Next Article in Journal
Discovery of Antimicrobial Peptides That Can Accelerate Culture Diagnostics of Slow-Growing Mycobacteria Including Mycobacterium tuberculosis
Next Article in Special Issue
Diversity and Network Relationship Construction of Soil Fungal Communities in Lactarius hatsudake Tanaka Orchard during Harvest
Previous Article in Journal
SARS-CoV-2 Induced Herpes Virus Reactivations and Related Implications in Oncohematology: When Lymphocytopenia Sets in and Immunosurveillance Drops Out
Previous Article in Special Issue
Diversity and Abundance of Bacterial and Fungal Communities Inhabiting Camellia sinensis Leaf, Rhizospheric Soil, and Gut of Agriophara rhombata
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 11
Issue 9
10.3390/microorganisms11092224
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria

by
Haodong Sha
1,2,3,
Xinyi Liu
1,2,3,
Xiaoe Xiao
1,2,
Han Zhang
1,2,3,
Xueting Gu
1,2,3,
Weiliang Chen
1,2,3 and
Bizeng Mao
1,2,3,*
1
Institute of Biotechnology, College of Agriculture & Biotechnology, Zhejiang University, Hangzhou 310058, China
2
Ministry of Agriculture Key Lab of Molecular Biology of Crop Pathogens and Insects, Hangzhou 310058, China
3
Zhejiang Tongxiang Hangbaiju Technology Academy, Tongxiang 314500, China
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(9), 2224; https://doi.org/10.3390/microorganisms11092224
Submission received: 15 August 2023 / Revised: 29 August 2023 / Accepted: 29 August 2023 / Published: 1 September 2023
(This article belongs to the Special Issue Plant-Microbe Interaction State-of-the-Art Research in China)
Browse Figures
Versions Notes

Abstract

:
Chrysanthemum × morifolium Ramat. is a famous perennial herb with medicinal, edible, and ornamental purposes, but the occurrence of plant diseases can reduce its value. A serious disease that caused leaf spots in C. morifolium appeared in 2022 in Tongxiang City, Zhejiang Province, China. The C. morifolium leaves with brown spots were collected and used for pathogen isolation. By completing Koch’s postulates, it was proven that the isolate had pathogenicity to infect C. morifolium. It was determined that the pathogen isolated from chrysanthemum leaves was Nigrospora oryzae, through morphology and a multilocus sequence analysis method using a combination of the internal transcribed spacer gene (ITS), beta-tubulin gene (TUB2), and translation elongation factor 1-alpha gene (TEF1-α). This is the first report of C. morifolium disease caused by N. oryzae in the world. Through dual culture assay on PDA plates, 12 strains of bacteria with antagonistic effects were selected from 231 strains from the C. morifolium phyllosphere, among which Bacillus siamensis D65 had the best inhibitory effect on N. oryzae growth. In addition, the components of a strain D65 fermentation broth were profiled by SPME-GC-Q-TOF analysis, providing a foundation for further application and research of biological control.

1. Introduction

Chrysanthemum × morifolium Ramat., a perennial herb native to China, is widely distributed in China and has a long history of cultivation [1]. Since ancient times, Chinese people have been fond of using chrysanthemums as a cultural carrier; there exist many poems praising the chrysanthemum and endowing it with a noble character and the quality of indifference to fame and wealth. The chrysanthemum is also an important traditional Chinese medicine [2]; it contains volatile oils, triterpenes, flavonoids, phenolic acids, and other phytometabolites, which have antimicrobial, antiviral, antioxidant, antiaging, anticancer, and anti-inflammatory activities. It is popular as well as important, and is usually used as food and tea in China [3]. With the development of the times and cultural exchanges, the chrysanthemum has spread all over the world. Now, it has a high economic value ranking second in the cut flower trade after the rose [4].
During plant growth, fungal diseases often affect plant development. According to reports, over 19,000 fungi are known to cause diseases in crop plants worldwide [5]. The leaf is an essential organ of most plants that collects and converts solar energy for plant growth [6]. The phyllosphere, including leaves, has been estimated to make up around 60% of the biomass across all taxa on the earth, making it a key habitat for microbial organisms [7]. Pathogenic fungi, as a component of phyllosphere microbial organisms, often induce plant leaf diseases [8]. On the chrysanthemum, pathogenic fungi—including the genera Ascochyta, Septoria, and Verticillium—often cause damage to its leaves [9].
There exist a huge diversity of microbial communities in the phyllosphere of plants. In addition to pathogenic fungi, there are also other microorganisms distributed in the phyllosphere that are much more diverse and numerous than pathogenic fungi [10,11]. These microbial communities are collectively referred to as the phyllosphere microbiota [12]. Since these microorganisms occupy ecological niches that are the same as, or similar to, those of pathogenic fungi, there is a large number of antagonistic and competitive relationships between these microbial populations. These microorganisms with antagonistic effects can be screened out as Biocontrol Agents (BCA) which, when applied as a biological control, can reduce the use of pesticides [13].
There are many varieties of C. morifolium with different attributes [1,3]. For chrysanthemums used for ornamental purposes, the occurrence of leaf diseases reduces the overall aesthetic feeling of chrysanthemums and damages their ornamental value [14]. For edible and medicinal chrysanthemum varieties, leaf diseases reduce the yield of chrysanthemums by affecting photosynthesis and plant health [15,16]. Therefore, a study about chrysanthemum leaf disease is of great significance.
Tongxiang City of Zhejiang Province is a famous chrysanthemum production area on a nationwide scale, which contributes 50% of the yields of edible chrysanthemum in China [16]. In October 2022, a chrysanthemum leaf disease occurred widely in Tongxiang, where the disease incidence was estimated to be more than 10%.
In order to identify the pathogen that caused the disease and obtain potential antagonistic bacteria for the prevention and control of the disease, we conducted the following work in this study: (1) isolation and identification of the pathogen causing C. morifolium leaf spot disease; and (2) isolation of the phyllosphere bacteria of the chrysanthemum and the screening out of bacteria that have antagonistic effects on the pathogen. This work is of great significance for the research and biological control of leaf diseases in C. morifolium.

2. Materials and Methods

2.1. Pathogen Isolation and Culture Conditions

The symptomatic leaves of chrysanthemum were collected from Shimeng Town, Tongxiang City, Zhejiang Province, China (120.46° E, 30.62° N; altitude: 5 m). The collected samples were taken to the laboratory and immediately processed. Strains were isolated according to Fang’s method with slight modification [17]. Briefly, a small section (about 5 × 5 mm) taken at the border between the infected and healthy parts of the disease leaf was aseptically cut and surface-sterilized in 75% alcohol for 30 s, washed with sterile water 2 times followed by 3% sodium hypochlorite solution for 1 min, and rinsed 3 times in sterile water. Leaf sections were dried on sterilized filter paper and plated on potato dextrose agar (PDA) medium containing 50 μg/mL streptomycin and 50 μg/mL penicillin. The plates were incubated under 25 °C in the dark for 4 days. Pure mycelia were obtained by hyphae tip separation; the mycelium on the outside of the colony was picked with a sterilized toothpick and placed on new plates for a new round of culture until the pure colony was obtained.

2.2. Pathogenicity Tests and Morphological Observations

In order to verify the pathogenicity of the isolated fungi, according to Zhang’s method with small modification [18], the leaves and branches were put on a moist sterile filter paper in Petri dishes, a 7 × 7 mm mycelium plug was placed on the wounded leaves, and the sterile PDA was placed on the wounded leaves as the controls. The dishes were incubated in a growth chamber under artificial light (12/12 h light/dark) at 30 °C and 80% humidity, and the symptoms were observed after 5–7 days. The microstructures of spores and hyphae were observed with a Nikon Eclipse Ni microscope equipped with a Nikon DS-Fi2 digital camera after cultivation for 2 weeks.

2.3. Phylogenetic Analysis

2.3.1. Genomic DNA Extraction and PCR Amplification

The mycelia cultured on PDA for 7 days was scraped off with a sterile scalpel, frozen with liquid nitrogen, and then transferred to a mortar for grinding. The genomic DNA of the isolates was extracted by using the Plant Genomic DNA kit (Tiangen, China). The primer pair ITS1/ITS4 was used to amplify the internal transcribed spacer region (ITS) [19], Bt2a/Bt2b was used to amplify the beta-tubulin gene (TUB2) [20], and TEF1-728F/EF2 was used to amplify the translation elongation factor 1-alpha gene (TEF1-α) [21,22]. The primers are summarized in Table 1. All amplification reactions were performed in a total volume of 20 μL mixture consisting of 10 μL of 2 × Phanta Flash Master Mix (Vazyme, Nanjing, China), 7 μL ddH2O, 1 μL of each forward and reverse primer, and 1 μL of DNA template (1 ng/μL). The amplification conditions were as follows: initial denaturation at 98 °C for 30 s, followed by 35 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 5 s, and extension at 72 °C for 10 s, with a final extension step at 72 °C for 5 min. The obtained sequences were sent to Zhejiang Youkang Biotechnology Co., Ltd. (Hangzhou, China) for sequencing.

2.3.2. Phylogenetic Analysis

Phylosuite software v1.2.3 was used as a platform for phylogenetic analysis [23]. The ITS, TUB2 and TEF1-α sequences were aligned using MAFFT v7.505 separately using the “--auto” strategy and normal alignment mode [24]. After concatenation, the best partitioning scheme and evolutionary models for 3 pre-defined partitions were selected using PartitionFinder2 v2.1.1, with all algorithms and the AICc criterion [25]. Then Bayesian Inference phylogenies were inferred using MrBayes v3.2.7a under the partition model (2 parallel runs, 2,000,000 generations), in which the initial 25% of sampled data were discarded as burn-in [26]. Figtree software v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 25 July 2023)) was used to display the tree. GenBank accession numbers obtained in this study are listed in Supplementary Table S1, and several reference sequences of the Nigrospora genus from GenBank (http://www.ncbi.nlm.nih.gov (accessed on 24 July 2023)) used in the phylogenetic analysis are listed in Supplementary Table S2.

2.4. Isolation of Bacteria from the Phyllosphere

In order to obtain culturable microbial isolates from the chrysanthemum phyllosphere, Zhan’s method was used with some modifications [27]. Firstly, 5 g of healthy chrysanthemum leaves were collected from the location where the disease occurred and those chrysanthemum leaves were disinfected with 75% ethanol for 60 s. Then, they were washed three times with sterile water and dried on sterilized filter paper. The treated leaves were placed in a mortar, 5 mL of phosphate buffer saline was added for grinding, and the grinding fluid was diluted 2, 5, and 10 times. A quantity of 50 μL of the above grinding liquid was dropped into the center of a Luria–Bertani (LB) medium plate and evenly coated. It was then incubated under dark conditions at 30 °C for 3 days. Afterwards, single colonies were picked using sterilized toothpicks and inoculated onto a new culture medium using the streak plate method, each cultured as an isolate of phyllosphere bacteria.

2.5. Screening and Identification of Antagonistic Bacteria

Fungi isolated from diseased chrysanthemum leaves and phyllosphere bacteria isolated from healthy chrysanthemum leaves were used for this experiment. Firstly, the initial screening was carried out. After 5 days’ cultivation of fungi on PDA, a small portion of the mycelium was picked using sterilized toothpicks and placed on one side of a new PDA plate, while different strains isolated from the chrysanthemum leaf space were placed on the other side. Subsequently, the plate was incubated under dark conditions at 27 °C for 5 days to observe whether the growth of fungi was inhibited. Then, the plates were screened and the strains that inhibited fungal growth were preserved.
In order to identify the strains which had antagonistic ability, 27F/1492R primer was used to amplify 16 s rRNA gene sequences (Table 1) [28]. The gene extraction, PCR reaction system, and procedure were the same as described in Section 2.3.1. Obtained sequences were blasted with type materials available at NCBI (http://www.ncbi.nlm.nih.gov (accessed on 11 August 2023)) to obtain the highest hit for taxon and strain. The EasyID Microbial Biochemical Reagent Kit (Guangdong Huankai Biotechnology Co., Ltd., Guangzhou, China) was used for testing the mannitol fermentation, glucose utilization under anaerobic conditions, amylolysis, nitrate reduction abilities, and V-P of each strain.

2.6. In Vitro Antagonism against N. oryzae

The antagonism ability of each antagonistic strain screened from the previous study was determined by dual culture assay on PDA plates [29]. In general, we took a 6 mm agar–mycelium plug obtained from N. oryzae that had been cultured on PDA medium for 5 days, placed in the center of a new PDA plate, and incubated in the dark conditions of 27 °C for 1 day. Then we added 0.5 μL of the antagonistic suspension (1 × 106 CFU/mL) dropwise to 4 areas of the PDA plate, each positioned 1 cm from the edge of the plate. PDA with dropwise water was used as a control. The plates were then cultured at 27 °C for 6 days in the dark, and the colony radius of N. oryze was measured in mm using a vernier caliper, retaining two decimal places. The experiment was repeated twice in three replicates. GraphPad Prime v8.0 was used to calculate the mean and quartiles of the colony radius. One-way ANOVA was used to obtain the difference between each strain. The statistical results are displayed as a box plot.

2.7. Identification of the Active Metabolites from the Antagonistic Strain

The strain with the best antagonistic ability was used to determine the chemical composition of its fermentation broth. After 48 h of cultivation, the strain was inoculated with sterile toothpicks into a 400 mL conical flask containing 250 mL LB medium, and incubated under dark conditions at 25 °C at 200 r/min for 3 days. The fermentation broth was obtained by centrifuging at 10,000 rpm for 10 min. LB medium was used as the control.
SPME-GC-Q-TOF (Agilent 7250 GC/Q-TOF, USA) was used to determine the composition of the antagonistic bacterial fermentation broth. Samples from the PAL Sampler were extracted for 15 min at 80 °C, incubated for 20 min, then heated and stirred for 80 min at 200 rpm. Then the sample was pre-desorbed for 2 min at 240 °C, post-desorbed for 2 min, and then pre-washed and post-washed for 35 min. After the test, the results were compared with the National Institute of Standards and Technology (NIST) library to obtain the possible composition of compounds in the antagonistic bacterial broth.
We discarded compounds with a match factor below 90, and then rounded out compounds containing silicon to ensure the accuracy of the test results. We compared the results of the fermentation broth with LB medium, and obtained compounds that were present in the fermentation broth but were not present in LB medium, which are components that may have the ability of inhibit growth of pathogenic fungi in the fermentation broth.

3. Results

3.1. Plant Disease Symptoms and Pathogenicity Test

The disease occurs widely on chrysanthemum leaves. The typical disease symptoms are shown in (Figure 1A–D). The disease spot is brown to dark brown, and the shape of the disease spots is an irregular small dot. In severe cases, each small spot can combine to form a large irregular spot. When the disease occurs seriously, the entire shoot and leaf are infected. For a single plant, the disease occurs from the top new leaf to the bottom old leaf, but the top new leaf is affected more seriously. As for a single leaf, the number and severity of the disease spots at the edge of the leaf are greater than those at the center of the leaf.
For the pathogenicity test, dark brown spot symptoms were observed on the inoculation site 5 to 7 days after being inoculated (Figure 1F,H). The symptoms were consistent with the disease observed in the field, while no obvious symptoms were observed in the control group (Figure 1D). In addition, the fungal isolates were re-isolated from infected leaves, which fulfilled Koch’s postulates.

3.2. Morphological Characterization

The isolate was cultured on PDA, and the colony of the isolate was white to grayish white, then gradually turned black from the center of the colony with the production of spores, until it turned completely black during 3 weeks of incubation (Figure 2A,B).
The hyphae were branched and septate with a transparent or translucent black color, the conidia were transparent initially at the top or middle of the hypha, and then turned into opaque black gradually when mature (Figure 2C–F). They were one-celled, spherical or near-spherical with a smooth surface, and the sizes of the spores were 11.2–15.97 × 10.64–15.91 μm (av. = 13.95 ± 1.20 × 13.40 ± 1.48 μm, n = 25). These characteristics of the pathogen were similar to the descriptions of Nigrospora oryzae [30,31].

3.3. Molecular Characterization and Phylogenetic Analysis

Ten isolates with similar morphological characteristics were isolated from the leaves of chrysanthemum. To further confirm the identity of the pathogen, three isolates, TaxaJA, TaxaJE, and TaxaJF, were selected to construct the phylogenetic tree using the ITS, TUB2, and TEF1-α genes. The final concatenated DNA sequences of each isolate had 1450 bp including ITS (505 bp), TEF1-α (526 bp), and TUB2 (419 bp). Arthrinium malaysianum served as an outgroup. The topology of the phylogenetic tree was consistent with Li’s research [32].
According to the phylogenetic tree, all three isolates belonged to the branch of N. oryzae (Figure 3), which was consistent with the results obtained by using single-gene phylogenetic analysis. This reliably proved that the isolates were N. oryzae.

3.4. Screening of Antagonistic Bacteria

A total of 231 isolates of phyllosphere bacteria were isolated from the leaves of healthy Chrysanthemum morifolium. Twelve strains with antagonism were screened in total, of which nine strains were Bacillus (A10, D2, D5, D22, D31, D65, F70, F81 and F88), two strains were Pseudomonas (F5 and F17), and one strain was Burkholderia (D43). At the species level, the most common strain was Bacillus amyloliquefaciens, with a total of four strains (D5, D22, D31 and F88). The second was Bacillus siamensis, with three strains (D2, D65 and F81). The rest were: one strain of Bacillus tequilensis (A10), one strain of Bacillus subtilis (F70), one strain of Pseudomonas citri, and one strain of Pseudomonas eucalypticola. The test results of mannitol fermentation, glucose utilization under anaerobic conditions, amylolysis, nitrate reduction abilities, and V-P of each strain are shown in the Table 2.
At the dual culture assay on PDA plates, the plates treated with three Bacillus siamensis strains D2, D65, and D81, had the smallest fungal colony radius, indicating that Bacillus siamensis had the best antagonistic effect against N. oryzae among the 12 C. morifolium phyllosphere bacteria strains (Figure 4). The antagonistic effect of strain D65 was the best, with a radius of only 22.22 mm, which shows an extremely significant difference compared to the control (32.50 mm).

3.5. SPME-GC-Q-TOF Analysis of the D65 Fermentation Broth Components

To identify the components of the Bacillus siamensis D65 fermentation broth components which possessed the best antagonistic ability against N. oryzae, the SPME-GC-Q-TOF analysis of Bacillus siamensis D65 fermentation broth was carried out. It can be clearly seen that the chromatogram of the D65 fermentation broth has more numerous and complex peaks compared to LB medium. D65 has 218 compounds, while LB medium only has 110 compounds, indicating that D65 has abundant metabolic products (Figure 5). After deleting the repeated compounds and discarding compounds with a match factor below 90 and compounds containing silicon, there were still 38 compounds left. After removing the same compounds as were in LB medium, 22 specific compounds with a high match factor were obtained, including 2-Heptanone, 2-Nonanone, 3-Methyl-1-butanol and so on, which are listed in the table (Table 3). Although a large number of compounds were obtained in the results, further research is needed on the specific activity and function of each component.

4. Discussion

Plant diseases cause a considerable reduction in the yield of crops every year [33,34]. There are many pathogens that can infect chrysanthemums. In addition to chrysanthemum viruses and viroids, which often bring damage to chrysanthemums [35,36], white rust [37], anthracnose [38] and other leaf diseases also occur frequently. Chrysanthemums infected by pathogens, especially which cause leaf diseases, will lead to a decline not only the crop’s yield, but also its ornamental, edible and medicinal value, which will reduce its commercial characteristics and seriously hinder its commercial development [39].
The genus of Nigrospora is a widely distributed fungus, which can exist as an endophyte [40,41]. Many species can produce biologically active metabolites such as polyketides, terpenoids, steroids, N-containing compounds, and fatty acids [42]. Meanwhile, it also plays a role as a pathogen to affect plant health.
To date, a large number of studies have reported the diseases caused by the genus Nigrospora. From herbaceous plants such as Oxalis corymbosa to woody plants such as Morus alba [43,44], and from monocotyledonous plants such as Triticum aestivum to dicotyledonous plants such as Nicotiana tabacum [45,46], all can become the host of the genus Nigrospora (Supplementary Table S3). Moreover, not only can the fungus be hosted in the leaves but also in the stems and fruits of plants [47,48]. This demonstrates that the genus Nigrospora is an important pathogen with a wide host range and can be hosted in many parts of plants.
On the world scale, the pathogens of the genus Nigrospora are widely distributed (Figure 6), and there are reports of plant diseases caused by the genus Nigrospora on all continents except for Oceania and Antarctica. The main distribution range of the disease caused by the genus Nigrospora is the tropical and temperate zones, and there are few relevant reports in the cold zone.
East and Southeast Asia, including China, have the highest numbers of reports, and the maximum diversity of species. This indicates that the genus Nigrospora may be a very important potential pathogen in China and its neighboring areas. In terms of the frequency and scope of occurrence, the most frequent and widespread species is N. oryzae, followed by N. sphaerica, while the other species mainly occur in East Asia. This fact implies that the research on N. oryzae and N. sphaerica is of great significance for the prevention and control of the diseases caused by the genus Nigrospora.
N. oryzae and N. sphaerica can often infect the same species of plant, such as Arachis hypogaea and Vaccinium corymbosum [49,50,51,52]. As for chrysanthemums, a widespread disease caused by N. sphaerica has been found in chrysanthemum growing areas [53], and in this study we found that N. oryzae is also a pathogen of chrysanthemum. This indicates that N. oryzae and N. sphaerica may have similar host ranges.
As a means of prevention and control of plant disease, biological control has been greatly promoted in today’s widespread use of chemical pesticides. Screening microorganisms with biocontrol effects from different parts is a good choice; for example, Wang et al. screened many antagonistic Bacillus strains from passion fruit leaves, which can prevent disease caused by N. sphaerica [29]. In this article, 12 biocontrol strains with antagonistic effects were screened from the leaves of Chrysanthemum morifolium, among which Bacillus siamensis D65 had the most significant antagonistic effect and could be further studied as an effective biocontrol resource.
Moreover, the metabolites were profiled using SPME-GC-Q-TOF. In total, 22 compounds were identified, and several of these compounds have been reported to be produced by bacteria or to possess antimicrobial activities and other functions. For example, 3-methyl-1-Butanol, produced by Bacillus, Pseudomonas or Phoma, can promote maize and wheat growth at appropriate concentrations [54]. Volatile compounds produced by Tetrapisispora sp. which contain Nonane, 2,6-dimethyl- have antifungal properties against Botrytis cinerea [55]. 2-Nonanol and 2-Nonanone can inhibit Fusarium graminearum growth and subspore germination, and prevent wheat scab caused by Fusarium graminearum [56,57]. 2-Undecanone has a targeted mode of antagonistic action against Candida albicans biofilm [58]. Fermentation broth produced by Bacillus amyloliquefaciens containing 2-Heptanone, 2-Nonanone, 2-Nonanol, 2-Undecanone, and 2-Undecanol has good antagonistic effects against plant pathogenic fungi such as Monilinia fructigena, Glomerella cingulate, Rhizoctonia solani, and so on [59].
SPME-GC-Q-TOF analysis in this study provided a variety of compounds that far exceeded the number of currently reported compounds which possess antagonistic effects. However, further research is needed to determine which type or types of compounds play a role in inhibiting plant fungal growth. The results of this study can be used as a reservoir to further screen components with antagonistic substances against pathogenic fungi.

5. Conclusions

In this study, N. oryzae, a pathogenic fungus with a wide host range, was identified as the pathogen of C. morifolium leaf spot disease. This is the first report of C. morifolium leaf disease caused by N. oryzae in the world. The result expanded our understanding of the host range that can be infected by N. oryzae. At the same time, this study screened 12 potential antagonistic strains with good antagonistic effects, which have inhibitory effects on N. oryzae, indicating the potential of these bacteria—especially Bacillus siamensis D65—as Biocontrol Agents (BCA) in controlling chrysanthemum diseases and other plants diseases caused by N. oryzae. Through SPME-GC-Q-TOF, 22 special compounds with antibacterial potential were identified, which can be studied as candidate compounds for inhibiting pathogenic fungi in a future study. Overall, this study provides a basis for further research and utilization of antagonistic strains for biological control.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms11092224/s1, Table S1: GenBank accession numbers obtained in this study; Table S2: Reference sequences of Nigrospora species from GenBank used in phylogenetic analysis; Table S3: Hosts of the disease caused by genus Nigrospora and report sources.

Author Contributions

Conceptualization, design of the experiments, methodology, and original manuscript, H.S.; software and bioinformatic analysis, X.X.; assisting on the experiments, X.L., H.Z. and X.G.; advising on the experiments and providing resources, W.C.; validation and supervision, B.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by A Project Supported by a Scientific Research Fund of Zhejiang Provincial Education Department, grant number Y202250798, and Major scientific and technological projects for the selection of new varieties of Chinese herbal medicines in Zhejiang Province (2021C02074).

Data Availability Statement

Not applicable.

Acknowledgments

We are grateful for the help of Weizhen Hu, Agricultural Experiment Station, Zhejiang University; and Yuexiao Miu, Tongxiang Yuanyuan Edible Flowers Professional Cooperative in this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Su, J.; Jiang, J.; Zhang, F.; Liu, Y.; Ding, L.; Chen, S.; Chen, F. Current achievements and future prospects in the genetic breeding of chrysanthemum: A review. Hortic. Res.-Engl. 2019, 6, 109. [Google Scholar]
  2. Yuan, H.; Jiang, S.; Liu, Y.; Daniyal, M.; Jian, Y.; Peng, C.; Shen, J.; Liu, S.; Wang, W. The flower head of Chrysanthemum morifolium ramat. (Juhua): A paradigm of flowers serving as Chinese dietary herbal medicine. J. Ethnopharmacol. 2020, 261, 113043. [Google Scholar] [PubMed]
  3. Hao, D.; Song, Y.; Xiao, P.; Zhong, Y.; Wu, P.; Xu, L. The genus Chrysanthemum: Phylogeny, biodiversity, phytometabolites, and chemodiversity. Front. Plant Sci. 2022, 13, 973197. [Google Scholar]
  4. Teixeira Da Silva, J.A.; Shinoyama, H.; Aida, R.; Matsushita, Y.; Raj, S.K.; Chen, F. Chrysanthemum biotechnology: Quo vadis? Crit. Rev. Plant Sci. 2013, 32, 21–52. [Google Scholar]
  5. Jain, A.; Sarsaiya, S.; Wu, Q.; Lu, Y.; Shi, J. A review of plant leaf fungal diseases and its environment speciation. Bioengineered 2019, 10, 409–424. [Google Scholar] [PubMed]
  6. Dawson, T.E.; Goldsmith, G.R. The value of wet leaves. New Phytol. 2018, 219, 1156–1169. [Google Scholar]
  7. Koskella, B. The phyllosphere. Curr. Biol. 2020, 30, R1143–R1146. [Google Scholar] [PubMed]
  8. Zhan, C.; Matsumoto, H.; Liu, Y.; Wang, M. Pathways to engineering the phyllosphere microbiome for sustainable crop production. Nat. Food 2022, 3, 997–1004. [Google Scholar] [PubMed]
  9. Jane, C.; Trolinger, R.J.M.W. Diseases of chrysanthemum. In Handbook of Florists’ Crops Diseases; Springer: Berlin/Heidelberg, Germany, 2017. [Google Scholar]
  10. Pandiyan, K.; Kushwaha, P.; Kashyap, P.L.; Bagul, S.Y.; Karthikeyan, N.; Saxena, A.K. 12-phyllosphere microbiome: Modern prospectus and application. In Microbiomes and Plant Health; Academic Press: Cambridge, MA, USA, 2021; pp. 345–366. [Google Scholar]
  11. Bashir, I.; War, A.F.; Rafiq, I.; Reshi, Z.A.; Rashid, I.; Shouche, Y.S. Phyllosphere microbiome: Diversity and functions. Microbiol. Res. 2022, 254, 126888. [Google Scholar] [PubMed]
  12. Remus-Emsermann, M.N.P.; Schlechter, R.O. Phyllosphere microbiology: At the interface between microbial individuals and the plant host. New Phytol. 2018, 218, 1327–1333. [Google Scholar]
  13. Teixidó, N.; Usall, J.; Torres, R. Insight into a successful development of biocontrol agents: Production, formulation, packaging, and shelf life as key aspects. Horticulturae 2022, 8, 305. [Google Scholar] [CrossRef]
  14. Yang, S.C. Resistance Evaluation and Control to Alternaria Leaf Spot and Sclerotinia sclerotiorum in Cut Chrysanthemum Germplasm Resource. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2020. (In Chinese). [Google Scholar]
  15. Chen, Q.H.; Miao, Y.H.; Li, J.X.; Yang, Y.W.; Chen, W.L.; Guo, L.P.; Liu, D.H. Research Progress on Pathogenesis and Control Measures of Common Diseases in Chrysanthemum morifolium. Mod. Chin. Med. 2023, 25, 413–420. (In Chinese) [Google Scholar]
  16. Yan, K.R. Virus Identification and Analysis of Yield and Quality of Virus-Free Plantlets at Different Generations on Chrysanthemun morifolium. Master’s Thesis, Zhejiang University, Hangzhou, China, 2021. (In Chinese). [Google Scholar]
  17. Fang, Z.D.F. Research Method for Plant Pathology, 3rd ed.; Agriculture Press: Beijing, China, 1998. (In Chinese) [Google Scholar]
  18. Zhang, J.; Sha, H.; Chen, W.; Mao, B. Characterization and control of Dendrobium officinale bud blight disease. Pathogens 2023, 12, 621. [Google Scholar] [CrossRef] [PubMed]
  19. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  20. Glass, N.L.U.O.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
  21. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
  22. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  23. Zhang, D.; Gao, F.L.; Jakovlic, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. Phylosuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
  24. Katoh, K.; Standley, D.M. Mafft multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  25. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. Partitionfinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2016, 34, w260. [Google Scholar] [CrossRef] [PubMed]
  26. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [PubMed]
  27. Zhan, C.; Wu, M.; Fang, H.; Liu, X.; Pan, J.; Fan, X.; Wang, M.; Matsumoto, H. Characterization of the chemical fungicides-respofnsive and bacterial pathogen-preventing Bacillus licheniformis in rice spikelet. Food Qual. Saf. 2023, 7, fyad005. [Google Scholar] [CrossRef]
  28. Lane, D.J. 16s/23s rRNA Sequencing. Nucleic Acid Techniques in Bacterial Systematics; John and Wiley and Sons: Hoboken, NJ, USA, 1991. [Google Scholar]
  29. Wang, J.; Qin, S.; Fan, R.; Peng, Q.; Hu, X.; Yang, L.; Liu, Z.; Baccelli, I.; Migheli, Q.; Berg, G.; et al. Plant growth promotion and biocontrol of leaf blight caused by Nigrospora sphaerica on passion fruit by endophytic Bacillus subtilis strain gucc4. J. Fungi 2023, 9, 132. [Google Scholar] [CrossRef] [PubMed]
  30. Li, L.; Pan, H.; Chen, M.Y.; Zhang, S.J.; Zhong, C.H. First report of Nigrospora oryzae causing brown/black spot disease of kiwifruit in China. Plant Dis. 2018, 102, 243. [Google Scholar] [CrossRef]
  31. Wu, J.B.; Zhang, C.L.; Mao, P.P.; Qian, Y.S.; Wang, H.Z. First report of leaf spot caused by Nigrospora oryzae on Dendrobium candidum in China. Plant Dis. 2014, 98, 996. [Google Scholar] [CrossRef] [PubMed]
  32. Li, M.; Gao, Z.; Wang, Y.; Zhang, W.; Yang, J.; Gong, D.; Ma, Y.; Li, Y.; Hu, M. First report of Nigrospora lacticolonia causing leaf spot of Bougainvillea spectabilis in China. Can. J. Plant Pathol. 2022, 44, 695–701. [Google Scholar] [CrossRef]
  33. Stukenbrock, E.; Gurr, S. Address the growing urgency of fungal disease in crops. Nature 2023, 617, 31–34. [Google Scholar] [CrossRef]
  34. Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; Mcroberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef] [PubMed]
  35. Cho, W.; Jo, Y.; Jo, K.; Kim, K. A current overview of two viroids that infect chrysanthemums: Chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. Viruses 2013, 5, 1099–1113. [Google Scholar] [CrossRef] [PubMed]
  36. Hill, M.F.; Giles, R.J.; Moran, J.R.; Hepworth, G. The incidence of chrysanthemum stunt viroid and chrysanthemum b carlavirus, tomato aspermy cucumovirus and tomato spotted wilt tospovirus in Australian chrysanthemum crops. Australas. Plant Pathol. 1996, 25, 174–178. [Google Scholar] [CrossRef]
  37. Alaei, H.; De Backer, M.; Nuytinck, J.; Maes, M.; Höfte, M.; Heungens, K. Phylogenetic relationships of Puccinia horiana and other rust pathogens of Chrysanthemum × morifolium based on rDNA its sequence analysis. Mycol. Res. 2009, 113, 668–683. [Google Scholar] [CrossRef] [PubMed]
  38. Uematsu, S.; Kageyama, K.; Moriwaki, J.; Sato, T. Colletotrichum carthami comb. Nov., An anthracnose pathogen of safflower, garland chrysanthemum and pot marigold, revived by molecular phylogeny with authentic herbarium specimens. J. Gen. Plant Pathol. 2012, 78, 316–330. [Google Scholar] [CrossRef]
  39. Yang, J.S.; Guo, H.W.; Niu, L.Y. Diseases and Pests of Chrysanthemum in Baoding Area. J. Anhui Agric. Sci. 2007, 35, 2311–2312. (In Chinese) [Google Scholar]
  40. Wang, M.; Liu, F.; Crous, P.W.; Cai, L. Phylogenetic reassessment of Nigrospora: Ubiquitous endophytes, plant and human pathogens. Persoonia-Mol. Phylogeny Evol. Fungi 2017, 39, 118–142. [Google Scholar] [CrossRef]
  41. Ebada, S.S.; Eze, P.; Okoye, F.B.C.; Esimone, C.O.; Proksch, P. The fungal endophyte Nigrospora oryzae produces quercetin monoglycosides previously known only from plants. ChemistrySelect 2016, 1, 2767–2771. [Google Scholar] [CrossRef]
  42. Xu, T.; Song, Z.; Hou, Y.; Liu, S.; Li, X.; Yang, Q.; Wu, S. Secondary metabolites of the genus Nigrospora from terrestrial and marine habitats: Chemical diversity and biological activity. Fitoterapia 2022, 161, 105254. [Google Scholar] [CrossRef] [PubMed]
  43. Zheng, T.; Zhao, L.; Huang, M.G.; Deng, J.X.; Wang, Y.H. First report of leaf spot caused by Nigrospora hainanensis on Oxalis corymbosa in China. Plant Dis. 2022, 106, 1986. [Google Scholar] [CrossRef] [PubMed]
  44. Arunakumar, G.S.; Gnanesh, B.N.; Supriya, M.; Sivaprasad, V. First report of Nigrospora sphaerica causing shot hole disease on mulberry in India. Plant Dis. 2019, 103, 1783–1784. [Google Scholar] [CrossRef]
  45. Wang, D.K.; Li, Y.C.; Sun, G.J.; Ai, Y.F.; Wang, F.L.; Wang, X.Q. First report of leaf spot disease caused by Nigrospora oryzae on Nicotiana tabacum in China. Plant Dis. 2022, 106, 2526. [Google Scholar] [CrossRef]
  46. Eken, C.; Spanbayev, A.; Tulegenova, Z.; Yechshzhanov, T. First report of Nigrospora oryzae on wheat in Kazakhstan. Plant Dis. 2016, 100, 861. [Google Scholar] [CrossRef]
  47. Luo, F.; Li, W.; Zhu, T.; Han, S.; Qiao, T.; Li, S. First report of Nigrospora aurantiaca causing leaf spot disease of Castanea mollissima in China. Plant Dis. 2020, 104, 2730–2731. [Google Scholar] [CrossRef]
  48. Abass, M.H.; Hameed, M.A.; Ahmed, A.N. First report of Nigrospora sphaerica (sacc.) Mason as a potential pathogen on date palm (Phoenix dactylifera l.). Can. J. Plant Pathol. 2013, 35, 75–80. [Google Scholar] [CrossRef]
  49. Vijayalakshmi, A.; Soundharajan, R.; Srinivasan, H. Engineered green nanoparticles interact with Nigrospora oryzae isolated from infected leaves of Arachis hypogaea. J. Basic Microbiol. 2022, 62, 1393–1401. [Google Scholar] [CrossRef] [PubMed]
  50. Liu, X.; Yu, F.; Fu, D.; Yang, W. First report of leaf blight on peanut caused by Nigrospora sphaerica in China. J. Plant Pathol. 2020, 102, 1269. [Google Scholar] [CrossRef]
  51. Zhang, L.Q.; Jiang, S.; Meng, J.J.; An, H.S.; Zhang, X.Y. First report of leaf spot caused by Nigrospora oryzae on blueberry in shanghai, China. Plant Dis. 2019, 103, 2473–2474. [Google Scholar] [CrossRef]
  52. Wright, E.R.; Folgado, M.; Rivera, M.C.; Crelier, A.; Vasquez, P.; Lopez, S.E. Nigrospora sphaerica causing leaf spot and twig and shoot blight on blueberry: A new host of the pathogen. Plant Dis. 2008, 92, 171. [Google Scholar] [CrossRef] [PubMed]
  53. Luo, X.; Xi, Y.; Shen, C.; Wang, M.; Wang, H. Occurrence of Nigrospora sphaerica causing leaf blight on Chrysanthemum morifolium in China. Crop Prot. 2022, 157, 105982. [Google Scholar] [CrossRef]
  54. Li, C.Y.; Zhang, J.J.; Zhao, C.J.; Jiang, H.W.; Ren, X.T.; Su, W.R.; Guan, J.J.; Li, Y.Z. Effects of 3-methyl-1-butanol on Seed Germination and Seedling Growth of Maize and Wheat. Bull. Bot. Res. 2018, 38, 785–789. (In Chinese) [Google Scholar]
  55. Bagheri, S.; Amini, J.; Ashengroph, M.; Koushesh Saba, M. Antifungal effects of volatile compounds produced by Tetrapisispora sp. Strain 111a-nl1 as a new biocontrol agent on the strawberry grey mold disease. Cell. Mol. Biol. 2022, 68, 12–23. [Google Scholar] [CrossRef]
  56. Zhao, Y.J.; Liu, Y.; Wang, Y.; Xing, G.F.; Wang, Y. Use of 2-Nonanol Derivative in Preparing Medicine for Inhibiting Fusarium graminearum Growth, Inhibiting Fusarium graminearum Sub Spore Germination, Inhibiting Fusarium graminearum and Preventing Wheat Scab of Fusarium graminearum. Chinese Patent CN107258783, 2019. (In Chinese). [Google Scholar]
  57. Liu, Y.; Zhao, Y.J.; Wang, Y.; Xing, G.F.; Wang, Y. Use of 2-Nonanone and/or 2-Nonanone Analogs and/or 2-Nonanone Derivative for Inhibiting Fusarium graminearum Growth and Spore Germination and Preparing Medicine for Production and Preventing and Controlling Wheat Scab and Biopesticide. Chinese Patent CN107258785, 2019. (In Chinese). [Google Scholar]
  58. Rajasekharan, S.K.; Shemesh, M. The bacillary postbiotics, including 2-undecanone, suppress the virulence of pathogenic microorganisms. Pharmaceutics 2022, 14, 962. [Google Scholar] [PubMed]
  59. Guo, J.X.; Zhang, Y.M.; Zhu, H.L.; Ren, L.; Zhang, B.J. Antifungal Activity of Volatile Organic Compounds from Bacillus amyloliquefaciens XJ5 and Control Effect against Monilinia fructigena. Chin. J. Biol. Control. 2020, 36, 575–580. [Google Scholar]
Microorganisms 11 02224 g001
Figure 1. Symptoms of disease in C. morifolium and pathogenicity test. (A) Field symptoms. (B) Diseased branches near the top of the chrysanthemum. (C,D) Symptoms of leaf spot disease. (E) Leaf 5 days after inoculation with sterile PDA plug. (F) Leaf 5 days after artificial inoculation. (G) Branch before inoculation. (H) Branch 7 days after inoculation.
Figure 1. Symptoms of disease in C. morifolium and pathogenicity test. (A) Field symptoms. (B) Diseased branches near the top of the chrysanthemum. (C,D) Symptoms of leaf spot disease. (E) Leaf 5 days after inoculation with sterile PDA plug. (F) Leaf 5 days after artificial inoculation. (G) Branch before inoculation. (H) Branch 7 days after inoculation.
Microorganisms 11 02224 g001
Microorganisms 11 02224 g002
Figure 2. Morphological characterization. (A) Colony on PDA medium after 7 days. (B) Colony on PDA medium after 21 days. (C) Ongoing conidia. (D,E) Conidia and hyphae observed with optical microscope (F) Conidia and hyphae observed with stereomicroscope. The red arrow points to conidia.
Figure 2. Morphological characterization. (A) Colony on PDA medium after 7 days. (B) Colony on PDA medium after 21 days. (C) Ongoing conidia. (D,E) Conidia and hyphae observed with optical microscope (F) Conidia and hyphae observed with stereomicroscope. The red arrow points to conidia.
Microorganisms 11 02224 g002
Microorganisms 11 02224 g003
Figure 3. Bayesian inference was used to construct the phylogenetic tree using ITS, TUB2, and TEF1-α sequences of Nigrospora species. Arthrinium malaysianum served as outgroup. The asterisk represents the type materials.
Figure 3. Bayesian inference was used to construct the phylogenetic tree using ITS, TUB2, and TEF1-α sequences of Nigrospora species. Arthrinium malaysianum served as outgroup. The asterisk represents the type materials.
Microorganisms 11 02224 g003
Microorganisms 11 02224 g004
Figure 4. Inhibition effect of 12 strains on the growth of N. oryzae. (A) Colony radius of N. oryzae in dual culture assay on PDA plates treated by different strains. (B) Schematic diagram of dual culture assay, central position represents N. oryzae, and the four directions represent bacterial strains, the red line represents the colony radius of N. oryzae. (C) Bacillus tequilensis A10. (D) Bacillus siamensis D2. (E) Bacillus amyloliquefaciens D5. (F) Bacillus amyloliquefaciens D22. (G) Bacillus amyloliquefaciens D31. (H) Burkholderia gladioli D43. (I) Control. (J) Bacillus siamensis D65. (K) Pseudomonas citri F5. (L) Pseudomonas eucalypticola F17. (M) Bacillus subtilis F70. (N) Bacillus siamensis F81. (O) Bacillus amyloliquefaciens F88. Different letters above bars indicate a significant difference according to one-way ANOVA (p < 0.05).
Figure 4. Inhibition effect of 12 strains on the growth of N. oryzae. (A) Colony radius of N. oryzae in dual culture assay on PDA plates treated by different strains. (B) Schematic diagram of dual culture assay, central position represents N. oryzae, and the four directions represent bacterial strains, the red line represents the colony radius of N. oryzae. (C) Bacillus tequilensis A10. (D) Bacillus siamensis D2. (E) Bacillus amyloliquefaciens D5. (F) Bacillus amyloliquefaciens D22. (G) Bacillus amyloliquefaciens D31. (H) Burkholderia gladioli D43. (I) Control. (J) Bacillus siamensis D65. (K) Pseudomonas citri F5. (L) Pseudomonas eucalypticola F17. (M) Bacillus subtilis F70. (N) Bacillus siamensis F81. (O) Bacillus amyloliquefaciens F88. Different letters above bars indicate a significant difference according to one-way ANOVA (p < 0.05).
Microorganisms 11 02224 g004
Microorganisms 11 02224 g005
Figure 5. Chromatogram of SPME-GC-Q-TOF analysis. (A) LB medium. (B) Bacillus siamensis D65 fermentation broth.
Figure 5. Chromatogram of SPME-GC-Q-TOF analysis. (A) LB medium. (B) Bacillus siamensis D65 fermentation broth.
Microorganisms 11 02224 g005
Microorganisms 11 02224 g006
Figure 6. (A) Plant diseases caused by N. oryzae worldwide. (B) The occurrence of diseases caused by the genus Nigrospora worldwide.
Figure 6. (A) Plant diseases caused by N. oryzae worldwide. (B) The occurrence of diseases caused by the genus Nigrospora worldwide.
Microorganisms 11 02224 g006
Table 1. Primers used in this study.
Table 1. Primers used in this study.
LociPrimerSequence
ITSITS1
ITS4		CTTGGTCATTTAGAGGAAGTAA
TCCTCCGCTTATTGATATGC
TUB2Bt2a
Bt2b		GGTAACCAAATCGGTGCTGCTTTC
ACCCTCAGTGTAGTGACCCTTGGC
TEF1-αEF1-728F
EF2		CATCGAGAAGTTCGAGAAGG
GGA(G/A)GTACCAGT(G/C)ATCATGTT
16s rRNA27F
1492R		AGAGTTGATCCTGGCTCAG
GTTACCTTGTTACGACTT
Table 2. Strains with antagonistic effects against N. oryzae screened from phyllosphere of C. morifolium. (Note: + represents positive, − represents negative).
Table 2. Strains with antagonistic effects against N. oryzae screened from phyllosphere of C. morifolium. (Note: + represents positive, − represents negative).
IsolateHit TaxonHit Strain NameMannitol
Fermentation		Glucose UtilizationAmylolysisNitrate ReductionV-P
A10Bacillus tequilensis (99.93%)KCTC 13622+++++
D2Bacillus siamensis (99.45%)KCTC 13613+++++
D5Bacillus amyloliquefaciens (99.93%)NBRC 15535−++++
D22Bacillus amyloliquefaciens (99.93%)MPA 1034+++++
D31Bacillus amyloliquefaciens (100%)NBRC 15535+++++
D43Burkholderia gladioli (99.44%)ATCC 10248+−−−−
D65Bacillus siamensis (99.59%)KCTC 13613−++++
F5Pseudomonas citri (99.43%)OPS 13-3+−−+−
F17Pseudomonas eucalypticola (99.93%)CCTCC M2018494−−−−−
F70Bacillus subtilis (99.79%)NBRC 13719+++++
F81Bacillus siamensis (99.86%)KCTC 13613+++++
F88Bacillus amyloliquefaciens (100%)NBRC 15535−++++
Table 3. Components of Bacillus siamensis D65 fermentation broth (sorted by Component Area).
Table 3. Components of Bacillus siamensis D65 fermentation broth (sorted by Component Area).
Component AreaFormulaMolecular Weight (g/mol)Compound NameCAS NumberMatch Factor
41,649,590C13H28O200.362-Tridecanol1653-31-294.94
33,930,144C4H8O288.1Ethyl Acetate141-78-692.88
22,758,614C14H22190.32Benzene, 1,3-bis(1,1-dimethylethyl)-1014-60-497.49
20,428,923C11H24O172.312-Undecanol1653-30-195.38
16,886,839C14H30O214.392-Tetradecanol4706-81-491.53
15,412,517C13H26O198.342-Tridecanone593-08-896.03
12,362,340C12H26O186.332-Dodecanol10203-28-893.30
12,122,120C14H28O212.372-Tetradecanone2345-27-993.44
8,805,195C12H24O184.322-Dodecanone6175-49-194.47
8,767,459C9H20O144.252-Nonanol628-99-990.61
6,409,912C7H14O114.192-Heptanone110-43-095.02
5,336,527C11H22O170.292-Undecanone112-12-994.43
4,158,934C9H18O142.242-Nonanone821-55-692.25
2,147,246C15H30O226.42-Pentadecanone2345-28-090.64
1,906,840C5H12O88.151-Butanol, 3-methyl-123-51-392.62
1,713,221C11H24156.31Nonane, 2,6-dimethyl-17302-28-294.84
1,312,588C10H12O148.2Benzaldehyde, 2,4,6-trimethyl-487-68-390.80
1,272,686C11H18N2178.27Pyrazine, 2,5-dimethyl-3-(3-methylbutyl)-18433-98-292.33
1,073,632C13H28184.36Undecane, 2,8-dimethyl-17301-25-695.28
856,873C11H24156.31Octane, 2,4,6-trimethyl-62016-37-990.33
496,511C11H12O3S224.283-(Benzoylthio)-2-methylpropanoic acid67714-34-592.59
242,368C23H44O3368.59Carbonic acid, eicosyl vinyl ester1000382-54-390.51
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sha, H.; Liu, X.; Xiao, X.; Zhang, H.; Gu, X.; Chen, W.; Mao, B. Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria. Microorganisms 2023, 11, 2224. https://doi.org/10.3390/microorganisms11092224

AMA Style

Sha H, Liu X, Xiao X, Zhang H, Gu X, Chen W, Mao B. Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria. Microorganisms. 2023; 11(9):2224. https://doi.org/10.3390/microorganisms11092224

Chicago/Turabian Style

Sha, Haodong, Xinyi Liu, Xiaoe Xiao, Han Zhang, Xueting Gu, Weiliang Chen, and Bizeng Mao. 2023. "Nigrospora oryzae Causing Leaf Spot Disease on Chrysanthemum × morifolium Ramat and Screening of Its Potential Antagonistic Bacteria" Microorganisms 11, no. 9: 2224. https://doi.org/10.3390/microorganisms11092224

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop