. 2001, 27, 355–371. [Google Scholar] [CrossRef]
- Akhtar, M.; Guo, S.; Guo, Y.F.; Zahoor, A.; Shaukat, A.; Chen, Y.; Umar, T.; Deng, P.G.; Guo, M. Upregulated-gene expression of pro-inflammatory cytokines (TNF-alpha, IL-1beta and IL-6) via TLRs following NF-kappaB and MAPKs in bovine mastitis. Acta Trop. 2020, 207, 105458. [Google Scholar] [CrossRef]
- Ray, A.; Ray, B.K. Lipopolysaccharide-mediated induction of the bovine interleukin-6 gene in monocytes requires both NF-kappa B and C/EBP binding sites. DNA Cell Biol. 1995, 14, 795–802. [Google Scholar] [CrossRef]
- Fitzgerald, D.C.; Meade, K.G.; McEvoy, A.N.; Lillis, L.; Murphy, E.P.; MacHugh, D.E.; Baird, A.W. Tumour necrosis factor-alpha (TNF-alpha) increases nuclear factor kappaB (NFkappaB) activity in and interleukin-8 (IL-8) release from bovine mammary epithelial cells. Vet. Immunol. Immunopathol. 2007, 116, 59–68. [Google Scholar] [CrossRef]
- Jia, Q.; Cheng, W.; Yue, Y.; Hu, Y.; Zhang, J.; Pan, X.; Xu, Z.; Zhang, P. Cucurbitacin E inhibits TNF-alpha-induced inflammatory cytokine production in human synoviocyte MH7A cells via suppression of PI3K/Akt/NF-kappaB pathways. Int. Immunopharmacol. 2015, 29, 884–890. [Google Scholar] [CrossRef]
- Li, Y.; Li, P.; Lin, S.H.; Zheng, Y.Q.; Zheng, X.X. Paeonol inhibited TNFalpha-induced GM-CSF expression in fibroblast-like synoviocytes. Int. J. Clin. Pharm. Ther. 2014, 52, 986–996. [Google Scholar] [CrossRef] [PubMed]
- Varani, K.; De Mattei, M.; Vincenzi, F.; Gessi, S.; Merighi, S.; Pellati, A.; Ongaro, A.; Caruso, A.; Cadossi, R.; Borea, P.A. Characterization of adenosine receptors in bovine chondrocytes and fibroblast-like synoviocytes exposed to low frequency low energy pulsed electromagnetic fields. Osteoarthr. Cartil. 2008, 16, 292–304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sappino, A.P.; Schurch, W.; Gabbiani, G. Differentiation repertoire of fibroblastic cells: Expression of cytoskeletal proteins as marker of phenotypic modulations. Lab. Investig. 1990, 63, 144–161. [Google Scholar] [PubMed]
- Mena, J.; Manosalva, C.; Ramirez, R.; Chandia, L.; Carroza, D.; Loaiza, A.; Burgos, R.A.; Hidalgo, M.A. Linoleic acid increases adhesion, chemotaxis, granule release, intracellular calcium mobilisation, MAPK phosphorylation and gene expression in bovine neutrophils. Vet. Immunol. Immunopathol. 2013, 151, 275–284. [Google Scholar] [CrossRef]
- Hidalgo, M.A.; Ojeda, F.; Eyre, P.; LaBranche, T.P.; Smith, C.; Hancke, J.L.; Burgos, R.A. Platelet-activating factor increases pH(i) in bovine neutrophils through the PI3K-ERK1/2 pathway. Br. J. Pharm. 2004, 141, 311–321. [Google Scholar] [CrossRef] [Green Version]
- Favata, M.F.; Horiuchi, K.Y.; Manos, E.J.; Daulerio, A.J.; Stradley, D.A.; Feeser, W.S.; Van Dyk, D.E.; Pitts, W.J.; Earl, R.A.; Hobbs, F.; et al. Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J. Biol. Chem. 1998, 273, 18623–18632. [Google Scholar] [CrossRef] [Green Version]
- Pierce, J.W.; Schoenleber, R.; Jesmok, G.; Best, J.; Moore, S.A.; Collins, T.; Gerritsen, M.E. Novel inhibitors of cytokine-induced IkappaBalpha phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo. J. Biol. Chem. 1997, 272, 21096–21103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, S.; Jiang, M.S.; Adams, J.L.; Lee, J.C. Pyridinylimidazole compound SB 203580 inhibits the activity but not the activation of p38 mitogen-activated protein kinase. Biochem. Biophys. Res. Commun. 1999, 263, 825–831. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Halestrap, A.P. The monocarboxylate transporter family--Structure and functional characterization. IUBMB Life 2012, 64, 1–9. [Google Scholar] [CrossRef]
- Ovens, M.J.; Davies, A.J.; Wilson, M.C.; Murray, C.M.; Halestrap, A.P. AR-C155858 is a potent inhibitor of monocarboxylate transporters MCT1 and MCT2 that binds to an intracellular site involving transmembrane helices 7-10. Biochem. J. 2010, 425, 523–530. [Google Scholar] [CrossRef] [PubMed]
- Berrios, C.; Padi, M.; Keibler, M.A.; Park, D.E.; Molla, V.; Cheng, J.; Lee, S.M.; Stephanopoulos, G.; Quackenbush, J.; DeCaprio, J.A. Merkel Cell Polyomavirus Small T Antigen Promotes Pro-Glycolytic Metabolic Perturbations Required for Transformation. PLoS Pathog. 2016, 12, e1006020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhatt, D.; Ghosh, S. Regulation of the NF-kappaB-Mediated Transcription of Inflammatory Genes. Front. Immunol. 2014, 5, 71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagaraja, T.G.; Lechtenberg, K.F. Acidosis in feedlot cattle. Vet. Clin. N. Am.-Food Anim. Pr. 2007, 23, 333–350. [Google Scholar] [CrossRef]
- Lorenz, I.; Gentile, A. D-lactic acidosis in neonatal ruminants. Vet. Clin. N. Am.-Food Anim. Pr. 2014, 30, 317–331. [Google Scholar] [CrossRef] [PubMed]
- Dunlop, R.H.; Hammond, P.B. D-lactic acidosis of ruminants. Ann. N. Y. Acad. Sci. 1965, 119, 1109–1132. [Google Scholar] [CrossRef]
- Danscher, A.M.; Toelboell, T.H.; Wattle, O. Biomechanics and histology of bovine claw suspensory tissue in early acute laminitis. J. Dairy Sci. 2010, 93, 53–62. [Google Scholar] [CrossRef] [Green Version]
- Thoefner, M.B.; Pollitt, C.C.; Van Eps, A.W.; Milinovich, G.J.; Trott, D.J.; Wattle, O.; Andersen, P.H. Acute bovine laminitis: A new induction model using alimentary oligofructose overload. J. Dairy Sci. 2004, 87, 2932–2940. [Google Scholar] [CrossRef] [Green Version]
- Mgasa, M.N. Bovine pododermatitis aseptica diffusa (laminitis) aetiology, pathogenesis, treatment and control. Vet. Res. Commun. 1987, 11, 235–241. [Google Scholar] [CrossRef]
- Bailey, S.R.; Marr, C.M.; Elliott, J. Current research and theories on the pathogenesis of acute laminitis in the horse. Vet. J. 2004, 167, 129–142. [Google Scholar] [CrossRef]
- Concha, C.; Carretta, M.D.; Alarcon, P.; Conejeros, I.; Gallardo, D.; Hidalgo, A.I.; Tadich, N.; Caceres, D.D.; Hidalgo, M.A.; Burgos, R.A. Oxidative response of neutrophils to platelet-activating factor is altered during acute ruminal acidosis induced by oligofructose in heifers. J. Vet. Sci. 2014, 15, 217–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morrow, L.L.; Tumbleson, M.E.; Kintner, L.D.; Pfander, W.H.; Preston, R.L. Laminitis in lambs injected with lactic acid. Am. J. Vet. Res. 1973, 34, 1305–1307. [Google Scholar] [PubMed]
- Haas, R.; Smith, J.; Rocher-Ros, V.; Nadkarni, S.; Montero-Melendez, T.; D’Acquisto, F.; Bland, E.J.; Bombardieri, M.; Pitzalis, C.; Perretti, M.; et al. Lactate Regulates Metabolic and Pro-inflammatory Circuits in Control of T Cell Migration and Effector Functions. PLoS Biol. 2015, 13, e1002202. [Google Scholar] [CrossRef] [PubMed]
- Kaneko, S.; Satoh, T.; Chiba, J.; Ju, C.; Inoue, K.; Kagawa, J. Interleukin-6 and interleukin-8 levels in serum and synovial fluid of patients with osteoarthritis. Cytokines Cell. Mol. Ther. 2000, 6, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Doss, F.; Menard, J.; Hauschild, M.; Kreutzer, H.J.; Mittlmeier, T.; Muller-Steinhardt, M.; Muller, B. Elevated IL-6 levels in the synovial fluid of osteoarthritis patients stem from plasma cells. Scand. J. Rheumatol. 2007, 36, 136–139. [Google Scholar] [CrossRef]
- Narazaki, M.; Tanaka, T.; Kishimoto, T. The role and therapeutic targeting of IL-6 in rheumatoid arthritis. Expert Rev. Clin. Immunol. 2017, 13, 535–551. [Google Scholar] [CrossRef]
- Hwang, S.Y.; Kim, J.Y.; Kim, K.W.; Park, M.K.; Moon, Y.; Kim, W.U.; Kim, H.Y. IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-kappaB- and PI3-kinase/Akt-dependent pathways. Arthritis Res. Ther. 2004, 6, R120–R128. [Google Scholar] [CrossRef] [Green Version]
- Lally, F.; Smith, E.; Filer, A.; Stone, M.A.; Shaw, J.S.; Nash, G.B.; Buckley, C.D.; Rainger, G.E. A novel mechanism of neutrophil recruitment in a coculture model of the rheumatoid synovium. Arthritis Rheum. 2005, 52, 3460–3469. [Google Scholar] [CrossRef] [Green Version]
- Kobayashi, Y. The role of chemokines in neutrophil biology. Front. Biosci. 2008, 13, 2400–2407. [Google Scholar] [CrossRef] [Green Version]
- Szekanecz, Z.; Vegvari, A.; Szabo, Z.; Koch, A.E. Chemokines and chemokine receptors in arthritis. Front. Biosci. (Sch. Ed.) 2010, 2, 153–167. [Google Scholar] [CrossRef] [Green Version]
- Rubbert, A.; Combadiere, C.; Ostrowski, M.; Arthos, J.; Dybul, M.; Machado, E.; Cohn, M.A.; Hoxie, J.A.; Murphy, P.M.; Fauci, A.S.; et al. Dendritic cells express multiple chemokine receptors used as coreceptors for HIV entry. J. Immunol. 1998, 160, 3933–3941. [Google Scholar] [PubMed]
- Zhu, X.; Xiao, L.; Huo, R.; Zhang, J.; Lin, J.; Xie, J.; Sun, S.; He, Y.; Sun, Y.; Zhou, Z.; et al. Cyr61 is involved in neutrophil infiltration in joints by inducing IL-8 production by fibroblast-like synoviocytes in rheumatoid arthritis. Arthritis Res. Ther. 2013, 15, R187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peichl, P.; Ceska, M.; Effenberger, F.; Haberhauer, G.; Broell, H.; Lindley, I.J. Presence of NAP-1/IL-8 in synovial fluids indicates a possible pathogenic role in rheumatoid arthritis. Scand. J. Immunol. 1991, 34, 333–339. [Google Scholar] [CrossRef] [PubMed]
- Rampart, M.; Herman, A.G.; Grillet, B.; Opdenakker, G.; Van Damme, J. Development and application of a radioimmunoassay for interleukin-8: Detection of interleukin-8 in synovial fluids from patients with inflammatory joint disease. Lab. Investig. 1992, 66, 512–518. [Google Scholar]
- McClenahan, D.; Fagliari, J.; Evanson, O.; Weiss, D. Role of inflammatory mediators in priming, activation, and deformability of bovine neutrophils. Am. J. Vet. Res. 2000, 61, 492–498. [Google Scholar] [CrossRef]
- Zerbe, H.; Schuberth, H.J.; Engelke, F.; Frank, J.; Klug, E.; Leibold, W. Development and comparison of in vivo and in vitro models for endometritis in cows and mares. Theriogenology 2003, 60, 209–223. [Google Scholar] [CrossRef]
- Valcamonica, E.; Chighizola, C.B.; Comi, D.; De Lucia, O.; Pisoni, L.; Murgo, A.; Salvi, V.; Sozzani, S.; Meroni, P.L. Levels of chemerin and interleukin 8 in the synovial fluid of patients with inflammatory arthritides and osteoarthritis. Clin. Exp. Rheumatol. 2014, 32, 243–250. [Google Scholar]
- Kraan, M.C.; Patel, D.D.; Haringman, J.J.; Smith, M.D.; Weedon, H.; Ahern, M.J.; Breedveld, F.C.; Tak, P.P. The development of clinical signs of rheumatoid synovial inflammation is associated with increased synthesis of the chemokine CXCL8 (interleukin-8). Arthritis Res. 2001, 3, 65–71. [Google Scholar] [CrossRef] [Green Version]
- Yu, F.Y.; Xie, C.Q.; Jiang, C.L.; Sun, J.T.; Huang, X.W. TNFalpha increases inflammatory factor expression in synovial fibroblasts through the tolllike receptor3mediated ERK/AKT signaling pathway in a mouse model of rheumatoid arthritis. Mol. Med. Rep. 2018, 17, 8475–8483. [Google Scholar] [CrossRef]
- Li, H.; Xie, S.; Qi, Y.; Li, H.; Zhang, R.; Lian, Y. TNF-alpha increases the expression of inflammatory factors in synovial fibroblasts by inhibiting the PI3K/AKT pathway in a rat model of monosodium iodoacetate-induced osteoarthritis. Exp. Ther. Med. 2018, 16, 4737–4744. [Google Scholar] [CrossRef] [Green Version]
- Matsuno, H.; Yudoh, K.; Katayama, R.; Nakazawa, F.; Uzuki, M.; Sawai, T.; Yonezawa, T.; Saeki, Y.; Panayi, G.S.; Pitzalis, C.; et al. The role of TNF-alpha in the pathogenesis of inflammation and joint destruction in rheumatoid arthritis (RA): A study using a human RA/SCID mouse chimera. Rheumatology 2002, 41, 329–337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiao, Z.; Wang, W.; Ma, J.; Wang, S.; Su, Z.; Xu, H. Notch signaling mediates TNF-alpha-induced IL-6 production in cultured fibroblast-like synoviocytes from rheumatoid arthritis. Clin. Dev. Immunol. 2012, 2012, 350209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Awasthi, D.; Nagarkoti, S.; Sadaf, S.; Chandra, T.; Kumar, S.; Dikshit, M. Glycolysis dependent lactate formation in neutrophils: A metabolic link between NOX-dependent and independent NETosis. Biochim. Biophys. Acta-Mol. Basis Dis. 2019, 1865, 165542. [Google Scholar] [CrossRef] [PubMed]
- An, Z.; Li, J.; Yu, J.; Wang, X.; Gao, H.; Zhang, W.; Wei, Z.; Zhang, J.; Zhang, Y.; Zhao, J.; et al. Neutrophil extracellular traps induced by IL-8 aggravate atherosclerosis via activation NF-kappaB signaling in macrophages. Cell Cycle 2019, 18, 2928–2938. [Google Scholar] [CrossRef] [PubMed]
- Joshi, M.B.; Lad, A.; Bharath Prasad, A.S.; Balakrishnan, A.; Ramachandra, L.; Satyamoorthy, K. High glucose modulates IL-6 mediated immune homeostasis through impeding neutrophil extracellular trap formation. FEBS Lett. 2013, 587, 2241–2246. [Google Scholar] [CrossRef] [Green Version]
- Vegran, F.; Boidot, R.; Michiels, C.; Sonveaux, P.; Feron, O. Lactate influx through the endothelial cell monocarboxylate transporter MCT1 supports an NF-kappaB/IL-8 pathway that drives tumor angiogenesis. Cancer Res. 2011, 71, 2550–2560. [Google Scholar] [CrossRef] [Green Version]
- Hojman, P.; Brolin, C.; Norgaard-Christensen, N.; Dethlefsen, C.; Lauenborg, B.; Olsen, C.K.; Abom, M.M.; Krag, T.; Gehl, J.; Pedersen, B.K. IL-6 release from muscles during exercise is stimulated by lactate-dependent protease activity. Am. J. Physiol. Endocrinol. Metab. 2019, 316, E940–E947. [Google Scholar] [CrossRef]
- Harada, N.; Hirano, I.; Inui, H.; Yamaji, R. Stereoselective effects of lactate enantiomers on the enhancement of 3T3-L1 adipocyte differentiation. Biochem. Biophys. Res. Commun. 2018, 498, 105–110. [Google Scholar] [CrossRef]
- Harmon, D.L.; Britton, R.A.; Prior, R.L. In vitro rates of oxidation and gluconeogenesis from L(+)- and D(-)lactate in bovine tissues. Comp. Biochem. Physiol. B-Biochem. Mol. Biol. 1984, 77, 365–368. [Google Scholar] [CrossRef]
- Enerson, B.E.; Drewes, L.R. Molecular features, regulation, and function of monocarboxylate transporters: Implications for drug delivery. J. Pharm. Sci. 2003, 92, 1531–1544. [Google Scholar] [CrossRef]
- Graham, C.; Gatherar, I.; Haslam, I.; Glanville, M.; Simmons, N.L. Expression and localization of monocarboxylate transporters and sodium/proton exchangers in bovine rumen epithelium. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2007, 292, R997–R1007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takahashi, S.; Saegusa, J.; Sendo, S.; Okano, T.; Akashi, K.; Irino, Y.; Morinobu, A. Glutaminase 1 plays a key role in the cell growth of fibroblast-like synoviocytes in rheumatoid arthritis. Arthritis Res. Ther. 2017, 19, 76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, L.; Zhou, Y.; Yao, J.; Qiao, C.; Ni, T.; Guo, R.; Guo, Q.; Lu, N. Lactate promotes PGE2 synthesis and gluconeogenesis in monocytes to benefit the growth of inflammation-associated colorectal tumor. Oncotarget 2015, 6, 16198–16214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korb, A.; Tohidast-Akrad, M.; Cetin, E.; Axmann, R.; Smolen, J.; Schett, G. Differential tissue expression and activation of p38 MAPK alpha, beta, gamma, and delta isoforms in rheumatoid arthritis. Arthritis Rheum. 2006, 54, 2745–2756. [Google Scholar] [CrossRef] [PubMed]
- Schett, G.; Zwerina, J.; Firestein, G. The p38 mitogen-activated protein kinase (MAPK) pathway in rheumatoid arthritis. Ann. Rheum. Dis. 2008, 67, 909–916. [Google Scholar] [CrossRef] [Green Version]
- Goodridge, H.S.; Harnett, W.; Liew, F.Y.; Harnett, M.M. Differential regulation of interleukin-12 p40 and p35 induction via Erk mitogen-activated protein kinase-dependent and -independent mechanisms and the implications for bioactive IL-12 and IL-23 responses. Immunology 2003, 109, 415–425. [Google Scholar] [CrossRef]
- Thalhamer, T.; McGrath, M.A.; Harnett, M.M. MAPKs and their relevance to arthritis and inflammation. Rheumatology 2008, 47, 409–414. [Google Scholar] [CrossRef] [Green Version]
- Xue, M.; McKelvey, K.; Shen, K.; Minhas, N.; March, L.; Park, S.Y.; Jackson, C.J. Endogenous MMP-9 and not MMP-2 promotes rheumatoid synovial fibroblast survival, inflammation and cartilage degradation. Rheumatology 2014, 53, 2270–2279. [Google Scholar] [CrossRef] [Green Version]
- Xu, H.; He, Y.; Yang, X.; Liang, L.; Zhan, Z.; Ye, Y.; Yang, X.; Lian, F.; Sun, L. Anti-malarial agent artesunate inhibits TNF-alpha-induced production of proinflammatory cytokines via inhibition of NF-kappaB and PI3 kinase/Akt signal pathway in human rheumatoid arthritis fibroblast-like synoviocytes. Rheumatology 2007, 46, 920–926. [Google Scholar] [CrossRef] [Green Version]
- Zhang, N.; Jiang, Y.; Mu, F.; Wu, H.; You, Q. Gentiopicrin exerts anti-rheumatic effect in human fibroblast-like synoviocytes via inhibition of p38MAPK/NF-kappaB pathway. Cell. Mol. Biol. (Noisy-Le-Grand) 2019, 65, 85–90. [Google Scholar] [CrossRef]
- Luo, X.; Zuo, X.; Zhou, Y.; Zhang, B.; Shi, Y.; Liu, M.; Wang, K.; McMillian, D.R.; Xiao, X. Extracellular heat shock protein 70 inhibits tumour necrosis factor-alpha induced proinflammatory mediator production in fibroblast-like synoviocytes. Arthritis Res. Ther. 2008, 10, R41. [Google Scholar] [CrossRef] [Green Version]
- Ni, S.; Li, C.; Xu, N.; Liu, X.; Wang, W.; Chen, W.; Wang, Y.; van Wijnen, A.J. Follistatin-like protein 1 induction of matrix metalloproteinase 1, 3 and 13 gene expression in rheumatoid arthritis synoviocytes requires MAPK, JAK/STAT3 and NF-kappaB pathways. J. Cell. Physiol. 2018, 234, 454–463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshida, S.; Katoh, T.; Tetsuka, T.; Uno, K.; Matsui, N.; Okamoto, T. Involvement of thioredoxin in rheumatoid arthritis: Its costimulatory roles in the TNF-alpha-induced production of IL-6 and IL-8 from cultured synovial fibroblasts. J. Immunol. 1999, 163, 351–358. [Google Scholar] [PubMed]
- Arlier, S.; Kayisli, U.A.; Arici, A. Tumor necrosis factor alfa and interleukin 1 alfa induced phosphorylation and degradation of inhibitory kappa B alpha are regulated by estradiol in endometrial cells. Turk. J. Obs. Gynecol. 2018, 15, 50–59. [Google Scholar] [CrossRef]
- Georganas, C.; Liu, H.; Perlman, H.; Hoffmann, A.; Thimmapaya, B.; Pope, R.M. Regulation of IL-6 and IL-8 expression in rheumatoid arthritis synovial fibroblasts: The dominant role for NF-kappa B but not C/EBP beta or c-Jun. J. Immunol. 2000, 165, 7199–7206. [Google Scholar] [CrossRef] [Green Version]
- Bramley, E.; Lean, I.J.; Fulkerson, W.J.; Costa, N.D. Clinical acidosis in a Gippsland dairy herd. Aust. Vet. J. 2005, 83, 347–352. [Google Scholar] [CrossRef]
- Andersson, L.; Liberg, P. Blood serum and synovial fluid in bovine laminitis and arthritis, with particular reference to the protein composition. Acta Vet. Scand. 1980, 21, 567–577. [Google Scholar]
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | Size (Bp) |
---|---|---|---|
bCXCL-1 | CCGCCCCCATGGTTAAGAAA | AAACACAGTCCAGATGGCCC | 161 |
bCXCL-2 | CCAGCTCTAACTGACCAGGTG | ATGGCCTTAGGAGGTGGTGA | 116 |
bCXCL-3 | GCCATTGCCTGCAAACTT | TGCTGCCCTTGTTTAGCA | 189 |
bCXCL-6 | ATTCATCCCAAAACGGTCAGTG | CAGACTTCCCTTCCATTCTTCAAG | 101 |
bIL-6 | ACTGGCAGAAAATAAGCTGAATCTTC | TGATCAAGCAAATCGCCTGAT | 89 |
bIL-8 | ATGACTTCCAAGCTGGCTGTTG | TTGATAAATTTGGGGTGGAAAG | 149 |
bMCT-1 | CGCCGCGAGCCGCGTATAA | CCTCCAACTGCTGGTGGCATTGT | 85 |
bMCT-2 | CCACCCAGTGCCGGAGACCA | TCCCGTGTCTAAGGTTGCCCAGG | 70 |
bMCT-3 | GAGGCTGTGGCTGTGCTCATCG | GATCTCGTAGTTCTTGAGCGCGTCC | 72 |
bMCT-4 | ATCCAGCAAGCCCTCCCTTCCC | CCATGGCCAGGAGGGCTGATTCT | 100 |
bRPS9 | GCTGACGCTGGATGAGAAAGACCC | ATCCAGCACCCCGATACGGACG | 85 |
bRPS9 | TTCCAGAGCGTTGGCTTAGG | ACCCTCCAGACCTCACGTTT | 181 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Manosalva, C.; Quiroga, J.; Teuber, S.; Cárdenas, S.; Carretta, M.D.; Morán G, G.; Alarcón, P.; Hidalgo, M.A.; Burgos, R.A. D-Lactate Increases Cytokine Production in Bovine Fibroblast-Like Synoviocytes via MCT1 Uptake and the MAPK, PI3K/Akt, and NFκB Pathways. Animals 2020, 10, 2105. https://doi.org/10.3390/ani10112105
Manosalva C, Quiroga J, Teuber S, Cárdenas S, Carretta MD, Morán G G, Alarcón P, Hidalgo MA, Burgos RA. D-Lactate Increases Cytokine Production in Bovine Fibroblast-Like Synoviocytes via MCT1 Uptake and the MAPK, PI3K/Akt, and NFκB Pathways. Animals. 2020; 10(11):2105. https://doi.org/10.3390/ani10112105
Chicago/Turabian StyleManosalva, Carolina, John Quiroga, Stefanie Teuber, Sebastián Cárdenas, María Daniella Carretta, Gabriel Morán G, Pablo Alarcón, María Angélica Hidalgo, and Rafael Agustín Burgos. 2020. "D-Lactate Increases Cytokine Production in Bovine Fibroblast-Like Synoviocytes via MCT1 Uptake and the MAPK, PI3K/Akt, and NFκB Pathways" Animals 10, no. 11: 2105. https://doi.org/10.3390/ani10112105