Next Article in Journal
A New Anticancer Semisynthetic Theobromine Derivative Targeting EGFR Protein: CADDD Study
Previous Article in Journal
Assessment of Countermovement Jump: What Should We Report?
Previous Article in Special Issue
Effects of Secretoneurin and Gonadotropin-Releasing Hormone Agonist on the Spawning of Captive Greater Amberjack (Seriola dumerili)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 13
Issue 1
10.3390/life13010188
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis)

by
Tong Zhou
1,†,
Haiqi Zhang
2,†,
Meng Chen
1,
Yingping Zhang
1,
Guobin Chen
1,
Guiwei Zou
1,* and
Hongwei Liang
1,3,*
1
Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
2
Zhejiang Institute of Freshwater Fisheries, Huzhou 313001, China
3
Key Laboratory of Aquatic Genomics, Ministry of Agriculture and Rural Affairs, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Life 2023, 13(1), 188; https://doi.org/10.3390/life13010188
Submission received: 21 November 2022 / Revised: 28 December 2022 / Accepted: 2 January 2023 / Published: 9 January 2023
(This article belongs to the Special Issue Sex Determination and Gonad Development: From Mechanism to Application)
Browse Figures
Versions Notes

Abstract

:
The Chinese soft-shelled turtle (Pelodiscus sinensis) is an important freshwater aquaculture animal in China. The Wnt gene family plays important regulatory roles in the development and growth of mammals. However, the precise function of these family genes has not been well understood in the sex differentiation of Chinese soft-shelled turtles. Here, we cloned a member of the Wnt family, Wnt2, which obtained a 1077 bp open reading frame that encoded a 358-aa protein. The putative amino acid sequences of proteins are exceeded 80% identical to other turtles. The expression level of Wnt2 peaked at the 14th stage both in female and male embryos during the early gonadal differentiation period of Chinese soft-shelled turtles, which occurred before gonadal differentiation. Wnt2 mRNA was expressed at higher levels in the brains and gonads of mature P. sinensis females compared with those in mature males. Wnt agonists significantly affected the expression level of Wnt2 during the gonadal differentiation period. After Wnt agonists (1.0 μg/μL, 2.5 μg/μL, 5.0 μg/μL) treatment, the expression level of the Wnt2 generally appeared to have an inverted-V trend over time in female embryonic gonads. The results suggested that Wnt2 may participate in the regulation of gonad development in P. sinensis during the early embryonic stages. These results could provide a theoretical basis for the reproduction process of the Chinese soft-shelled turtle.

1. Introduction

Pelodiscus sinensis, a Chinese soft-shelled turtle, is one of China’s economically important freshwater aquaculture animals [1]. When exposed to an appropriate temperature ranging from 24 to 34 °C, the P. sinensis eggs could develop normally [2]. Within this range, the temperature may not affect the sex ratio and hatching success of hatchling embryos. When eggs were incubated at 30 °C, the primitive gonads began to appear on the 15th day. The gonads undergo a process of growth and development, and the gonad differentiation is completed until the 26th day (20 stages) [3]. Unlike other animals, males are highly popular and have higher prices than females due to the fact that males are superior to females in weight, size, and calipash width, as well as lower fat content [4]. The previous study showed that the Chinese soft-shelled turtle was a genotypic sex determination mechanism having a ZZ/ZW sex determination system [5]. Therefore, it allows studying genetically all-male populations in this species.
The Wnt signaling pathway is involved in important life activities such as organ formation and early development through signal transduction regulated by Wnt genes. Many Wnt genes have been observed in many higher eukaryotes, ranging from humans to Xenopus and zebrafish [6,7,8,9]. Further, Wnt signaling genes related to turtles’ gonadal development and differentiation have been identified, such as Wnt4 and Rspo1 [10,11].
The role of Wnt signaling in several development processes has been suggested that several Wnt genes are expressed in different organisms. Previous studies showed that Wnt4-deficient could cause sex reversal and steroidogenic function alteration in female mice [12], whereas mice null for frizzled 4 (Fzd4) are found to infecundity and reveal the damage of the corpus luteum [13,14]. In contrast, it has been found that targeted disruption of the Wnt2 gene caused placentation defects [15], while Wnt2-null female mice were fertile [16]. Approximately 50% of Wnt2 knockout mice died soon after birth, possibly due to respiratory failure [17]. Wnt2, Wnt3, Wnt5a, and Wnt11 are involved in both follicular genesis and oogenesis [18], whereas during spermatogenesis of rainbow trout, other Wnt genes, such as Wnt5a, Wnt6, and Wnt7b are expressed in the testis [19].
Wnt2, a gene coding a factor from the Wnt family of signaling molecules, mediates the canonical Wnt/beta-catenin signaling pathway. Recent evidence suggests that the Wnt2 has been implicated in the development and differentiation process in invertebrate and vertebrate animals. Most previous studies have focused on expression patterns and regulatory mechanisms of the Wnt2 gene, which has been reported in mice [20], Pacific white shrimp [21], sea urchin [22] and flatworms [23]. Wnt2 exhibit the dimorphic expression pattern between male and female in the somatic gonadal cells of D. melanogaster, which is related to the doublesex (dsx) gene, which is required for male and female sex differentiation [24]. Additionally, the importance of Wnt2 ligand expression in follicles development has been well documented. For example, Wnt2 expression has been detected in rat follicular granulosa cells and in human cumulus cells and granulosa cells [25,26,27,28]. Wnt2 is reported to be highly expressed in Hyriopsis cumingii at all stages of ovarian development and 4 months of age gonads tissues, which suggests Wnt2 might be involved in the follicular formation and early gonadal development [29].
However, there is still no report focused on the role of Wnt2 in P. sinensis. Identification of Wnt2 expressed pattern in gonads tissues and embryos stage is essential for a broad understanding of their functions in gonadal development, potentially sex determination, and differentiation. In addition, we showed here information on the dynamics of Wnt2 gene expression in developing gonads after the treatment of Wnt agonist could provide insight into the early development of both types of embryos. Therefore, this research could greatly widen our insights on P. sinensis Wnt2 and uncover their potential regulatory roles in the sex determination and reproduction processes of reptiles.

