Barley Yellow Dwarf Virus Influences Its Vector’s Endosymbionts but Not Its Thermotolerance
Abstract
:1. Introduction
2. Materials and Methods
2.1. General Outline of Experimental Design
2.2. Maintenance of Virus Isolate
2.3. Aphid Line Creation and Maintenance
2.4. Measuring Thermotolerance
2.5. Measuring Endosymbiont and BYDV Density
2.6. Data Analysis
2.7. Comparison of Genomic Backgrounds
3. Results
3.1. Thermotolerance
3.2. BYVD and Endosymbiont Interactions
3.3. Comparison of Genomic Backgrounds
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Aradottir, G.I.; Crespo-Herrera, L. Host plant resistance in wheat to barley yellow dwarf viruses and their aphid vectors: A review. Curr. Opin. Insect Sci. 2021, 45, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Mc Namara, L.; Gauthier, K.; Walsh, L.; Thébaud, G.; Gaffney, M.; Jacquot, E. Management of yellow dwarf disease in Europe in a post-neonicotinoid agriculture. Pest. Manage Sci. 2020, 76, 2276–2285. [Google Scholar] [CrossRef] [PubMed]
- Nancarrow, N.; Aftab, M.; Hollaway, G.; Rodoni, B.; Trębicki, P. Yield Losses Caused by Barley Yellow Dwarf Virus-PAV Infection in Wheat and Barley: A Three-Year Field Study in South-Eastern Australia. Microorganisms 2021, 9, 645. [Google Scholar] [CrossRef] [PubMed]
- Miller, W.; Rasochova, L. Barley Yellow Dwarf Viruses. Annu. Rev. Phytopathol. 1997, 35, 167–190. [Google Scholar] [CrossRef] [PubMed]
- Power, A.G.; Seaman, A.J.; Gray, S.M. Aphid transmission of barley yellow dwarf virus: Inoculation access periods and epidemiological implications. Phytopathology 1991, 81, 545–548. [Google Scholar] [CrossRef]
- Umina, P.A.; Reidy-Crofts, J.; Babineau, M.; Maino, J.L.; Edwards, O.R. Susceptibility of the bird cherry-oat aphid, Rhopalosiphum padi (Hemiptera: Aphididae), to four insecticides. Austral Entomol. 2020, 59, 838–844. [Google Scholar] [CrossRef]
- Wang, K.; Zhang, M.; Huang, Y.; Yang, Z.; Su, S.; Chen, M. Characterisation of imidacloprid resistance in the bird cherry-oat aphid, Rhopalosiphum padi, a serious pest on wheat crops. Pest Manag. Sci. 2018, 74, 1457–1465. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.-H.; Han, Z.-J.; Qiao, X.-F.; Qu, M.-J. Mutations in acetylcholinesterase genes of Rhopalosiphum padi resistant to organophosphate and carbamate insecticides. Genome 2007, 50, 172–179. [Google Scholar] [CrossRef]
- Zuo, Y.; Wang, K.; Zhang, M.; Peng, X.; Piñero, J.C.; Chen, M. Regional susceptibilities of Rhopalosiphum padi (Hemiptera: Aphididae) to ten insecticides. Fla. Entomol. 2016, 99, 269–275. [Google Scholar] [CrossRef]
- Foster, S.P.; Paul, V.L.; Slater, R.; Warren, A.; Denholm, I.; Field, L.M.; Williamson, M.S. A mutation (L1014F) in the voltage-gated sodium channel of the grain aphid, Sitobion avenae, is associated with resistance to pyrethroid insecticides. Pest Manag. Sci. 2014, 70, 1249–1253. [Google Scholar] [CrossRef]
- Mauck, K.E.; De Moraes, C.M.; Mescher, M.C. Deceptive chemical signals induced by a plant virus attract insect vectors to inferior hosts. Proc. Natl. Acad. Sci. USA 2010, 107, 3600–3605. [Google Scholar] [CrossRef] [PubMed]
