Rapid Diagnostic Test for Hepatitis B Virus Viral Load Based on Recombinase Polymerase Amplification Combined with a Lateral Flow Read-Out
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plasma Samples
2.2. Primers, Probe, and Internal Control
2.3. Nucleic Acid Extraction
2.4. RPA Exo Assay–Real-Time Fluorescence Detection
2.5. RPA-LFA–Naked Eye Detection
2.6. Statistics
3. Results
3.1. Selection of Primers and Probe and Analytical Evaluation
3.2. Development of the RPA-LFA
3.3. Analysis of Biological Samples
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Schweitzer, A.; Horn, J.; Mikolajczyk, R.T.; Krause, G.; Ott, J.J. Estimations of worldwide prevalence of chronic hepatitis B virus infection: A systematic review of data published between 1965 and 2013. Lancet 2015, 386, 1546–1555. [Google Scholar] [CrossRef]
- WHO. Global Progress Report on HIV, Viral Hepatitis and Sexually Transmitted Infections. 2021. Available online: https://www.who.int/publications/i/item/9789240027077 (accessed on 15 July 2021).
- EASL 2017 Clinical Practice Guidelines on the management of hepatitis B virus infection. J. Hepatol. 2017, 67, 370–398. [CrossRef] [PubMed] [Green Version]
- Stanaway, J.D.; Flaxman, A.D.; Naghavi, M.; Fitzmaurice, C.; Vos, T.; Abubakar, I.; Abu-Raddad, L.J.; Assadi, R.; Bhala, N.; Cowie, B.; et al. The global burden of viral hepatitis from 1990 to 2013: Findings from the Global Burden of Disease Study 2013. Lancet 2016, 388, 1081–1088. [Google Scholar] [CrossRef] [Green Version]
- Pan, C.Q.; Duan, Z.; Dai, E.; Zhang, S.; Han, G.; Wang, Y.; Zhang, H.; Zou, H.; Zhu, B.; Zhao, W.; et al. Tenofovir to Prevent Hepatitis B Transmission in Mothers with High Viral Load. N. Engl. J. Med. 2016, 374, 2324–2334. [Google Scholar] [CrossRef] [PubMed]
- Jourdain, G.; Ngo-Giang-Huong, N.; Harrison, L.; Decker, L.; Khamduang, W.; Tierney, C.; Salvadori, N.; Cressey, T.R.; Sirirungsi, W.; Achalapong, J.; et al. Tenofovir versus Placebo to Prevent Perinatal Transmission of Hepatitis B. N. Engl. J. Med. 2018, 378, 911–923. [Google Scholar] [CrossRef]
- Thompson, P.; Morgan, C.E.; Ngimbi, P.; Mwandagalirwa, K.; Ravelomanana, N.L.R.; Tabala, M.; Fathy, M.; Kawende, B.; Muwonga, J.; Misingi, P.; et al. Arresting vertical transmission of hepatitis B virus (AVERT-HBV) in pregnant women and their neonates in the Democratic Republic of the Congo: A feasibility study. Lancet Glob. Health 2021, 9, E1600–E1609. [Google Scholar] [CrossRef]
- Boucheron, P.; Lu, Y.; Yoshida, K.; Zhao, T.; Funk, A.L.; Lunel-Fabiani, F.; Guingané, A.; Tuaillon, E.; van Holten, J.; Chou, R.; et al. Accuracy of HBeAg to identify pregnant women at risk of transmitting hepatitis B virus to their neonates: A systematic review and meta-analysis. Lancet Infect. Dis. 2021, 21, 85–96. [Google Scholar] [CrossRef]
- Funk, A.L.; Lu, Y.; Yoshida, K.; Zhao, T.; Boucheron, P.; van Holten, J.; Chou, R.; Bulterys, M.; Shimakawa, Y. Efficacy and safety of antiviral prophylaxis during pregnancy to prevent mother-to-child transmission of hepatitis B virus: A systematic review and meta-analysis. Lancet Infect. Dis. 2021, 21, 70–84. [Google Scholar] [CrossRef]
- WHO. Prevention of Mother-to-Child Transmission of Hepatitis B Virus: Guidelines on Antiviral Prophylaxis in Pregnancy. In Prevention of Mother-to-Child Transmission of Hepatitis B Virus: Guidelines on Antiviral Prophylaxis in Pregnancy; World Health Organization: Geneva, Switzerland, 2020. [Google Scholar]
- Guingané, A.N.; Bougouma, A.; Sombié, R.; King, R.; Nagot, N.; Meda, N.; Van de Perre, P.; Tuaillon, E. Identifying gaps across the cascade of care for the prevention of HBV mother-to-child transmission in Burkina Faso: Findings from the real world. Liver Int. 2020, 40, 2367–2376. [Google Scholar] [CrossRef]
- Belopolskaya, M.; Avrutin, V.; Kalinina, O.; Dmitriev, A.; Gusev, D. Chronic hepatitis B in pregnant women: Current trends and approaches. World J. Gastroenterol. 2021, 27, 3279–3289. [Google Scholar] [CrossRef]
- Loarec, A.; Nguyen, A.; Molfino, L.; Chissano, M.; Madeira, N.; Rusch, B.; Staderini, N.; Couto, A.; Ciglenecki, I.; Antabak, N.T. Prevention of mother-to-child transmission of hepatitis B virus in antenatal care and maternity services, Mozambique. Bull. World Health Organ. 2022, 100, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Terrault, N.A.; Lok, A.S.F.; McMahon, B.J.; Chang, K.M.; Hwang, J.P.; Jonas, M.M.; Brown, R.S., Jr.; Bzowej, N.H.; Wong, J.B. Update on prevention, diagnosis, and treatment of chronic hepatitis B: AASLD 2018 hepatitis B guidance. Hepatology 2018, 67, 1560–1599. [Google Scholar] [CrossRef]
- Marcuccilli, F.; Chevaliez, S.; Muller, T.; Colagrossi, L.; Abbondanza, G.; Beyser, K.; Wlassow, M.; Ortonne, V.; Perno, C.F.; Ciotti, M. Multicenter Evaluation of the Cepheid Xpert® HBV Viral Load Test. Diagnostics 2021, 11, 297. [Google Scholar] [CrossRef] [PubMed]
- Datta, S.; Chatterjee, S.; Veer, V. Recent advances in molecular diagnostics of hepatitis B virus. World J. Gastroenterol. 2014, 20, 14615–14625. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Macdonald, J.; von Stetten, F. Review: A comprehensive summary of a decade development of the recombinase polymerase amplification. The Analyst 2018, 144, 31–67. [Google Scholar] [CrossRef] [Green Version]
- Mayboroda, O.; Katakis, I.; O’Sullivan, C.K. Multiplexed isothermal nucleic acid amplification. Anal. Biochem. 2018, 545, 20–30. [Google Scholar] [CrossRef]
- Zhao, Y.; Chen, F.; Li, Q.; Wang, L.; Fan, C. Isothermal Amplification of Nucleic Acids. Chem. Rev. 2015, 115, 12491–12545. [Google Scholar] [CrossRef]
- Craw, P.; Balachandran, W. Isothermal nucleic acid amplification technologies for point-of-care diagnostics: A critical review. Lab Chip 2012, 12, 2469–2486. [Google Scholar] [CrossRef]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef]
- Behrmann, O.; Bachmann, I.; Spiegel, M.; Schramm, M.; Abd El Wahed, A.; Dobler, G.; Dame, G.; Hufert, F.T. Rapid Detection of SARS-CoV-2 by Low Volume Real-Time Single Tube Reverse Transcription Recombinase Polymerase Amplification Using an Exo Probe with an Internally Linked Quencher (Exo-IQ). Clin. Chem. 2020, 66, 1047–1054. [Google Scholar] [CrossRef] [PubMed]
- Cherkaoui, D.; Huang, D.; Miller, B.S.; Turbé, V.; McKendry, R.A. Harnessing recombinase polymerase amplification for rapid multi-gene detection of SARS-CoV-2 in resource-limited settings. Biosens. Bioelectron. 2021, 189, 113328. [Google Scholar] [CrossRef] [PubMed]
- Xia, S.; Chen, X. Single-copy sensitive, field-deployable, and simultaneous dual-gene detection of SARS-CoV-2 RNA via modified RT-RPA. Cell Discov. 2020, 6, 37. [Google Scholar] [CrossRef]
- Boyle, D.S.; Lehman, D.A.; Lillis, L.; Peterson, D.; Singhal, M.; Armes, N.; Parker, M.; Piepenburg, O.; Overbaugh, J. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification. mBio 2013, 4, e00135-13. [Google Scholar] [CrossRef] [Green Version]
- Bai, X.; Ma, X.; Li, M.; Li, X.; Fan, G.; Zhang, R.; Wang, R.; Duan, Q.; Shen, X.; Xie, Y.; et al. Field applicable detection of hepatitis B virus using internal controlled duplex recombinase-aided amplification assay and lateral flow dipstick assay. J. Med. Virol. 2020, 92, 3344–3353. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Zhu, Z.; Li, F.; Xie, X.; Ding, A. Rapid and sensitive detection of hepatitis B virus by lateral flow recombinase polymerase amplification assay. J. Virol. Methods 2021, 291, 114094. [Google Scholar] [CrossRef]
- Shen, X.X.; Qiu, F.Z.; Shen, L.P.; Yan, T.F.; Zhao, M.C.; Qi, J.J.; Chen, C.; Zhao, L.; Wang, L.; Feng, Z.S.; et al. A rapid and sensitive recombinase aided amplification assay to detect hepatitis B virus without DNA extraction. BMC Infect. Dis. 2019, 19, 229. [Google Scholar] [CrossRef]
- Ichzan, A.M.; Hwang, S.H.; Cho, H.; Fang, C.S.; Park, S.; Kim, G.; Kim, J.; Nandhakumar, P.; Yu, B.; Jon, S.; et al. Solid-phase recombinase polymerase amplification using an extremely low concentration of a solution primer for sensitive electrochemical detection of hepatitis B viral DNA. Biosens. Bioelectron. 2021, 179, 113065. [Google Scholar] [CrossRef]
- Vanhomwegen, J.; Kwasiborski, A.; Diop, A.; Boizeau, L.; Hoinard, D.; Vray, M.; Bercion, R.; Ndiaye, B.; Dublineau, A.; Michiyuki, S.; et al. Development and clinical validation of loop-mediated isothermal amplification (LAMP) assay to diagnose high HBV DNA levels in resource-limited settings. Clin. Microbiol. Infect. 2021, 27, 1858.e9–1858.e15. [Google Scholar] [CrossRef]
- Yi, T.T.; Zhang, H.Y.; Liang, H.; Gong, G.Z.; Cai, Y. Betaine-assisted recombinase polymerase assay for rapid hepatitis B virus detection. Biotechnol. Appl. Biochem. 2020, 68, 469–475. [Google Scholar] [CrossRef]
- Higgins, O.; Clancy, E.; Forrest, M.S.; Piepenburg, O.; Cormican, M.; Boo, T.W.; O’Sullivan, N.; McGuinness, C.; Cafferty, D.; Cunney, R.; et al. Duplex recombinase polymerase amplification assays incorporating competitive internal controls for bacterial meningitis detection. Anal. Biochem. 2018, 546, 10–16. [Google Scholar] [CrossRef]
- Shimakawa, Y.; Ndow, G.; Njie, R.; Njai, H.F.; Takahashi, K.; Akbar, S.M.F.; Cohen, D.; Nayagam, S.; Jeng, A.; Ceesay, A.; et al. Hepatitis B Core-related Antigen: An Alternative to Hepatitis B Virus DNA to Assess Treatment Eligibility in Africa. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2020, 70, 1442–1452. [Google Scholar] [CrossRef] [PubMed]
- Lillis, L.; Lehman, D.; Singhal, M.C.; Cantera, J.; Singleton, J.; Labarre, P.; Toyama, A.; Piepenburg, O.; Parker, M.; Wood, R.; et al. Non-instrumented incubation of a recombinase polymerase amplification assay for the rapid and sensitive detection of proviral HIV-1 DNA. PLoS ONE 2014, 9, e108189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Crannell, Z.A.; Rohrman, B.; Richards-Kortum, R. Equipment-free incubation of recombinase polymerase amplification reactions using body heat. PLoS ONE 2014, 9, e112146. [Google Scholar] [CrossRef] [PubMed]
- Lillis, L.; Siverson, J.; Lee, A.; Cantera, J.; Parker, M.; Piepenburg, O.; Lehman, D.A.; Boyle, D.S. Factors influencing Recombinase polymerase amplification (RPA) assay outcomes at point of care. Mol. Cell. Probes 2016, 30, 74–78. [Google Scholar] [CrossRef] [Green Version]
Sense | Sequence | Position * | Reference | |
---|---|---|---|---|
RPA Exo Kit: Primers and Probe | ||||
HBV-Fc | Forward | ATT-CGC-AGT-CCC-CAA-CCT-CCA-ATC-ACT-CAC-C | 309–339 | This study |
HBV-R1 | Reverse | AAT-ACC-ACA-TCA-TCC-ATA-TAA-CTR-AAA-GCC | 755–726 | Shen et al. |
P1F-HBV | Forward | AAC-CTC-CAA-TCA-CTC-ACC-AAC-CTC-T | 322–346 | Yi et al. |
P1R-HBV | Reverse | GAT-AGT-CCA-GAA-GAA-CCA-ACA-AGA-AGA | 455–429 | Yi et al. |
EXO_HBV | Forward | CCA-AYT-TGT-CCT-GGC-TAT-CGY-TGG-ATG-[dT-FAM]-G[THF]-C[dT-BHQ1]G-CGG-CGT-TTT-ATC-AT-[Spacer C3] | 353–399 | This study |
RPA-NFO Kit: Primers, Probe, and Synthetic Control | ||||
HBV-Fc | Forward | ATT-CGC-AGT-CCC-CAA-CCT-CCA-ATC-ACT-CAC-C | 309–339 | This study |
P1R-HBV-FAM | Reverse | FAM-GAT-AGT-CCA-GAA-GAA-CCA-ACA-AGA-AGA | 455–429 | Yi et al. |
HBV probe | Forward | Biotin-CCA-AYT-TGT-CCT-GGC-TAT-CGY-TGG-ATG- TG[THF]-CTG-CGG-CGT-TTT-ATC-AT-[Spacer C3] | 353–399 | This study |
Synthetic control oligonucleotide | Forward | GGCCTAAATTCGCAGTCCCCAACCTCCAATCACTT ACCAACCTCCTGTCCTCGATCATGCCCATCAGCAG CTTATGATCAATATGATCCAAACCGAGGCGCTTCC TCTTCATCCTGCTGATGCCTCATCTTCTTGTTGGT TCTTCTGGACTATCAAGGTAT | This study | |
Control probe | Forward | Digoxigenin-CGA-TCA-TGC-CCA-TCA-GCA-GCT-TAT-GAT- CAA-T[THF]T-GAT-CCA-AAC-CGA-GGC-G-[Spacer C3] | This study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mayran, C.; Foulongne, V.; Van de Perre, P.; Fournier-Wirth, C.; Molès, J.-P.; Cantaloube, J.-F. Rapid Diagnostic Test for Hepatitis B Virus Viral Load Based on Recombinase Polymerase Amplification Combined with a Lateral Flow Read-Out. Diagnostics 2022, 12, 621. https://doi.org/10.3390/diagnostics12030621
Mayran C, Foulongne V, Van de Perre P, Fournier-Wirth C, Molès J-P, Cantaloube J-F. Rapid Diagnostic Test for Hepatitis B Virus Viral Load Based on Recombinase Polymerase Amplification Combined with a Lateral Flow Read-Out. Diagnostics. 2022; 12(3):621. https://doi.org/10.3390/diagnostics12030621
Chicago/Turabian StyleMayran, Charly, Vincent Foulongne, Philippe Van de Perre, Chantal Fournier-Wirth, Jean-Pierre Molès, and Jean-François Cantaloube. 2022. "Rapid Diagnostic Test for Hepatitis B Virus Viral Load Based on Recombinase Polymerase Amplification Combined with a Lateral Flow Read-Out" Diagnostics 12, no. 3: 621. https://doi.org/10.3390/diagnostics12030621