2. Materials and Methods

2.1. Sample Collection

In this study, Chinese soft-shelled turtle fertilized eggs, three male and three female adults (mean weight 1000 g) were collected from Anhui Xijia Agricultural Development. Freshly laid fertilized eggs were collected and incubated in a constant temperature and humidity incubator. During the incubation process, the temperature was kept at 30 ± 0.5 °C, and humidity was controlled at 80–85%. Furthermore, embryos from stages 14–28 were sampled [30]. The details of sample collection have been portrayed previously [31]. Twenty embryo samples of different stages were processed, the ZZ/ZW-type sex of the embryos was identified based on sex-related markers developed [32], and then the embryos were used for quantitative expression analysis of embryonic gonadal development.
Nine tissues, including the brain, liver, heart, spleen, muscle, kidney, lung, intestines, and gonads, were obtained from healthy adult turtles P. Sinensis after MS-222 anesthesia. Finally, they were quickly collected and frozen in liquid nitrogen, then stored at −80 °C for RNA extraction. The research was performed in accordance with provisions for the Yangtze River Fisheries Research Institute Animal Care Committee and the Guidelines for the Care and Use of Laboratory Animals.

2.2. Tissue Distribution of Wnt2 Transcripts

Total RNA was extracted from tissues, and then the first-strand cDNA was synthesized with PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Dalian, China). The quantitative real-time PCR was conducted using the QuantStudio 5 Real-time PCR system (ABI, USA). RNA extraction, cDNA synthesis, and qRT-PCR were prepared from diverse tissues of P. sinensis under the same reaction conditions as mentioned in our study [31]. The relative expression of the Wnt2 gene was determined by the comparative Ct (2−ΔΔCt) method using the 18S rRNA gene as the reference gene [33] (Table 1).

2.3. Cloning of Full-Length cDNAs Encoding Wnt2

The PCR primers (Table 1) were designed to amplify the cDNA core fragment based on the mRNA sequences from NCBI data (Accession number: XM_006122543.3). Two fragments coding the core sequence of the Wnt2 gene were amplified by RT-PCR with HiScript® III 1st Strand cDNA Synthesis Kit and 2 × Rapid Taq Master Mix (Vazyme Bio, Inc., Nanjing, China). The reaction system was produced in a volume of 50 μL as follows: 25 μL 2 × Rapid Taq Master Mix, 1 μL cDNA, 1μL reverse primer (10 μM), 1 μL forward primer (10 μM), and 22 μL RNase-free ddH2O. The reaction conditions were as follows: pre-denaturation for 5 min at 95 °C; 95 °C for 30 s, 61 °C for 30 s, and 72 °C for 45 s, in 35 cycles; Extension at 72 °C for 10 min. Then PCR products were purified and sequenced in Wuhan Tianyihuiyuan Biotech Company.
The full-length cDNAs encoding Wnt2 from P. Sinensis were obtained using rapid amplification of cDNA ends (RACE). The 3′-RACE first-strand cDNAs were synthesized from 1 μg of total RNA from the ovary of P. Sinensis using the SMARTer® RACE 5′/3′ Kit (Takara) according to the manufacturer’s instructions. Each 3′-RACE first-strand cDNA was used as a template, and amplification was primed by the Wnt2-3′-GSP and UPM short (Table 1). The gene-specific primers (Wnt2-3′-GSP, Table 1) were designed based on the partial sequence of obtained cDNA fragments. The PCR of Wnt2 3′-RACE was performed according to the following program: 94 °C for 5 min, 25 cycles of 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min. The PCR products of 3′-RACE were subcloned into the pMD18-T vector (Takara) and sequenced.

2.4. Sequence Alignment and Analysis

The open reading frame (ORF) and amino acid sequences were predicted with an online program (http://www.bio-soft.net/sms/index.html (accessed on 7 March 2022.)) and SMART (http://smart.embl-heidelberg.de). Twelve representative sequences for Wnt2 amino acid sequences were obtained with the NCBI database. Multiple sequence alignment of Wnt2 amino acid sequences was performed using DNAMAN software 8.0. The ExPASy Molecular Biology server (http://www.us.expasy.org/) and SignalP 3.0 Server (http://www.cbs.dtu.dk/services/-SignalP (accessed on 8 March 2022.)) were applied to perform the Sequence analysis. A phylogenetic tree was conducted using MEGA-X software 10.0 with the neighbor-joining method.

2.5. Wnt Agonist Treatment

Wnt agonist (Selleck, Houston, TX, USA; NO. S8178) was used to mimic the effects of Wnt signaling at the whole organism level. Wnt agonist was identified as a small-molecule agonist of the Wnt signaling pathway. The activation of Wnt signaling also leads to the transcriptional activity of TCF/β-catenin and is independent of GSK-3β activity [34]. Wnt agonist treatments were carried out in accordance with the previous study [31].
Egg incubations were performed under the same condition as previously described. After 15 days of incubation, embryos were injected with different concentrations of Wnt agonist: 1.0 μg/µL, 2.5 μg/µL, and 5.0 μg/µL. The Wnt agonist was first prepared with ethanol as 10 μg/µL mother liquor and then diluted with a combination of 5% DMSO, 40% PEG 300, 5% Tween 80, and 50% ddH2O. The Control group was treated with 1μL of the mixture containing DSMO, PEG300, Tween 80, and ddH2O. At 0, 6, 12, 24, 36, 48, 72, 96, 120, 144, and 168 h time-point post injection (pi), 20 embryos of the experimental and control groups were collected. The type of the embryos was detected using sex-related markers, and the gonads of embryos were sampled for Wnt2 mRNA expression analysis.

2.6. Statistical Analysis

We used SPSS software 17.0 (SPSS Inc, Chicago, IL, USA), one-way analysis of variance (ANOVA), and Duncan’s multiple comparison test was used to compare the data derived from different groups. Statistical evaluation of significance between different experimental groups was determined by a p-value of less than 0.05. Data were presented as mean ± S.D. (standard deviation of the mean; n = 9).

3. Results

3.1. Cloning and Sequence Analysis

To explore the molecular functions of Wnt2, the cDNA sequence of Wnt2 containing the entire coding region was cloned from the Chinese soft-shelled turtle P. sinensis. The 1285 bp PsWnt2 was obtained, which included 5′-UTR of 20 bp, 3′-UTR of 188 bp, and an ORF of 1077 bp encoding a polypeptide of 358 amino acids (Figure 1). Sequence analysis predicted the ORF of PsWnt2 encodes a 24-residue signal peptide (SP), the conserved WNT domain, and 25 conserved cysteine sites were identified in P. sinensis Wnt2. The sequence details about PsWnt2 are shown in Figure 1.
Through the ProtParam program (http://www.expasy.org/tools/protparam.html (accessed on 10 March 2022)), the molecular mass of the deduced Wnt2 protein was predicted to be 40.338 kDa, and the isoelectric point (pI) was 9.36, which was acidic and uncharged. The hydrophilic coefficient of the Wnt2 protein was −0.412, and its instability index was 41.66, indicating that the protein was unstable and hydrophobic. Amino acid sequence homology comparison demonstrated that the deduced amino acid sequence of P. sinensis Wnt2 shared 88.30%, 88.56%, 88.83%, 88.30%, 78.19%, and 63.03% identity with that in the western painted turtle (Chrysemys picta bellii), the green turtle (Chelonia mydas), three-toed box turtles (Terrapene carolina triunguis), the red-eared turtle (Trachemys scripta elegans), human (Homo sapiens), and zebrafish (Danio rerio), respectively (Figure 2, Table S1). The phylogenetic tree based on the Wnt2 amino acid sequence showed that P. sinensis was evolutionarily most closely related to the western painted turtle, the green turtle, three-toed box turtles, and the red-eared turtle, which are clustered into a small branch, then followed by mouse, human, and zebrafish. The phylogenetic analysis showed that P. sinensis formed a clade with other turtle species with high similarity (Figure 3). Supplementary Figure S1 showed relative Wnt gene expression during the embryo development stages of Chinese soft-shelled turtle. We found that these Wnt genes have a common domain after comparison (Supplementary Figure S2).

3.2. Expression Pattern of PsWnt2 during Embryonic Development

Quantitative PCR was used to compare the relative expression levels of PsWnt2 mRNA in different embryonic developmental stages and types. At the early developmental stage 14 of the male embryos, the expression level of PsWnt2 was significantly higher than that in female embryos. The PsWnt2 expression in stage 14 was about 10 times higher than that in stage 20 in male embryos. Moreover, the expression levels of PsWnt2 at some embryonic stages (14, 18, 20, and 22) in males were significantly higher in females (Figure 4).

3.3. Tissue Distribution of PsWnt2 mRNA

In this study, the expression levels of PsWnt2 among different tissues were analyzed. We found that it was significantly expressed in the brain, testis, and ovary than in other tissues. In contrast, in males and females, the mRNA expression level of PsWnt2 had an extremely low expression level in the heart, liver, spleen, and intestine. In addition, PsWnt2 expression had a female-biased expression pattern in the brain, gonad, and lung. Among all tissues of the two types (female and male), PsWnt2 expression was highest in the female ovary (p < 0.05; Figure 5).

3.4. Effects of a Wnt Agonist on P. sinensis Wnt2 Expression

After incubation for 15 days, the Chinese soft-shelled turtle embryos were selected to study PsWnt2 expression in response to the Wnt agonists challenge. This small molecule activates Wnt signaling by inducing catenin via inducing beta-Catenin/TCF transcription. Wnt agonists can significantly influence the expression levels of sex-related genes (Supplementary Figure S3). To investigate the effects of Wnt agonist on the gonads of P. sinensis, the expression of Wnt2 in gonad samples was detected at 11 time points of the experiment using qRT-PCR (Figure 6). In female embryonic gonads, the expression of Wnt2 in the 1.0 μg/µL treatment group was not significantly different from that in the control group from 6 to 36 h. However, the expression was significantly up-regulated at 48 h and remained high expression level until 168 h. In 5.0 μg/µL and 2.5 μg/µL treatment groups, the peak was reached at 48 h and 36 h, respectively, and then showed a downward trend. In male embryonic gonads, the expression level of PsWnt2 in three experimental groups was not significantly different at four-time points (6 h, 12 h, 24 h, and 36 h) compared with 0 h. In contrast, PsWnt2 mRNA expression increased dramatically at 48 h. Moreover, in the 1.0 μg/µL and 5.0 μg/µL Wnt agonist-treated groups, PsWnt2 expression was maintained at a high expression level after 72 h.

4. Discussion

The Wnt signaling pathway is a conserved signaling pathway that plays an important role in regulating and controlling many important internal biological processes. This study showed that the Wnt2 gene of P. sinensis was 1285 bp in length and encoded 358 amino acids, containing a wnt1 domain, a signal peptide, and 25 conserved cysteine sites, which is consistent with the structural characteristics of Wnt-related proteins [21]. Protein sequence analysis revealed that the P. sinensis Wnt2 shared the highest homology (approximately 80%) with the Wnt2 of Chelonia mydas, Chelonoidis abingdonii, and Chrysemys picta bellii and a lower identity (approximately 70%) with the Wnt2 of other vertebrates (Homo sapiens and Gallus gallus). These findings further demonstrated that the Wnt2 genes were successfully isolated from the P. sinensis in this study. The phylogenetic tree result of Wnt2 was consistent with the traditional evolutionary relationship, and Wnt2 was conserved in structure and function.
In this study, the expression levels of PsWnt2 at some embryonic stages (14, 18, 20, and 22) in male embryos were significantly higher than that in female embryos. This particular expression pattern suggests that the Wnt2 gene may play a role in regulating gonadal differentiation. Wnt genes have been demonstrated to exert critical roles in embryonic development in vertebrates and invertebrates. Similar results have been observed in Paracentrotus Lividus; Wnt2 mRNA expression has been detected in embryonic developmental stages from the mid-blastula stage to the pluteus larva stage, reaching a peak at the swimming blastula stage [22]. In zebrafish embryos, Wnt2 is required for early hepatoblast proliferation, and Wnt2 can interact with Wnt2b to participate in swim bladder formation [35]. In addition, Wnt2 is expressed in gonad formation in drosophila embryos and could promote the development of germ cells. And that, Wnt2 might stimulate male germ cells to reenter the cell cycle, but not in female embryos [36]. Consequently, Wnt2 was highly expressed in the early gonadal stage of embryonic development, suggesting that it was involved in determining several specific organ fates in early development.
The Wnt2 gene is widely expressed during fetal life and functional in organs. For example, Wnt2 is expressed in the heart and lung and mammary glands of developing mouse embryos [20], suggesting that this gene could regulate the development and differentiation of several tissues. In this study, the Wnt2 gene had a constitutive expression in diverse tissues of P. sinensis, but relative expression levels varied. The high expression level of Wnt2 in ovaries tissues showed its significance in female gonadal development as in mammals. Conversely, a Wnt2 homolog, Wnt2b, has not been prominently expressed in adult carp’s testis and ovaries [37].
Moreover, studies of Wnt2 mutant mice showed that it was essential for male fertility as well as that in females [37]. Wnt2 has been reported to be essential for granule cell growth, and the knockdown of Wnt2 by siRNA in mice indicates its cell proliferation was inhibited [38]. However, its functional role in determining the gonadal sexual fate among other turtle species still needs further investigation. Interestingly, the Wnt2 gene was also highly expressed in the brain tissue of the male. A previous report showed that the Wnt2 gene plays a key role in the later stages of mature brain development [39]. Similarly, Wnt2 was expressed in the developing brain of the spider Achaearanea tepidariorum and myriapod Glomeris marginata, suggesting that Wnt2 has a possible role in brain regionalization [40]. This observation may have suggested the specific role of Wnt2 in the brain and gonadal development.
The canonical Wnt signaling pathway was demonstrated to be involved in the morphogenesis of the ovary and testis. Mork and Capel reported that ectopic activation of the Wnt signaling pathway in male gonads results in male-to-female sex reversal in the red-eared slider turtle [41]. On the other hand, suppression of the pathway in female gonads contributed to sex reversal from female to male, indicating that Wnt signaling may be necessary for turtle gonadal differentiation during embryogenesis.
In the Wnt signaling pathway, ligand Wnt2 specifically regulates the canonical Wnt signaling pathway. The overexpression of Wnt2 reduced GSK-3β transcription and accelerated the accumulation of nuclear level β-catenin [42]. In our study, the Wnt2 expression of female embryonic gonads in the three treatment groups reached the peak at 48 h or 36 h, respectively, and then the two groups (2.5 μg/µL and 5.0 μg/µL Wnt agonist-treated group) showed a downward trend. In male embryos, the Wnt2 expression level in three experimental groups increased dramatically at 48 h and remained at a high expression level. Previous studies have shown that Wnt agonist-induced β-catenin accumulation in the nucleus and β-catenin expression was increased with the increase in treatment concentration [43]. We speculated that there might be an exact mechanism that can somehow stabilize β-catenin and rescue cell injury derived from excessive accumulation of β-catenin. On the other hand, GSK-3β negatively regulates the Wnt signaling pathway by phosphorylating β-catenin [44]. Therefore, these results suggested that the distinct expression pattern of Wnt2 may account for the feedback regulation machinery of the Wnt signal pathway response to a Wnt agonist. In contrast, the mechanism might be more sensitive to female embryos than male embryos. In early Ciona embryos, overexpression of β-catenin could directly change the endoderm cell differentiation’s fate [45].
Taken together, the increased expression of Wnt2 may activate the Wnt signaling pathway, stimulate the activation of Wnt target gene expression, and influence the fate of female gonads differentiation. As the interaction between the Wnt signaling pathway, gonadal development, and sex determination in turtles is a complex process, the information on the Wnt signaling molecule regulating this mechanism is limited to very few studies. Further studies are envisaged to elucidate the specific role of the requirement of Wnt/β-catenin signaling in the turtles by the experiments of the RNA interference of the Wnt2 gene in the gonads and bring a new perspective to the precise requirements for Wnt/β-catenin signaling in early gonadal development patterning.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/life13010188/s1, Figure S1: Relative Wnt genes expression during embryo development stages; Figure S2: The structure of Wnt proteins in Pelodiscus sinesis; Figure S3: Expressions of sex-related genes after treatment Wnt agonist; Table S1: Comparison of deduce amino region of P. sinensis Wnt2 with that of other species.

Author Contributions

H.L. and G.Z. conceived the study. Y.Z. and M.C. performed the experiments. Y.Z. and G.C. contributed to the sample collection. M.C. conducted the bioinformatics analysis. T.Z. and H.Z. contributed to the manuscript preparation. T.Z. and H.L. offered useful guidance and recommendations that contributed greatly to the conduct of this research. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Key Laboratory of Healthy Freshwater Aquaculture, Ministry of Agriculture and Rural Affairs, Key Laboratory of Freshwater Aquaculture genetic and breeding of Zhejiang Province, Zhejiang Institute of Freshwater Fisheries, China (ZJK202207), and the National Freshwater Aquatic Germplasm Resource Center (FGRC18537).

Institutional Review Board Statement

The Animal Care and Ethics Committee of the Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences (Wuhan, China), approved this research (Approval Code: 2022YFI-ZT-01), and all experimental protocols and methods were performed in accordance with the relevant guidelines and regulations.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors have no conflict of interest to declare.

References

  1. Liang, H.; Meng, Y.; Cao, L.; Li, X.; Zou, G. Effect of exogenous hormones on R-spondin 1 (RSPO1) gene expression and embryo development in Pelodiscus sinensis. Reprod. Fertil. Dev. 2019, 31, 1425–1433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Ji, X.; Chen, F.; Du, W.; Chen, H. Incubation temperature affects hatchling growth but not sexual phenotype in the Chinese soft-shelled turtle, Pelodiscus sinensis (Trionychidae). J. Zool. 2003, 261, 409–416. [Google Scholar] [CrossRef] [Green Version]
  3. Li, H.; Zhou, Z.S.; Wu, T.; Wu, Y.Q.; Ji, X. Do fluctuations in incubation temperature affect hatchling quality in the Chinese soft-shelled turtle Pelodiscus sinensis? Aquaculture 2013, 406, 91–96. [Google Scholar] [CrossRef]
  4. Ma, X.; Cen, S.; Wang, L.; Zhang, C.; Wu, L.; Tian, X.; Wu, Q.; Li, X.; Wang, X. Genome-wide identification and comparison of differentially expressed profiles of miRNAs and lncRNAs with associated ceRNA networks in the gonads of Chinese soft-shelled turtle, Pelodiscus sinensis. BMC Genom. 2020, 21, 443. [Google Scholar] [CrossRef] [PubMed]
  5. Mu, Y.; Zhao, B.; Tang, W.-Q.; Sun, B.-J.; Zeng, Z.-G.; Valenzuela, N.; Du, W.-G. Temperature-dependent sex determination ruled out in the Chinese soft-shelled turtle (Pelodiscus sinensis) via molecular cytogenetics and incubation experiments across populations. Sex. Dev. 2015, 9, 111–117. [Google Scholar] [CrossRef]
  6. Lu, F.I.; Thisse, C.; Thisse, B. Identification and mechanism of regulation of the zebrafish dorsal determinant. Proc. Natl. Acad. Sci. USA 2011, 108, 15876–15880. [Google Scholar] [CrossRef] [Green Version]
  7. Yao, M.; Fang, M.; Zheng, W.J.; Yao, D.F. Oncogenic Wnt3a: A promising specific biomarker in hepatocellular carcinoma. Hepatoma Res. 2018, 4, 30. [Google Scholar] [CrossRef] [Green Version]
  8. Yin, A.; Winata, C.L.; Korzh, S.; Korzh, V.; Gong, Z. Expression of components of Wnt and Hedgehog pathways in different tissue layers during lung development in Xenopus laevis. Gene Expr. Patterns 2010, 10, 338–344. [Google Scholar] [CrossRef]
  9. Zhang, B.; Tran, U.; Wessely, O. Expression of Wnt signaling components during Xenopus pronephros development. PloS ONE 2011, 6, e26533. [Google Scholar] [CrossRef]
  10. Barlian, A.; Vanawati, N.; Ayuningtyas, F.D. The patterns of sex determination and differentiation genes in green sea turtle (Chelonia mydas). Berk. Penelit. Hayati 2015, 20, 15–20. [Google Scholar] [CrossRef]
  11. Zhang, Y.; Xiao, L.; Sun, W.; Li, P.; Zhou, Y.; Qian, G.; Ge, C. Knockdown of R-spondin1 leads to partial sex reversal in genetic female Chinese soft-shelled turtle Pelodiscus sinensis. Gen. Comp. Endocrinol. 2021, 309, 113788. [Google Scholar] [CrossRef] [PubMed]
  12. Biason-Lauber, A. WNT4, RSPO1, and FOXL2 in sex development. Semin. Reprod. Med. 2012, 30, 387–395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Dailey, W.A.; Gryc, W.; Garg, P.G.; Drenser, K.A. Frizzled-4 variations associated with retinopathy and intrauterine growth retardation: A potential marker for prematurity and retinopathy. Ophthalmology 2015, 122, 1917–1923. [Google Scholar] [CrossRef] [PubMed]
  14. Drenser, K.A. Wnt signaling pathway in retinal vascularization. Eye Brain 2016, 8, 141. [Google Scholar] [CrossRef] [Green Version]
  15. Zhang, Z.; Zhang, L.; Zhang, L.; Jia, L.; Wang, P.; Gao, Y. Association of Wnt2 and sFRP4 expression in the third trimester placenta in women with severe preeclampsia. Reprod. Sci. 2013, 20, 981–989. [Google Scholar] [CrossRef] [Green Version]
  16. Boyer, A.; Goff, A.K.; Boerboom, D. WNT signaling in ovarian follicle biology and tumorigenesis. Trends Endocrinol. Metab. 2010, 21, 25–32. [Google Scholar] [CrossRef]
  17. Ferreira, J.C.; Choufani, S.; Grafodatskaya, D.; Butcher, D.T.; Zhao, C.; Chitayat, D.; Shuman, C.; Kingdom, J.; Keating, S.; Weksberg, R. WNT2 promoter methylation in human placenta is associated with low birthweight percentile in the neonate. Epigenetics 2011, 6, 440–449. [Google Scholar] [CrossRef] [Green Version]
  18. Waiho, K.; Fazhan, H.; Zhang, Y.; Li, S.; Zhang, Y.; Zheng, H.; Ikhwanuddin, M.; Ma, H. Comparative profiling of ovarian and testicular piRNAs in the mud crab Scylla paramamosain. Genomics 2020, 112, 323–331. [Google Scholar] [CrossRef]
  19. Nicol, B.; Guiguen, Y. Expression Profiling of Wnt Signaling Genes during Gonadal Differentiation and Gametogenesis in Rainbow Trout. Sex. Dev. 2011, 5, 318–329. [Google Scholar] [CrossRef]
  20. Goss, A.M.; Tian, Y.; Tsukiyama, T.; Cohen, E.D.; Zhou, D.; Lu, M.M.; Yamaguchi, T.P.; Morrisey, E.E. Wnt2/2b and β-catenin signaling are necessary and sufficient to specify lung progenitors in the foregut. Dev. Cell 2009, 17, 290–298. [Google Scholar] [CrossRef]
  21. Du, J.; Zhang, X.; Yuan, J.; Zhang, X.; Li, F.; Xiang, J. Wnt gene family members and their expression profiling in Litopenaeus vannamei. Fish Shellfish. Immunol. 2018, 77, 233–243. [Google Scholar] [CrossRef] [PubMed]
  22. Robert, N.; Hammami, F.; Lhomond, G.; Dru, P.; Lepage, T.; Schubert, M.; Croce, J.C. A wnt2 ortholog in the sea urchin Paracentrotus lividus. Genesis 2019, 57, e23331. [Google Scholar] [CrossRef] [PubMed]
  23. Riddiford, N.; Olson, P.D. Wnt gene loss in flatworms. Dev. Genes Evol. 2011, 221, 187. [Google Scholar] [CrossRef]
  24. Prakash, A.; Monteiro, A. Molecular mechanisms of secondary sexual trait development in insects. Curr. Opin. Insect Sci. 2016, 17, 40–48. [Google Scholar] [CrossRef] [PubMed]
  25. Hu, Q.; Tian, H.; Li, W.; Meng, Y.; Wang, Q.; Xiao, H. Identification of critical sex-biased genes in Andrias davidianus by de novo transcriptome. Mol. Genet. Genom. 2019, 294, 287–299. [Google Scholar] [CrossRef] [PubMed]
  26. Qiao, G.Y.; Dong, B.W.; Zhu, C.J.; Yan, C.Y.; Chen, B.L. Deregulation of WNT2/FZD3/β-catenin pathway compromises the estrogen synthesis in cumulus cells from patients with polycystic ovary syndrome. Biochem. Biophys. Res. Commun. 2017, 493, 847–854. [Google Scholar] [CrossRef] [PubMed]
  27. Tepekoy, F.; Uysal, F.; Acar, N.; Ustunel, I.; Akkoyunlu, G. The effect of GnRH antagonist cetrorelix on Wnt signaling members in pubertal and adult mouse ovaries. Histochem. Cell Biol. 2019, 152, 423–437. [Google Scholar] [CrossRef]
  28. Wang, H.X.; Gillio-Meina, C.; Chen, S.; Gong, X.Q.; Li, T.Y.; Bai, D.; Kidder, G.M. The canonical WNT2 pathway and FSH interact to regulate gap junction assembly in mouse granulosa cells. Biol. Reprod. 2013, 89, 39. [Google Scholar] [CrossRef]
  29. Wang, Y.; Chen, Y.; Cao, M.; Wang, X.; Wang, G.; Li, J. Identification of Wnt2 in the pearl mussel Hyriopsis cumingii and its role in innate immunity and gonadal development. Fish Shellfish. Immunol. 2021, 118, 85–93. [Google Scholar] [CrossRef]
  30. Tokita, M.; Kuratani, S. Normal Embryonic Stages of the Chinese Softshelled Turtle Pelodiscus sinensis (Trionychidae). Zool. Sci. 2001, 18, 705–715. [Google Scholar] [CrossRef]
  31. Chen, M.; Zhang, Y.; Zhang, M.; Qu, C.; Zou, G.; Liang, H. Characterization and expression pattern of Wnt5b gene in Pelodiscus sinensis. Aquac. Res. 2022, 53, 2937–2946. [Google Scholar] [CrossRef]
  32. Liang, H.W.; Wang, L.; Sha, H.; Zou, G.W. Development and Validation of Sex-Specific Markers in Pelodiscus Sinensis Using Restriction Site-Associated DNA Sequencing. Genes 2019, 10, 302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  34. Kuncewitch, M.; Yang, W.L.; Molmenti, E.; Nicastro, J.; Coppa, G.F.; Wang, P. Wnt agonist attenuates liver injury and improves survival after hepatic ischemia/reperfusion. Shock 2013, 39, 3–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Poulain, M.; Ober, E.A. Interplay between Wnt2 and Wnt2bb controls multiple steps of early foregut-derived organ development. Development 2011, 138, 3557–3568. [Google Scholar] [CrossRef] [Green Version]
  36. Deshpande, G.; Nouri, A.; Schedl, P. Wnt Signaling in Sexual Dimorphism. Genetics 2016, 202, 661–673. [Google Scholar] [CrossRef] [Green Version]
  37. Deepa, S.; Senthilkumaran, B. Interactive role of Wnt signaling and Zn in regulating testicular function of the common carp, Cyprinus carpio. Theriogenology 2021, 161, 161–175. [Google Scholar] [CrossRef]
  38. Gifford, J.H. The role of WNT signaling in adult ovarian folliculogenesis. Reproduction 2015, 150, R137–R148. [Google Scholar] [CrossRef] [Green Version]
  39. Marui, T.; Funatogawa, I.; Koishi, S.; Yamamoto, K.; Matsumoto, H.; Hashimoto, O.; Jinde, S.; Nishida, H.; Sugiyama, T.; Kasai, K.; et al. Association between autism and variants in the wingless-type MMTV integration site family member 2 (WNT2) gene. Int. J. Neuropsychopharmacol. 2010, 13, 443–449. [Google Scholar] [CrossRef] [Green Version]
  40. Janssen, R.; Posnien, N. Identification and embryonic expression of Wnt2, Wnt4, Wnt5 and Wnt9 in the millipede Glomeris marginata (Myriapoda: Diplopoda). Gene Expr. Patterns 2014, 14, 55–61. [Google Scholar] [CrossRef]
  41. Mork, L.; Capel, B. Conserved action of β-catenin during female fate determination in the red-eared slider turtle. Evol. Dev. 2013, 15, 96–106. [Google Scholar] [CrossRef] [PubMed]
  42. Finnson, K.W.; Kontogiannea, M.; Li, X.; Farookhi, R. Characterization of Wnt2 overexpression in a rat granulosa cell line (DC3): Effects on CTNNB1 activation. Biol. Reprod. 2012, 87, 12. [Google Scholar] [CrossRef] [PubMed]
  43. Kato, Y.; Naiki, Y.; Komatsu, T.; Takahashi, K.; Nakamura, J.; Koide, N. A Wnt Pathway Activator Induces Apoptosis and Cell Death in Mouse Monocytic Leukemia Cells. Oncol. Res. 2017, 25, 479–483. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, W.C.; Tsai, J.J.; Kuo, C.Y.; Chen, H.M.; Kao, S.H. Non-proteolytic house dust mite allergen, Der p 2, upregulated expression of tight junction molecule claudin-2 associated with Akt/GSK-3β/β-catenin signaling pathway. J. Cell. Biochem. 2011, 112, 1544–1551. [Google Scholar] [CrossRef]
  45. Satou, Y.; Imai, K.S.; Satoh, N. Early embryonic expression of a LIM-homeobox gene Cs-lhx3 is downstream of β-catenin and responsible for the endoderm differentiation in Ciona savignyi embryos. Development 2001, 128, 3559–3570. [Google Scholar] [CrossRef]
Life 13 00188 g001 550
Figure 1. Wnt2 cDNA sequence and putative amino acid of P. sinensis. The start codon and end codon are presented in bold black. The red denotes the WNT domain. The termination codon is shown with an asterisk, and the Poly A tail is marked with an underscore. “c” represents cysteines in the Wnt2 amino acid sequence and is marked blue.
Figure 1. Wnt2 cDNA sequence and putative amino acid of P. sinensis. The start codon and end codon are presented in bold black. The red denotes the WNT domain. The termination codon is shown with an asterisk, and the Poly A tail is marked with an underscore. “c” represents cysteines in the Wnt2 amino acid sequence and is marked blue.
Life 13 00188 g001
Life 13 00188 g002 550
Figure 2. Multiple sequences alignment of Wnt2 amino acid sequences from different species. Black labels denote amino acids with similarity equal to 100%. The Wnt1 domain of Wnt2 is shown with a red line. The cysteine residues are marked orange.
Figure 2. Multiple sequences alignment of Wnt2 amino acid sequences from different species. Black labels denote amino acids with similarity equal to 100%. The Wnt1 domain of Wnt2 is shown with a red line. The cysteine residues are marked orange.
Life 13 00188 g002
Life 13 00188 g003 550
Figure 3. Phylogenetic tree for different species based on Wnt2 AA sequences. * represents Pelodiscus sinesis.
Figure 3. Phylogenetic tree for different species based on Wnt2 AA sequences. * represents Pelodiscus sinesis.