- Murdock, C.C.; Luckhart, S.; Cator, L.J. Immunity, host physiology, and behaviour in infected vectors. Curr. Opin. Insect Sci. 2017, 20, 28–33. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Niu, H.; Luo, G.; Zhao, D.; Hoffmann, A.; Guo, H. A virus drives its vector to virus-susceptible plants at the cost of vector fitness. J. Pest Sci. 2023, 1–12. [Google Scholar] [CrossRef]
- Ingwell, L.L.; Eigenbrode, S.D.; Bosque-Pérez, N.A. Plant viruses alter insect behavior to enhance their spread. Sci. Rep. 2012, 2, 578. [Google Scholar] [CrossRef] [PubMed]
- Porras, M.; De Moraes, C.M.; Mescher, M.C.; Rajotte, E.G.; Carlo, T.A. A plant virus (BYDV) promotes trophic facilitation in aphids on wheat. Sci. Rep. 2018, 8, 11709. [Google Scholar] [CrossRef] [PubMed]
- Porras, M.F.; Navas, C.A.; Marden, J.H.; Mescher, M.C.; De Moraes, C.M.; Pincebourde, S.; Sandoval-Mojica, A.; Raygoza-Garay, J.A.; Holguin, G.A.; Rajotte, E.G.; et al. Enhanced heat tolerance of viral-infected aphids leads to niche expansion and reduced interspecific competition. Nat. Commun. 2020, 11, 1184. [Google Scholar] [CrossRef] [PubMed]
- Van Der Broek, L.; Gill, C.C. The Median Latent Periods for Three Isolates of Barley Yellow Dwarf Virus in Aphid Vectors. Phytopathology 1980, 70, 644–646. [Google Scholar] [CrossRef]
- Nancarrow, N.; Constable, F.E.; Finlay, K.J.; Freeman, A.J.; Rodoni, B.C.; Trebicki, P.; Vassiliadis, S.; Yen, A.L.; Luck, J.E. The effect of elevated temperature on Barley yellow dwarf virus-PAV in wheat. Virus Res. 2014, 186, 97–103. [Google Scholar] [CrossRef]
- Zindel, R.; Gottlieb, Y.; Aebi, A. Arthropod symbioses: A neglected parameter in pest- and disease-control programmes. J. Appl. Ecol. 2011, 48, 864–872. [Google Scholar] [CrossRef]
- Leybourne, D.J.; Bos, J.I.; Valentine, T.A.; Karley, A.J. The price of protection: A defensive endosymbiont impairs nymph growth in the bird cherry-oat aphid, Rhopalosiphum padi. Insect Sci. 2020, 27, 69–85. [Google Scholar] [CrossRef]
- Yang, Q.; Umina, P.A.; Wei, S.; Bass, C.; Yu, W.; Robinson, K.L.; Gill, A.; Zhan, D.; Ward, S.E.; van Rooyen, A.; et al. Diversity and regional variation of endosymbionts in the green peach aphid, Myzus persicae (Sulzer). Diversity 2023, 15, 206. [Google Scholar] [CrossRef]
- Gong, J.T.; Li, Y.; Li, T.P.; Liang, Y.; Hu, L.; Zhang, D.; Zhou, C.Y.; Yang, C.; Zhang, X.; Zha, S.S.; et al. Stable Introduction of Plant-Virus-Inhibiting Wolbachia into Planthoppers for Rice Protection. Curr. Biol. 2020, 30, 4837–4845.e5. [Google Scholar] [CrossRef] [PubMed]
- Buchner, P. Endosymbiosis of Animals with Plant Microorganisms; Interscience Publishers: New York, NY, USA, 1965. [Google Scholar]
- Moran, N.A.; Baumann, P. Bacterial endosymbionts in animals. Curr. Opin. Microbiol. 2000, 3, 270–275. [Google Scholar] [CrossRef] [PubMed]
- Hector, T.E.; Hoang, K.L.; Li, J.; King, K.C. Symbiosis and host responses to heating. Trends Ecol. Evol. 2022, 37, 611–624. [Google Scholar] [CrossRef] [PubMed]
- Douglas, A.E. Nutritional interactions in insect-microbial symbioses: Aphids and their symbiotic bacteria Buchnera. Annu. Rev. Entomol. 1998, 43, 17–37. [Google Scholar] [CrossRef] [PubMed]
- Pinheiro, P.V.; Kliot, A.; Ghanim, M.; Cilia, M. Is there a role for symbiotic bacteria in plant virus transmission by insects? Curr. Opin. Insect Sci. 2015, 8, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Filichkin, S.A.; Brumfield, S.; Filichkin, T.P.; Young, M.J. In vitro interactions of the aphid endosymbiotic SymL chaperonin with barley yellow dwarf virus. J. Virol. 1997, 71, 569–577. [Google Scholar] [CrossRef]
- Bouvaine, S.; Boonham, N.; Douglas, A.E. Interactions between a luteovirus and the GroEL chaperonin protein of the symbiotic bacterium Buchnera aphidicola of aphids. J. Gen. Virol. 2011, 92, 1467–1474. [Google Scholar] [CrossRef]
- Cilia, M.; Tamborindeguy, C.; Fish, T.; Howe, K.; Thannhauser, T.W.; Gray, S. Genetics Coupled to Quantitative Intact Proteomics Links Heritable Aphid and Endosymbiont Protein Expression to Circulative Polerovirus Transmission. J. Virol. 2011, 85, 2148–2166. [Google Scholar] [CrossRef]
- Oliver, K.M.; Moran, N.A.; Hunter, M.S. Costs and benefits of a superinfection of facultative symbionts in aphids. Proc. R. Soc. B Biol. Sci. 2006, 273, 1273–1280. [Google Scholar] [CrossRef]
- Zytynska, S.E.; Tighiouart, K.; Frago, E. Benefits and costs of hosting facultative symbionts in plant-sucking insects: A meta-analysis. Mol. Ecol. 2021, 30, 2483–2494. [Google Scholar] [CrossRef] [PubMed]
- Higashi, C.H.; Nichols, W.L.; Chevignon, G.; Patel, V.; Allison, S.E.; Kim, K.L.; Strand, M.R.; Oliver, K.M. An aphid symbiont confers protection against a specialized RNA virus, another increases vulnerability to the same pathogen. Mol. Ecol. 2023, 32, 936–950. [Google Scholar] [CrossRef] [PubMed]
- Ross, P.A.; Turelli, M.; Hoffmann, A.A. Evolutionary ecology of Wolbachia releases for disease control. Annu. Rev. Genet. 2019, 53, 93–116. [Google Scholar] [CrossRef] [PubMed]
- Lei, T.; Zhao, J.; Wang, H.L.; Liu, Y.Q.; Liu, S.S. Impact of a novel Rickettsia symbiont on the life history and virus transmission capacity of its host whitefly (Bemisia tabaci). Insect Sci. 2021, 28, 377–391. [Google Scholar] [CrossRef] [PubMed]
- Kliot, A.; Cilia, M.; Czosnek, H.; Ghanim, M. Implication of the Bacterial Endosymbiont Rickettsia spp. in Interactions of the Whitefly Bemisia tabaci with Tomato yellow leaf curl virus. J. Virol. 2014, 88, 5652–5660. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.; Bosquée, E.; Fan, J.; Liu, Y.; Bragard, C.; Francis, F.; Chen, H. Proteomic and Transcriptomic Analysis for Identification of Endosymbiotic Bacteria Associated with BYDV Transmissin Efficiency by Sitobion miscanthi. Plants 2022, 11, 23. [Google Scholar] [CrossRef] [PubMed]
- Łukasik, P.; van Asch, M.; Guo, H.; Ferrari, J.; Charles, J.; Godfray, H. Unrelated facultative endosymbionts protect aphids against a fungal pathogen. Ecol. Lett. 2013, 16, 214–218. [Google Scholar] [CrossRef] [PubMed]
- Gu, X.; Ross, P.A.; Gill, A.; Yang, Q.; Ansermin, E.; Sharma, S.; Soleimannejad, S.; Sharma, K.; Callahan, A.; Brown, C.; et al. A rapidly spreading deleterious aphid endosymbiont that uses horizontal as well as vertical transmission. Proc. Natl. Acad. Sci. USA 2023, 120, e2217278120. [Google Scholar] [CrossRef]
- Enders, L.S.; Hefley, T.J.; Girvin, J.J.; Whitworth, R.J.; Smith, C.M. Spatiotemporal Distribution and Environmental Drivers of Barley yellow dwarf virus and Vector Abundance in Kansas. Phytopathology 2018, 108, 1196–1205. [Google Scholar] [CrossRef]
- Chirgwin, E.; Yang, Q.; Umina, P.A.; Gill, A.; Soleimannejad, S.; Gu, X.; Ross, P.; Hoffmann, A.A. Fungicides have transgenerational effects on Rhopalosiphum padi but not their endosymbionts. Pest. Manag. Sci. 2022, 78, 4709–4718. [Google Scholar] [CrossRef]
- Tsuchida, T.; Koga, R.; Fujiwara, A.; Fukatsu, T. Phenotypic Effect of “Candidatus Rickettsiella viridis,” a Facultative Symbiont of the Pea Aphid (Acyrthosiphon pisum), and Its Interaction with a Coexisting Symbiont. Appl. Environ. Microbiol. 2014, 80, 525. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.Q.; Purcell, A.H. Occurrence and transmission of facultative endosymbionts in aphids. Curr. Microbiol. 1997, 34, 220–225. [Google Scholar] [CrossRef] [PubMed]
- Brooks, M.E.; Kristensen, K.; Van Benthem, K.J.; Magnusson, A.; Berg, C.W.; Nielsen, A.; Skaug, H.J.; Machler, M.; Bolker, B.M. glmmTMB Balances Speed and Flexibility Among Packages for Zero-inflated Generalized Linear Mixed Modeling. R J. 2017, 9, 378–400. [Google Scholar] [CrossRef]
- Hartig, F.; Hartig, M.F. Package ‘DHARMa’. R Package. Available online: https://CRAN.R-project.org/package=DHARMa (accessed on 5 September 2022).
- Quinn, G.P.; Keough, M.J. Experimental Design and Data Analysis for Biologists; Cambridge University Press: Port Melbourne, Australia, 2002. [Google Scholar]
- Fox, J.; Weisberg, S. An R Companion to Applied Regression; Sage Publications: Thousand Oaks, CA, USA, 2018. [Google Scholar]
- Gaggiotti, O.E.; Chao, A.; Peres-Neto, P.; Chiu, C.H.; Edwards, C.; Fortin, M.J.; Jost, L.; Richards, C.M.; Selkoe, K.A. Diversity from genes to ecosystems: A unifying framework to study variation across biological metrics and scales. Evol. Appl. 2018, 11, 1176–1193. [Google Scholar] [CrossRef] [PubMed]
- Terblanche, J.S.; Deere, J.A.; Clusella-Trullas, S.; Janion, C.; Chown, S.L. Critical thermal limits depend on methodological context. Proc. Biol. Sci. 2007, 274, 2935–2942. [Google Scholar] [CrossRef] [PubMed]
- Gipson, S.A.Y.; Pettersen, A.K.; Heffernan, L.; Hall, M.D. Host Sex Modulates the Energetics of Pathogen Proliferation and Its Dependence on Environmental Resources. Am. Nat. 2022, 199, E186–E196. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, S.E.; Rogers, E.S.; Little, T.J.; Read, A.F. Host-parasite and genotype-by-environment interactions: Temperature modifies potential for selection by a sterilizing pathogen. Evolution 2005, 59, 70–80. [Google Scholar]
- Lambrechts, L.; Chevillon, C.; Albright, R.G.; Thaisomboonsuk, B.; Richardson, J.H.; Jarman, R.G.; Scott, T.W. Genetic specificity and potential for local adaptation between dengue viruses and mosquito vectors. BMC Evol. Biol. 2009, 9, 160. [Google Scholar] [CrossRef]
- Lourenco-De-Oliveira, R.; Caro, V.; Lambrechts, L.; Failloux, A.B.; Zouache, K.; Fontaine, A.; Vega-Rua, A.; Mousson, L.; Thiberge, J.M. Three-way interactions between mosquito population, viral. Proc. R. Soc. B 2014, 281, 20141078. [Google Scholar]
- Habekuss, A.; Leistner, H.U.; Schliephake, C. Characterization of Rhopalosiphum padi genotypes differing in the geographical origin by transmission efficiency of Barley yellow dwarf viruses and molecular markers. Z. Pflanzenkrankh. Pflanzenschutz-J. Plant Dis. Prot. 1999, 106, 437–443. [Google Scholar]
- Cao, J.-Y.; Xing, K.; Liu, H.-P.; Zhao, F. Effects of developmental acclimation on fitness costs differ between two aphid species. J. Therm. Biol. 2018, 78, 58–64. [Google Scholar] [CrossRef] [PubMed]
- Majeed, M.Z.; Sayed, S.; Bo, Z.; Raza, A.; Ma, C.S. Bacterial Symbionts Confer Thermal Tolerance to Cereal Aphids Rhopalosiphum padi and Sitobion avenae. Insects 2022, 13, 3. [Google Scholar] [CrossRef] [PubMed]
- Terblanche, J.S.; Hoffmann, A.A. Validating measurements of acclimation for climate change adaptation. Curr. Opin. Insect Sci. 2020, 41, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Clusella-Trullas, S.; Garcia, R.A.; Terblanche, J.S.; Hoffmann, A.A. How useful are thermal vulnerability indices? Trends Ecol. Evol. 2021, 36, 1000–1010. [Google Scholar] [CrossRef] [PubMed]
- Ørsted, M.; Jørgensen, L.; Overgaard, J. Finding the right thermal limit: A framework to reconcile ecological, physiological and methodological aspects of CTmax in ectotherms. J. Exp. Biol. 2022, 225, jeb244514. [Google Scholar] [CrossRef] [PubMed]
- Kiefer, J.S.; Batsukh, S.; Bauer, E.; Hirota, B.; Weiss, B.; Wierz, J.C.; Fukatsu, T.; Kaltenpoth, M.; Engl, T. Inhibition of a nutritional endosymbiont by glyphosate abolishes mutualistic benefit on cuticle synthesis in Oryzaephilus surinamensis. Commun. Biol. 2021, 4, 554. [Google Scholar]
- Heyworth, E.R.; Smee, M.R.; Ferrari, J. Aphid facultative symbionts aid recovery of their obligate symbiont and their host after heat stress. Front. Ecol. Evol. 2020, 8, 56. [Google Scholar] [CrossRef]
- Gao, Y.F.; Ren, Y.J.; Chen, J.C.; Cao, L.J.; Qiao, G.H.; Zong, S.X.; Hoffmann, A.A.; Wei, S.J.; Yang, Q. Effects of fungicides on fitness and Buchnera endosymbiont density in Aphis gossypii. Pest. Manag. Sci. 2023, 79, 4282–4289. [Google Scholar] [CrossRef]
- Patton, M.F.; Hansen, A.K.; Casteel, C.L. Potato leafroll virus reduces Buchnera aphidocola titer and alters vector transcriptome responses. Sci. Rep. 2021, 11, 23931. [Google Scholar] [CrossRef]
- Whittle, M.; Barreaux, A.M.G.; Bonsall, M.B.; Ponton, F.; English, S. Insect-host control of obligate, intracellular symbiont density. Proc. R. Soc. B Biol. Sci. 2021, 288, 20211993. [Google Scholar] [CrossRef]
- Davidson, E.W.; Segura, B.J.; Steele, T.; Hendrix, D.L. Microorganisms influence the composition of honeydew produced by the silverleaf whitefly, Bemisia argentifolii. J. Insect Physiol. 1994, 40, 1069–1076. [Google Scholar] [CrossRef]
- Parra, J.R. The evolution of artificial diets and their interactions in science and technology. In Insect Bioecology and Nutrition for Integrated Pest Management; CRC Press: Boca Raton, FL, USA, 2012; pp. 51–92. [Google Scholar]
- Rutledge, L.; Ward, R.; Gould, D. Studies on the feeding response of mosquitoes to nutritive solutions in a new membrane feeder. Mosq. News. 1964, 24, 407–409. [Google Scholar]
- Linak, J.A.; Jacobson, A.L.; Sit, T.L.; Kennedy, G.G. Relationships of virus titers and transmission rates among sympatric and allopatric virus isolates and thrips vectors support local adaptation. Sci. Rep. 2020, 10, 7649. [Google Scholar] [CrossRef] [PubMed]
- Rotenberg, D.; Krishna Kumar, N.K.; Ullman, D.E.; Montero-Astúa, M.; Willis, D.K.; German, T.L.; Whitfield, A.E. Variation in Tomato spotted wilt virus titer in Frankliniella occidentalis and its association with frequency of transmission. Phytopathology 2009, 99, 404–410. [Google Scholar] [CrossRef] [PubMed]
- Ammar, E.-D.; Gingery, R.; Madden, L. Transmission efficiency of three isolates of maize stripe tenuivirus in relation to virus titre in the planthopper vector. Plant Pathol. 1995, 44, 239–243. [Google Scholar] [CrossRef]
- Wu, B.; Blanchard-Letort, A.; Liu, Y.; Zhou, G.; Wang, X.; Elena, S.F. Dynamics of Molecular Evolution and Phylogeography of Barley yellow dwarf virus-PAV. PLoS ONE 2011, 6, e16896. [Google Scholar] [CrossRef] [PubMed]
- Morales-Hojas, R.; Gonzalez-Uriarte, A.; Alvira Iraizoz, F.; Jenkins, T.; Alderson, L.; Kruger, T.; Hall, M.J.; Greenslade, A.; Shortall, C.R.; Bell, J.R. Population genetic structure and predominance of cyclical parthenogenesis in the bird cherry-oat aphid Rhopalosiphum padi in England. Evol. Appl. 2020, 13, 1009–1025. [Google Scholar] [CrossRef] [PubMed]
- Simon, J.C.; Carrel, E.; Hebert, P.D.N.; Dedryver, C.A.; Bonhomme, J.; Gallic, J.F.L. Genetic diversity and mode of reproduction in French populations of the aphid Rhopalosiphum padi L. Heredity 1996, 76, 305–313. [Google Scholar] [CrossRef]
- Duan, X.; Peng, X.; Qiao, X.; Chen, M. Life cycle and population genetics of bird cherry-oat aphids Rhopalosiphum padi in China: An important pest on wheat crops. J. Pest. Sci. 2017, 90, 103–116. [Google Scholar] [CrossRef]
- Zhao, F.; Xing, K.; Hoffmann, A.A.; Ma, C.-S. The importance of timing of heat events for predicting the dynamics of aphid pest populations. Pest. Manag. Sci. 2019, 75, 1866–1874. [Google Scholar] [CrossRef]
- Chen, Y.; Quan, Y.; Verheggen, F.; Wang, Z.; Francis, F.; He, K. Differential thermal tolerance across life stages under extreme high temperatures crossed with feeding status in corn leaf aphid. Ecol. Entomol. 2021, 46, 533–540. [Google Scholar] [CrossRef]
- Li, Y.J.; Chen, S.Y.; Jørgensen, L.B.; Overgaard, J.; Renault, D.; Colinet, H.; Ma, C.S. Interspecific differences in thermal tolerance landscape explain aphid community abundance under climate change. J. Therm. Biol. 2023, 114, 103583. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Zhang, W.; Hoffmann, A.A.; Ma, C.S. Night warming on hot days produces novel impacts on development, survival and reproduction in a small arthropod. J. Anim. Ecol. 2014, 83, 769–778. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Hoffmann, A.A.; Xing, K.; Ma, C.-S. Life stages of an aphid living under similar thermal conditions differ in thermal performance. J. Insect Physiol. 2017, 99, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Tarailo-Graovac, M.; Chen, N.S. Using RepeatMasker to identify repetitive elements in genomic sequences. Curr. Protoc. Bioinform. 2009, 4, 1–14. [Google Scholar] [CrossRef]
- Flynn, J.M.; Hubley, R.; Goubert, C.; Rosen, J.; Clark, A.G.; Feschotte, C.; Smit, A.F. RepeatModeler2 for automated genomic discovery of transposable element families. Proc. Natl. Acad. Sci. USA 2020, 117, 9451–9457. [Google Scholar] [CrossRef]
- Holst, F.; Bolger, A.; Günther, C.; Maß, J.; Triesch, S.; Kindel, F.; Kiel, N.; Saadat, N.; Ebenhöh, O.; Usadel, B.; et al. Helixer- de novo prediction of primary eukaryotic gene models combining deep learning and a hidden markov model. bioRxiv 2023. [Google Scholar] [CrossRef]
- Huerta-Cepas, J.; Szklarczyk, D.; Heller, D.; Hernández-Plaza, A.; Forslund, S.K.; Cook, H.; Mende, D.R.; Letunic, I.; Rattei, T.; Jensen, L.J.; et al. eggNOG 5.0: A hierarchical, functionally and phylogenetically annotated orthology resource based on 5090 organisms and 2502 viruses. Nucleic Acids Res. 2019, 47, D309–D314. [Google Scholar] [CrossRef]
- Huerta-Cepas, J.; Forslund, K.; Coelho, L.P.; Szklarczyk, D.; Jensen, L.J.; Von Mering, C.; Bork, P. Fast genome-wide functional annotation through orthology assignment by eggNOG-Mapper. Mol. Biol. Evol. 2017, 34, 2115–2122. [Google Scholar] [CrossRef] [PubMed]
- Pertea, G.; Pertea, M. GFF Utilities: GffRead and GffCompare. F1000Research 2020, 9. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Li, H. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics 2011, 27, 2987–2993. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve years of SAMtools and BCFtools. Gigascience 2021, 10, giab008. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; DePristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. The variant call format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef]
- Joshua, A.T.; Cynthia, R. genomalicious: Serving up a smorgasbord of R functions for population genomic analyses. bioRxiv 2019. [Google Scholar] [CrossRef]
- Wickham, H.; Averick, M.; Bryan, J.; Chang, W.; McGowan, L.D.; François, R.; Grolemund, G.; Hayes, A.; Henry, L.; Hester, J.; et al. Welcome to the Tidyverse. J. Open Source Softw. 2019, 4, 1686. [Google Scholar] [CrossRef]
- Wickham, H. ggplot2. WIREs Comput. Stat. 2011, 3, 180–185. [Google Scholar] [CrossRef]
Organism Targeted | Primer Name | Primer Sequence | Reference |
---|---|---|---|
BYDV-PAV | BYL | GTGAATGAATTCAGTAGGCCGT | [40] |
BYR | GTTCCGGTGTTGAGGAGTCT | ||
Buchnera | Buch_16S_F1c | AAAGCTTGCTTTCTTGTCG | [41] |
Buch_16S_R1a | GGGTTCATCCAAAAGCATG | ||
Rickettsiella | RCL16S-211F | GGGCCTTGCGCTCTAGGT | [42] |
RCL16S-470R | TGGGTACCGTCACAGTAATCGA | ||
β-actin | actin_aphid_F1 | GTGATGGTGTATCTCACACTGTC | [41] |
actin_aphid_R1 | AGCAGTGGTGGTGAAACTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chirgwin, E.; Yang, Q.; Umina, P.A.; Thia, J.A.; Gill, A.; Song, W.; Gu, X.; Ross, P.A.; Wei, S.-J.; Hoffmann, A.A. Barley Yellow Dwarf Virus Influences Its Vector’s Endosymbionts but Not Its Thermotolerance. Microorganisms 2024, 12, 10. https://doi.org/10.3390/microorganisms12010010
Chirgwin E, Yang Q, Umina PA, Thia JA, Gill A, Song W, Gu X, Ross PA, Wei S-J, Hoffmann AA. Barley Yellow Dwarf Virus Influences Its Vector’s Endosymbionts but Not Its Thermotolerance. Microorganisms. 2024; 12(1):10. https://doi.org/10.3390/microorganisms12010010
Chicago/Turabian StyleChirgwin, Evatt, Qiong Yang, Paul A. Umina, Joshua A. Thia, Alex Gill, Wei Song, Xinyue Gu, Perran A. Ross, Shu-Jun Wei, and Ary A. Hoffmann. 2024. "Barley Yellow Dwarf Virus Influences Its Vector’s Endosymbionts but Not Its Thermotolerance" Microorganisms 12, no. 1: 10. https://doi.org/10.3390/microorganisms12010010