Life 13 00188 g003
Life 13 00188 g004 550
Figure 4. The expression pattern of Wnt2 in embryonic developmental stages from 14 to 28 of P. sinensis. The relative expression level in female gonads at stage 20 was defined as 1. Different letters indicated a significant difference between male and female embryonic gonads at different developmental stages (p < 0.05).
Figure 4. The expression pattern of Wnt2 in embryonic developmental stages from 14 to 28 of P. sinensis. The relative expression level in female gonads at stage 20 was defined as 1. Different letters indicated a significant difference between male and female embryonic gonads at different developmental stages (p < 0.05).
Life 13 00188 g004
Life 13 00188 g005 550
Figure 5. Tissue expression analysis of Wnt2 in P. sinensis. The expression level of Wnt2 mRNA in the female intestine tissues was the control quantity. Data are shown as means  ±  standard deviations. Various letters indicated statistically significant differences (p  <  0.05).
Figure 5. Tissue expression analysis of Wnt2 in P. sinensis. The expression level of Wnt2 mRNA in the female intestine tissues was the control quantity. Data are shown as means  ±  standard deviations. Various letters indicated statistically significant differences (p  <  0.05).
Life 13 00188 g005
Life 13 00188 g006 550
Figure 6. Effects on gene expression of Wnt2 in different genders of P. sinensis embryonic gonads under different concentrations agonists. The vertical axis denoted the expression of Wnt2 mRNA at each time point. The horizontal axis denoted the experimental time after injecting Wnt agonists. (A–C) Wnt2 mRNA level in the female embryos for 1.0 μg/µL, 2.5 μg/µL and 5.0 μg/µL Wnt agonists. (D–F) Wnt2 mRNA level in the male embryos for 1.0 μg/µL, 2.5 μg/µL and 5.0 μg/µL Wnt agonists. The data were shown as the mean ± S.D. Various letters indicated significant differences (p < 0.05).
Figure 6. Effects on gene expression of Wnt2 in different genders of P. sinensis embryonic gonads under different concentrations agonists. The vertical axis denoted the expression of Wnt2 mRNA at each time point. The horizontal axis denoted the experimental time after injecting Wnt agonists. (A–C) Wnt2 mRNA level in the female embryos for 1.0 μg/µL, 2.5 μg/µL and 5.0 μg/µL Wnt agonists. (D–F) Wnt2 mRNA level in the male embryos for 1.0 μg/µL, 2.5 μg/µL and 5.0 μg/µL Wnt agonists. The data were shown as the mean ± S.D. Various letters indicated significant differences (p < 0.05).
Life 13 00188 g006
Table
Table 1. The information of the primers for Wnt2 amplification in P. sinensis.
Table 1. The information of the primers for Wnt2 amplification in P. sinensis.
Primer Name Primer Sequence (5′–3′)Application
UPMCTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT5′ and 3′ RACE PCR
UPM shortCTAATACGACTCACTATAGGGC
Wnt2-FCGGAGTGAAGTGTTTCTAATATGAACDS clone
Wnt2-RACAGCCTTCCTTCCCGCTCT
Wnt2-F2TCACAAGGGCATGTAGTCAAGGGGA
Wnt2-R2GTGTACGTCCACCACCTCCAGGCAG
Wnt2-3′-GSPCTGTATCAGAGACTGGGATGTAGGCT3′ RACE
Wnt2-qFCAAGACGGCACTGGTTTCACqPCR
Wnt2-qRGTCCCAAGGGAGCCTACATC
Sox3-FGAGTGTAGAGGTGGAATGGAAACG
Sox3-RAAACCCTCAAGCAGGATACGG
Dmrt1-FCCGCCTCGGGAAAGAAGTC
Dmrt1-RTGCTGGATGCCGTAGTTGC
Wnt4-FGAGGTGATGGACTCGGTGCG
Wnt4-RCCCGTTCTTGAGGTCGTGGTC
Amh-FCGGCTACTCCTCCCACACG
Amh-RCCTGGCTGGAGTATTTGACGG
18S rRNA-FAAAGGAATTGACGGAAGGGCACInternal control
18S rRNA-RGCTCCACCAACTAAGAACGG
Ps4085-FGTTTGAAGTGCTGCTGGGAAGSex identification
Ps4085-RTTCCCCGTATAAAGCCAGGG
COI-FCAACCAACCACAAAGACATTGGCAC
COI-RACCTCAGGGTGTCCGAAAATCAAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhou, T.; Zhang, H.; Chen, M.; Zhang, Y.; Chen, G.; Zou, G.; Liang, H. Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Life 2023, 13, 188. https://doi.org/10.3390/life13010188

AMA Style

Zhou T, Zhang H, Chen M, Zhang Y, Chen G, Zou G, Liang H. Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Life. 2023; 13(1):188. https://doi.org/10.3390/life13010188

Chicago/Turabian Style

Zhou, Tong, Haiqi Zhang, Meng Chen, Yingping Zhang, Guobin Chen, Guiwei Zou, and Hongwei Liang. 2023. "Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis)" Life 13, no. 1: 188. https://doi.org/10.3390/life13010188

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop