Next Article in Journal
Genes Participating in the Ensheathment of Neurons Are Affected by Postnatal Stress and Maternal Immune Activation in the Pituitary Gland
Previous Article in Journal
CRISPR/Cas9-Mediated Knockout of tnfaip1 in Zebrafish Plays a Role in Early Development
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 14
Issue 5
10.3390/genes14051006
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Helicobacter pylori Strains Isolated from Raw Poultry Meat in the Shahrekord Region, Iran: Frequency and Molecular Characteristics

by
Sepehr Asadi
1,
Ebrahim Rahimi
1,2,* and
Amir Shakerian
2
1
Department of Food Hygiene, Shahrekord Branch, Islamic Azad University, Shahrekord P.O. Box 166, Iran
2
Research Center of Nutrition and Organic Products, Shahrekord Branch, Islamic Azad University, Shahrekord P.O. Box 166, Iran
*
Author to whom correspondence should be addressed.
Genes 2023, 14(5), 1006; https://doi.org/10.3390/genes14051006
Submission received: 12 November 2022 / Revised: 19 April 2023 / Accepted: 26 April 2023 / Published: 28 April 2023
(This article belongs to the Section Molecular Genetics and Genomics)
Review Reports Versions Notes

Abstract

:
Even though Helicobacter pylori (H. pylori) is a serious pathogen, its origin is unknown. Poultry (chicken, turkey, quail, goose, and ostrich) is consumed as a regular protein source by many people across the world; therefore, sanitary ways of delivering poultry for food are important for global health. As a result, the distribution of the virulence genes cagA, vacA, babA2, oipA, and iceA in H. pylori isolates in poultry meat, as well as their antibacterial resistance, was investigated. A Wilkins Chalgren anaerobic bacterial medium was used to cultivate 320 samples of raw poultry meat. Disk diffusion and multiplex-PCR were used to investigate both antimicrobial resistance and genotyping patterns. H. pylori was found in 20 of 320 (6.25 %) raw chicken meat samples. The highest incidence of H. pylori was found in chicken raw meat (15%), whereas no isolate was recovered from goose or quail raw meat (0.00%). Resistance to ampicillin (85%), tetracycline (85%), and amoxicillin (75%) were the most commonly detected in the tested H. pylori isolates. The percentage of H. pylori isolates with a multiple antibiotic resistance (MAR) index value of more than 0.2 was 17/20 (85%). The most prevalent genotypes detected were VacA (75%), m1a (75%), s2 (70%) and m2 (65%), and cagA (60%). The most typically detected genotype patterns were s1am1a (45 %), s2m1a (45 %), and s2 m2 (30%). babA2, oipA+, and oipA- genotypes were found in 40%, 30%, and 30% of the population, respectively. In summary, fresh poultry meat was polluted by H. pylori, with the babA2, vacA, and cagA genotypes being more prevalent. The simultaneous occurrence of vacA, cagA, iceA, oipA, and babA2 genotypes in antibiotic-resistant H. pylori bacteria raises a serious public health concern regarding the consumption of raw poultry. Future research should evaluate antimicrobial resistance among H. pylori isolates in Iran.

1. Introduction

The genus Helicobacter is a group of Gram-negative bacteria known for their helical, curved, or sometimes coccoid (spherical) shape. Helicobacter bacteria are generally small, with a length ranging from 2 to 4 μm and a width ranging from 0.5 to 1.0 μm [1,2]. Helicobacter bacteria can be classified into two main categories based on their preferred location of colonization in the body. The first category is the stomach Helicobacter, which colonize the gastric mucosa (the lining of the stomach) and include species such as Helicobacter pylori (H. pylori). These bacteria are associated with a range of gastrointestinal diseases, including gastritis, peptic ulcers, and stomach cancer [3,4,5]. The second category is enterohepatic Helicobacter, which colonize the liver, biliary tract, and intestine. These bacteria include species such as Helicobacter hepaticus and Helicobacter bilis, and are associated with a range of conditions such as hepatitis, cholecystitis, and inflammatory bowel disease [6]. Recently, Helicobacter have been referred to as zoonotic bacteria [7].
Poultry (chicken, turkey, quail, goose, and ostrich) is a popular protein source in countries across the globe [8,9]. The main reasons for the interest in poultry meat are its relatively low production costs and the absence of cultural and religious restrictions on its consumption [10]. Contamination of poultry meat can occur at various stages of its slaughter and processing [11,12]. Studies have shown that H. pylori can survive in the gastrointestinal tract of chickens, and these bacteria can be present in their feces [13]. If proper hygiene and sanitation practices are not followed during slaughter and processing, these bacteria can contaminate the poultry meat. Consumption of poultry meat contaminated with H. pylori may increase the risk of gastrointestinal infections in humans [5]. Sanitary delivery techniques for food-producing chickens are therefore essential for public health [14].
The emergence of antibiotic-resistant H. pylori strains has become a global issue, and many published studies reveal that H. pylori strains isolated from food sources, as well as clinical specimens, show a high rate of resistance against various types of antimicrobial medications, including macrolide, fluoroquinolones, metronidazole, tetracyclines, penicillin, aminoglycosides, and sulfonamides [15,16,17]. H. pylori resistance to antibacterial treatments has become a global issue, and many published studies have shown that both clinical and foodborne strains of H. pylori exhibited a high rate of resistance to various antibiotics [18,19,20,21]. While H. pylori is a frequently reported pathogen in humans and poultry, its source is still unclear [22]. H. pylori pathogenesis is linked to virulence genes only found in certain groups. Several virulence genes in H. pylori isolates have been reported, including vacuolating cytotoxin A (VacA) [23], cytotoxin-associated A (CagA) [23], restriction endonuclease A (IceA) [24], outer inflammatory protein A (OipA) [25], and blood-group antigen-binding adhesin (BabA2) [25]. Among the most efficient ways for studying relationships between H. pylori strains from diverse samples is genotyping using the virulence genes (cagA, vacA, babA2, oipA, and iceA) [15].
H. pylori is known to be prevalent in Iran. According to a systematic review and meta-analysis published in 2020, the overall prevalence of H. pylori infection in Iran was found to be 54% [26]. The prevalence varied across different regions of Iran, with higher rates reported in the northern and western regions. Several risk factors have been associated with H. pylori infection in Iran, including poor sanitation, low socioeconomic status, and low education level. Contaminated water and food, including poultry meat, have also been identified as potential sources of infection [27]. However, there have been insufficient published studies on antibiotic resistance of H. pylori obtained from edible and inedible raw poultry (chicken, turkey, quail, goose and ostrich) in Iran. Thus, the present study aims to characterize H. pylori strains by using virulence genes as markers and to assess the resistance profiles of the isolates.

2. Materials and Methods

2.1. Sampling

From April to July 2020, 320 raw poultry samples, including chicken (n = 60), turkey (n = 55), quail (n = 65), goose (n = 65), and ostrich (n = 75), were randomly collected from a slaughterhouse in the Shahrekord region, Iran. The sample size was determined using the Schwartz [18] formula n = z 2   ×   p   ×   q d 2 , where n = required sample size; p = prevalence; p = 0.54; q = 1 − p; z = confidence level according to the centered reduced normal distribution (for a confidence level of 95%, z = 1.96); and d = margin of error tolerated for this study is 0.05. Therefore, n = 382. Samples (40 g) were collected from breast, livers, and gizzards, including the jejunum, cecum, and colon. All samples were stored in a specific sterile Ziploc bag (Sc Johnson) that was water-resistant and transported in a cool chain (at 4 °C) to the laboratory within 2 h after collection.

2.2. Colony Morphology, Gram-Staining and Biochemical Analysis of H. pylori

For the isolation of H. pylori, 25 g of each sample was suspended in 225 mL of Brucella broth supplemented with 5% sheep defibrinated blood and DENT selective supplement (Oxoid, Hampshire, UK). After incubation at 37 °C for 48 h under a microaerophilic condition using BBL GasPak™ jars (Becton Dickinson, Franklin Lakes, NJ, USA), supplemented with CampyGen bags (Oxoid, Hampshire, UK) 100 µL of the mixture was inoculated onto Columbia blood agar base (Oxoid, Hampshire, UK), supplemented with 5% sheep blood and DENT selective supplements, and then incubated for 5–7 days under a microaerophilic condition. Suspected colonies were further identified using Gram staining (Gram-negative for Helicobacter spp.), oxidase (positive for Helicobacter spp.), urease (positive for H. pylori), and nitrate reduction (positive for H. pullorum) tests.

2.3. Genotypical Identification of H. pylori by 16S rRNA-Based PCR Confirmation

Subculturing was carried out using Wilkins Chalgren anaerobe medium. Genomic DNA was extracted from bacteria using a DNA extraction kit following the manufacturer’s instructions (Cinna-colon, Iran). The extracted DNA’s quality (A260/A280) and quantity (ng/mL) were then assessed using NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA, USA). The Helicobacter genus was identified by targeting 16S rRNA (Table 1). The oligonucleoide sequence was approved by the Lactofeed Biotech Group (Iran). A PCR thermal cycler (Eppendorf Co., Hamburg, Germany) was used to execute the polymerase chain reaction (PCR) according to the conditions described by the author for the used gene sequences [28]. Segments of the 16S rRNA gene were analyzed by PCR amplification. PCR conditions were as follows: an initial denaturation (94 °C, 5 min), followed by 40 cycles of denaturation (94 °C, 30 s), annealing (50 °C, 1 min), and extension (72 °C, 2 min), with a final extension (72 °C, 8 min). H. pylori ATCC 700392 strain and distilled water were used as positive and negative controls, respectively.

2.4. H. pylori Antibiotic Susceptibility Pattern

There seem to be no generally recognized standardized methods for checking H. pylori antibiotic susceptibilities; therefore, the procedures shown in this research were based on Ranjbar et al. [2] and Performance Standards for Antibiotic Susceptibility Testing, Clinical and Laboratory Standards Institute, 30th ed CLSI supplement M100. To inoculate Muller–Hinton agar plates, bacterial solutions were diluted to the 0.5 Mcfarland (equal to 1–2 × 108 CFU/mL). The current study employed antibiotic discs with varied doses to investigate the in vitro susceptibility of H. pylori isolates to antibiotics routinely used for treating H. pylori [29,30]. Antimicrobial discs (amoxicillin (10 μg), ampicillin (10 μg), metronidazole (5 μg), streptomycin (10 μg), cefsulodin (30 μg), erythromycin (5 μg), levofloxacin (5 μg), trimethoprim (25 μg), furazolidone (1 μg), clarithromycin (2 μg), rifampin (30 μg), tetracycline (30 μg), and spiramycin (100 μg) (Mast, UK) were used, and the plates were incubated at 35 °C for 16–18 h under anaerobic conditions. The standard technique was used to assess and analyze the inhibition zone induced by each antibiotic following European Committee on Antimicrobial Susceptibility Testing instructions (2020). H. pylori ATCC 26695 and ATCC 43504 were used as quality management isolates. Ayandele et al. (2020) [31] proposed the following calculation to calculate the Multiple Antibiotic Resistance score (MAR) index of each strain:
Table
Table 1. Oligonucleotide sequences, product length and cycling conditions of H. pylori virulence genotypes.
Table 1. Oligonucleotide sequences, product length and cycling conditions of H. pylori virulence genotypes.
Target GeneOligonucleotide Sequence (5′–3′)Size (bp)Annealing Temperature (°C)Authors
16S rRNAF: CTATGACGGGTATCCGGC
R: ATTCCACCTACCTCTCCCA		37553[28]
VacAs1aF: CTCTCGCTTTAGTAGGAGC
R: CTGCTTGAATGCGCCAAAC		21364[32]
s1bF: AGCGCCATACCGCAAGAG
R: CTGCTTGAATGCGCCAAAC		18764[32]
s1cF: CTCTCGCTTTAGTGGGGYT
R: CTGCTTGAATGCGCCAAAC		21364[32]
s2F: GCTAACACGCCAAATGATCC
R: CTGCTTGAATGCGCCAAAC		19964[32]
m1aF: GGTCAAAATGCGGTCATGG
R: CCATTGGTACCTGTAGAAAC		29064[32]
m1bF: GGCCCCAATGCAGTCATGGA
R: GCTGTTAGTGCCTAAAGAAGCAT		29164[32]
m2F: GGAGCCCCAGGAAACATTG
R: CATAACTAGCGCCTTGCA		35264[32]
CagACagAF: GATAACAGCCAAGCTTTTGAGG
R: CTGCAAAAGATTGTTTGGCAGA		30056[32]
IceAIceA1F: GTGTTTTTAACCAAAGTATC
R: CTATAGCCATYTCTTTGCA		24756[33]
IceA2F: GTTGGGTATATCACAATTTAT
R: TTCCCTATTTTCTAGTAGGT		22956[33]
OipAF: GTTTTTGATGCATGGGATTT
R: GTGCATCTCTTATGGCTTT		40156[33]
BabA2F: CCAAACGAAACAAAAAGCGT
R: GCTTGTGTAAAAGCCGTCGT		10557[34]
MAR index = number of antimicrobial drugs to which the bacterium is resistant/total number of antimicrobial drugs.

2.5. Genotyping Analysis

Multiplex-PCR was used to determine the prevalence of cagA, vacA, babA2, oipA, and iceA alleles [25,35,36,37]. The primers and PCR conditions used to genotype cagA, vacA, babA2, oipA, and iceA alleles are listed in Table 1. Initially, all samples were subjected to pre-tests to determine the best reaction time, temperature, and volume. In all PCR operations, a programmed DNA thermo-cycler was employed. Positive and negative controls were H. pylori standard strains (ATCC 43504) and PCR-grade water, respectively. A total volume of 25 µL was used, consisting of 5 µL of deoxy–nucleoside triphosphate mix, 2.5 µL of 10× PCR buffer, 0.25 µL of the primer, and 1 µL of the DNA template. Ethidium bromide was used to dye ten microliters of PCR product electrophoresed in a 2 percent agarose gel in 1× TBE buffer at 80 V for 30 min. For image processing, UVI doc gel documentation devices (Grade GB004, Jencons PLC, London, UK) were used.

2.6. Analytical Statistics

The International Business Machines Corporation (IBM) Statistical Package for Social Sciences (SPSS) software (version 20.0 for Windows) was used to conduct the statistical study. The information was given in the form of a mean, standard deviation, or percentages.

3. Results

3.1. Helicobacter spp. Prevalence in Poultry Based on Morphological and Biochemical Analysis

The presence of H. pylori was evaluated in 320 samples of poultry meat (Table 2). Helicobacter spp. were found in 20 of 320 (6.25%) poultry meat specimens. According to our findings, nine (15.00 %) chicken samples, seven (12.72 %) turkey samples, zero (0 %) quail samples, zero (0 %) goose samples, and four (5.33 %) ostrich samples were all contaminated with Helicobacter spp.

3.2. Identification of H. pylori with PCR Targeting the 16SrRNA Gene

The 16SrRNA gene PCR amplification was used to confirm all of the strains. The electrophoretically displayed PCR results from 20 H. pylori identified from 320 poultry samples and H. pylori are presented for all cases (100%). According to PCR results, all 20 (100%) isolates belonged to H. pylori. The largest prevalence of H. pylori bacteria was found in chicken (15.00%) and turkey (12.72%) meat samples, while no prevalence was found in quail and goose (0.00%).

3.3. H. pylori Sensitivity to Antibiotics and the MAR Index

Antimicrobial resistance profiles of H. pylori isolates recovered from various origins collected are depicted in Table 3. Antimicrobial resistance was found to be most common against ampicillin (85%), tetracycline (85%), and amoxicillin (75%). H. pylori isolates also had the lowest rate of resistance to furazolidone (5%), spiramycin (30%), cefsulodin (30%), and levofloxacin (30%). Furthermore, resistance to metronidazole (50%) and streptomycin (50%) was common, as it was resistant to erythromycin and rifampicin (40%), as well as trimethoprim and clarithromycin (35%). The results show that 17/20 (85%) of the H. pylori isolates obtained from poultry samples were resistant to at least three antibiotics from different classes (multi-drug resistant or MDR isolates). The average MAR index of the 20 H. pylori isolates recovered from poultry meat was 0.622 (Table 4). Seventeen of the twenty H. pylori isolates tested positive for antibiotic resistance (MDR phenotype), with MAR indexes varying from 0.230 to 1. Isolates 1 and 2 were highly resistant to all antibacterial agents (MAR index of 1.0), whereas isolates 3–5 were resistant to 12 of the 13 tested antibiotics (MAR index of 0.923). The MAR index for strains 6–7 was 0.846. The MAR scores for isolates 8–17 ranged from 0.23 to 0.769, and isolates 19 and 20 had the lowest MAR score (0.076). The number of H. pylori isolates with a MAR value more than 0.2 was 17/20 (85%); the frequency with a MAR value less than 0.2 was 3/20 (15%). We therefore conclude that H. pylori is extremely resistant to numerous evaluated antibacterial drugs and has large MAR index values.

3.4. Genotype Distribution among H. pylori Isolates Obtained from Various Origins or Poultry Samples

The genotype distribution of H. pylori isolates recovered from various samples is shown in Table 5. The most commonly found genotypes among the H. pylori bacteria isolates recovered from poultry raw meat were vacA s1a (75 %), m1a (75 %), s2 (70 %) and m2 (65 %), and cagA (60 %). The H. pylori isolates identified from several sorts of poultry samples with the lowest frequency were vacA s1c (5%) and iceA2 (15%). vacAs1b, vacAm1b, and oipA genes were also found in 25% of H. pylori strains from various poultry specimens. iceA1 and babA2 genes were distributed in 40% of the population.

3.5. Genotyping Patterns of H. pylori Strains

The genotyping frequency of H. pylori isolates recovered from the various poultry samples is shown in Table 6. The most commonly found vacA genotypes of H. pylori bacteria originating from the different poultry samples were s1am1a (45%), s2m1a (45%), and s2 m2 (30%). babA2, oipA+, and oipA- genotypes were seen in 40%, 30%, and 30%, respectively. We detected that iceA1/iceA2 genotyping was present in 10% of H. pylori isolates. Among the diverse genotyping profiles of H. pylori isolates, s1cm1b (0%), s1 cm2 (5%), s1cm1a (5%), and cagA+ (5%) exhibited the lowest frequency. The distribution of other genotypes, including s1am1b (15%), s1 am2 (25%), s1bm1a (15%), s1bm1b (10%), s1bm2 (10%), s2m1b (15%), cagA- (25%), babA2+ (25%) and iceA1/iceA2 (10%), was moderate.

4. Discussion

Data on the epidemiological role of poultry as a vehicle of H. pylori are very scarce. The present study aimed to investigate the frequency and molecular characteristics of H. pylori strains isolated from raw poultry meat. In the present study, 20 (6.25 %) H. pylori strains were recovered from 320 poultry samples, indicating that this bacterium poses a risk to humans. Although the root cause of such a finding is unknown, the cross-contamination of poultry meat is considered a major source of H. pylori infection in the poultry meat industry. The three primary operations that may increase the incidence of H. pylori infection include cutting, keeping, and shipping poultry meat. Furthermore, in a separate study, Ranjbar et al. [2] found that H. pylori can survive in water [2]. Therefore, an additional cause of H. pylori occurrence in the obtained poultry sample is the use of contaminated water in the meat industry. Furthermore, contaminated slaughtering personnel and equipment, such as blades, may contribute to a higher prevalence of this pathogen [38]. Generally, our findings are similar to those of Meng et al. (2008), who used multiplex-PCR to analyze 11 fresh chicken specimens (total chicken including skin), identifying that 4 (36%) were H. pylori-positive, although the prevalence detected in our study (6.25%) was significantly smaller. H. pylori is also a foodborne organism that may be transferred to humans, according to these investigators [39]. H. pylori is one of the main organisms that causes food poisoning, especially in raw meat products.
El Dairouty et al. (2016) reported that 5% of ground beef, raw chicken, and sandwich meat specimens tested positive for H. pylori [40].
Genomic approaches have subsequently been employed by several studies to discover the various genotypes of H. pylori, which also are strongly connected to its distribution. Multiplex-PCR is a commonly used test for genotyping and identifying homologous genes in H. pylori isolates obtained from clinical specimens [40,41]. The 16S rRNA gene was employed as a reference gene in this investigation. This gene was detected in all isolates, indicating that the 16S rRNA gene is a good candidate for identifying different H. pylori isolates. Similar findings were achieved by Piri-Gharaghie (2018) [7] and El Dairouty et al. (2016) [29,40]. According to these scientists, the 16S rRNA genetic code is a unique gene for recognizing bacterial species recovered from specimens when contrasted to other reference genes. Proliferation and cell wall formation in H. pylori are is dependent on the 16S rRNA gene. As a result, this gene has been widely used to diagnose H. pylori infections [41]. Our study looks at the incidence of the virulence genes, iceA, babA2, oipA, vacA, and cagA. In H. pylori isolates collected from edible and non-edible tissues from the poultry meat industry, the IceA (27.5 %), babA2 (40 %), OipA (25 %), vacA (48.57 %), and cagA (60 %) genes were all found. As a result, certain virulence genes, notably cagA, were found in larger numbers in commercial poultry meat. The major impediments of H. pylori in the human digestive system are thought to be increased by these genotypes. Bibi et al. (2017) earlier hypothesized a relationship between the existence of the H. pylori babA2/cagA+/vacAs1 genotype and the prevalence of gastroenteritis, stomach carcinoma, and ulcerative colitis [15]. In H. pylori isolates recovered from clinical specimens of human and animal populations, a high incidence of vacA, cagA, iceA1, oipA, and babA2 genotypes was also found [15,42,43]. Moreover, H. pylori isolates recovered from different sorts of dietary specimens have shown a significant frequency of these genes [44,45]. Previous studies have linked the H. pylori genotypes vacA, cagA, iceA, oipA, and babA2 to interleukin−8 and cytotoxin exudation, attachment to gastric epithelial cells, increase in the frequency of inflammatory impact, vacuolization, apoptosis process in gastric epithelial cells, stomach ulcers ulceration, increased intense neutrophilic incursion [43,44,45,46,47]. The consumption of fresh poultry meat infected with virulent isolates of H. pylori could increase duodenum ulcers, gastric epithelium shrinkage, and stomach carcinoma because the H. pylori strain in this experiment carried the vacA, cagA, iceA, oipA, and babA2 genes. Furthermore, certain H. pylori strains tested positive for multiple genotypes at the same time, indicating that they are potentially more harmful [21].
Another noteworthy result in the ongoing investigation is the high prevalence of antibiotic resistance among H. pylori isolates, which have frequent resistance to antimicrobials ampicillin (85%), tetracycline (85%), and amoxicillin (75%). Our results are consistent with those of Hamada et al. (2018), who found high levels of antimicrobial resistance to amoxicillin, penicillin, oxytetracycline, nalidixic acid, ampicillin and norfloxacin in H. pylori isolates recovered from chicken meat, liver, and gizzards [13]. Similarly, Mashak et al. (2020) found H. pylori strains resistant to tetracycline, erythromycin, levofloxacin and amoxicillin in raw meat [48]. In addition, H. pylori bacteria highly resistant to ampicillin, erythromycin, amoxicillin, tetracycline and clarithromycin were found in samples of meat products by Gilani et al. (2017) [38]. Recently, Elrais et al. (2022) reported the isolation of multidrug resistant H. pylori strains from poultry chicken meat samples [49]. Furthermore, epidemiologic studies in different countries found that H. pylori isolates in healthcare specimens had a high level of resistance to antibiotics such as metronidazole, ampicillin, tetracycline, and amoxicillin, which is consistent with our results [44,45,46,47,50,51]. With a MAR index, 85 % of the H. pylori isolates were resistant for three or more antibiotic medicines employed in the study, indicating a large chance of infection in poultry. Antibiotic resistance may have become more common as a result of the nonselective use of such antibacterial medicines, according to our findings. Many researchers have looked at the incidence of H. pylori resistance to multiple antibiotics, but some researchers ran into problems, notably with the number of isolates studied [52,53]. A low resistance rate of H. pylori isolates to metronidazole (50%), streptomycin (50%), erythromycin (40%), rifampin (40%), trimethoprim (35%), and clarithromycin (35%) was also found in our study. These findings might be attributed to the antibiotic medications being prescribed less often. There has been some speculation about a link between virulence genes and antibiotic resistance. According to research conducted in Ireland in 2009, the lack of cagA could be a potential risk for acquiring metronidazole sensitivity [54]. Other research has linked clarithromycin susceptibility changes to the less pathogenic vacA genotypes [55]. Some other studies identified a link between cagE and vacA S1, as well as clarithromycin and metronidazole susceptibility [56], whereas others reported no link between cagA or vacA and susceptibility [33]. As a result, it is crucial to determine whether there is a link between the existence of pathogenic indicators and antimicrobial resistance within H. pylori isolates.

5. Conclusions

In conclusion, the present study shows cases of H. pylori contamination of raw poultry meat collected from slaughterhouses. Many isolates were also found resistant to antibiotics, including metronidazole and streptomycin, erythromycin, rifampin, trimethoprim, and clarithromycin, often used as antibacterial treatments in a clinical setting. Various virulence profiles were found, with some isolates carrying several virulence genes. Therefore, sanitary measures in slaughterhouses and butchers are critical for reducing the risk of H. pylori infection from poultry meat spreading to humans. Future genome sequencing of isolates will help explain the mechanism of resistance observed and establish the genetic relatedness of the isolates for a better understanding of their epidemiology.

Author Contributions

S.A., Writing the original draft; E.R. and A.S., Writing and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated and/or analyzed during the current study are included in this published article. The datasets used and/or analyzed during this study are also available from the corresponding author on reasonable request.

Acknowledgments

The authors would like to thank the staff members of Biotechnology Research Center of Islamic Azad University of Shahrekord Branch in Iran.

Conflicts of Interest

The authors have no competing interest to declare.

Abbreviations

H. pylori: Helicobacter pylori; H. pullorum: Helicobacter pullorum; H. hepaticus: Helicobacter hepaticus; H. canis: Helicobacter canis; H. bilis: Helicobacter bilis; H. cinaedi: Helicobacter cinaedi; VacA: Vacuolating cytotoxin A; cagA: cytotoxin-associated A; IceA: restriction endonuclease A; OipA: Outer inflammatory protein A; BabA2: blood-group antigen-binding adhesin; MAR: multiple antibiotic resistance.

References

  1. Ranjbar, R.; Khamesipour, F.; Jonaidi-Jafari, N.; Rahimi, E. Helicobacter pylori in bottled mineral water: Genotyping and antimicrobial resistance properties. BMC Microbiol. 2016, 16, 40. [Google Scholar] [CrossRef] [PubMed]
  2. Ranjbar, R.; Farsani, F.Y.; Dehkordi, F.S. Phenotypic analysis of antibiotic resistance and genotypic study of the vacA, cagA, iceA, oipA and babA genotypes of the Helicobacter pylori strains isolated from raw milk. Antimicrob. Resist. Infect. Control 2018, 7, 115. [Google Scholar] [CrossRef] [PubMed]
  3. Ranjbar, R.; Khamesipour, F.; Jonaidi-Jafari, N.; Rahimi, E. Helicobacter pylori isolated from Iranian drinking water: vacA, cagA, iceA, oipA and babA2 genotype status and antimicrobial resistance properties. FEBS Open Bio 2016, 6, 433–441. [Google Scholar] [CrossRef]
  4. Waskito, L.A.; Salama, N.R.; Yamaoka, Y. Pathogenesis of Helicobacter pylori infection. Helicobacter 2018, 23, e12516. [Google Scholar] [CrossRef]
  5. Zarinnezhad, A.; Shahhoseini, M.H.; Piri Gharaghie, T. Evaluating the Relative Frequency of Fungal Infections in the Serum of Patients with Multiple Sclerosis and Healthy Subjects Using PCR. Biol. J. Microorg. 2021, 10, 37–50. [Google Scholar]
  6. Camilo, V.; Sugiyama, T.; Touati, E. Pathogenesis of Helicobacter pylori infection. Helicobacter 2017, 22, e12405. [Google Scholar] [CrossRef] [PubMed]
  7. Piri Gharaghie, T.; Hajimohammadi, S. Comparison of anti-candida effects of aqueous, ethanolic extracts and essential oil of E. angustifolia with fluconazole on the growth of clinical strains of Candida. New Cell. Mol. Biotechnol. J. 2021, 11, 25–38. [Google Scholar]
  8. Khodadadi, M.; Mousavinasab, S.S.; Khamesipour, F.; Katsande, S. The effect of Cichorium intybus L. ethanol extraction on the pathological and biomedical indexes of the liver and kidney of broilers reared under heat stress. Rev. Bras Cienc. Avic. 2016, 18, 407–412. [Google Scholar] [CrossRef]
  9. Baghbaderani, Z.T.; Shakerian, A.; Rahimi, E. Phenotypic and Genotypic Assessment of Antibiotic Resistance of Staphylococcus aureus Bacteria Isolated from Retail Meat. Infect. Drug Resist. 2020, 13, 1339–1349. [Google Scholar] [CrossRef]
  10. Pius, L.O.; Strausz, P.; Kusza, S. Overview of Poultry Management as a Key Factor for Solving Food and Nutritional Security with a Special Focus on Chicken Breeding in East African Countries. Biology 2021, 10, 810. [Google Scholar] [CrossRef]
  11. Smith, D.P. 24 Poultry Processing and Products. Princ. Appl. 2014, 549–566. [Google Scholar] [CrossRef]
  12. Mousavi, R.; Rahimi, E.; Shakerian, A. Incidence and Profiles of Antibiotic Resistance and Virulence Markers of The Escherichia coli O157 Bacteria Recovered from Poultry Meat. Egypt. J. Vet. Sci. 2020, 51, 215–223. [Google Scholar] [CrossRef]
  13. Hamada, M.; Elbehiry, A.; Marzouk, E.; Moussa, I.M.; Hessain, A.M.; Alhaji, J.H.; Heme, H.A.; Zahran, R.; Abdeen, E. Helicobacter pylori in a poultry slaughterhouse: Prevalence, genotyping and antibiotic resistance pattern. Saudi J. Biol. Sci. 2018, 25, 1072–1078. [Google Scholar] [CrossRef]
  14. Wong, J.T.; de Bruyn, J.; Bagnol, B.; Grieve, H.; Li, M.; Pym, R.; Alders, R.G. Small-scale poultry and food security in resource-poor settings: A review. Glob. Food Secur. 2017, 15, 43–52. [Google Scholar] [CrossRef]
  15. Bibi, F.; Alvi, S.A.; Sawan, S.A.; Yasir, M.; Sawan, A.; Jiman-Fatani, A.A.; Azhar, E.I. Detection and genotyping of Helicobacter pylori among gastric ulcer and cancer patients from Saudi Arabia. Pak. J. Med. Sci. 2017, 33, 320. [Google Scholar] [CrossRef]
  16. Cardos, I.A.; Zaha, D.C.; Sindhu, R.K.; Cavalu, S. Revisiting Therapeutic Strategies for H. pylori Treatment in the Context of Antibiotic Resistance: Focus on Alternative and Complementary Therapies. Molecules 2021, 26, 6078. [Google Scholar] [CrossRef] [PubMed]
  17. Doohan, D.; Rezkitha, Y.A.; Waskito, L.A.; Yamaoka, Y.; Miftahussurur, M. Helicobacter pylori BabA–SabA Key Roles in the Adherence Phase: The Synergic Mechanism for Successful Colonization and Disease Development. Toxins 2021, 13, 485. [Google Scholar] [CrossRef]
  18. Mégraud, F. H pylori antibiotic resistance: Prevalence, importance, and advances in testing. Gut 2004, 53, 1374–1384. [Google Scholar] [CrossRef]
  19. Ansari, H.; Doosti, A.; Kargar, M.; Bijanzadeh, M.; Jafarinya, M. Antimicrobial resistant determination and prokaryotic expression of smpA gene of Acinetobacter baumannii isolated from admitted patients. Jundishapur J. Microbiol. 2017, 10, e59370. [Google Scholar] [CrossRef]
  20. Khademi, F.; Poursina, F.; Hosseini, E.; Akbari, M.; Safaei, H.G. Helicobacter pylori in Iran: A systematic review on the antibiotic resistance. Iran. J. Basic Med. Sci. 2015, 18, 2. [Google Scholar]
  21. Alexander, S.M.; Retnakumar, R.J.; Chouhan, D.; Devi, T.N.; Dharmaseelan, S.; Devadas, K.; Thapa, N.; Tamang, J.P.; Lamtha, S.C.; Chattopadhyay, S. Helicobacter pylori in Human Stomach: The Inconsistencies in Clinical Outcomes and the Probable Causes. Front. Microbiol. 2021, 12, 713955. [Google Scholar] [CrossRef] [PubMed]
  22. Öztekin, M.; Yılmaz, B.; Ağagündüz, D.; Capasso, R. Overview of Helicobacter pylori Infection: Clinical Features, Treatment, and Nutritional Aspects. Diseases 2021, 9, 66. [Google Scholar] [CrossRef]
  23. Kishk, R.M.; Soliman, N.M.; Anani, M.M.; Nemr, N.; Salem, A.; Attia, F.; Allithy, A.N.; Fouad, M. Genotyping of Helicobacter pylori virulence genes cagA and vacA: Regional and National Study. Int. J. Microbiol. 2021, 2021, 5540560. [Google Scholar] [CrossRef]
  24. Kisiala, M.; Kowalska, M.; Pastor, M.; Korza, H.J.; Czapinska, H.; Bochtler, M. Restriction endonucleases that cleave RNA/DNA heteroduplexes bind dsDNA in A-like conformation. Nucleic Acids Res. 2020, 48, 6954–6969. [Google Scholar] [CrossRef] [PubMed]
  25. Rizzato, C.; Kato, I.; Plummer, M.; Muñoz, N.; Stein, A.; Jan van Doorn, L.; Franceschi, S.; Canzian, F. Risk of advanced gastric precancerous lesions in Helicobacter pylori infected subjects is influenced by ABO blood group and cagA status. Int. J. Cancer 2013, 133, 315–322. [Google Scholar] [CrossRef]
  26. Moosazadeh, M.; Lankarani, K.B.; Afshari, M. Meta-analysis of the prevalence of Helicobacter pylori infection among children and adults of Iran. Int. J. Prev. Med. 2016, 7, 48. [Google Scholar]
  27. Akhlaghi, H.; Javan, A.J.; Chashmi, S.H.E. Public health significance of Helicobacter pullorum, a putative food-associated emerging zoonotic pathogen in Iran. Comp. Immunol. Microbiol. Infect. Dis. 2022, 87, 101849. [Google Scholar] [CrossRef]
  28. Riley, L.K.; Franklin, C.L.; Hook, R.J.; Besch-Williford, C. Identification of murine helicobacters by PCR and restriction enzyme analyses. J. Clin. Microbiol. 1996, 34, 942–946. [Google Scholar] [CrossRef] [PubMed]
  29. Tohid, G.P.; Shandiz, S.A.S. The Inhibitory Effects of Silver Nanoparticles on Bap Gene Expression in Antibiotic-Resistant Acinetobacter baumanni Isolates using Real-Time PCR. Sci. J. Ilam Univ. Med. Sci. 2018, 26, 175–185. [Google Scholar]
  30. Suzuki, S.; Esaki, M.; Kusano, C.; Ikehara, H.; Gotoda, T. Development of Helicobacter pylori treatment: How do we manage antimicrobial resistance? World J. Gastroenterol. 2019, 25, 1907. [Google Scholar] [CrossRef]
  31. Ayandele, A.A.; Oladipo, E.K.; Oyebisi, O.; Kaka, M.O. Prevalence of Multi-Antibiotic Resistant Escherichia coli and Klebsiella species obtained from a Tertiary Medical Institution in Oyo State, Nigeria. Qatar Med. J. 2020, 2020, 9. [Google Scholar] [CrossRef] [PubMed]
  32. Yamazaki, S.; Yamakawa, A.; Okuda, T.; Ohtani, M.; Suto, H.; Ito, Y.; Yamazaki, Y.; Keida, Y.; Higashi, H.; Hatakeyama, M.; et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J. Clin. Microbiol. 2005, 43, 3906–3916. [Google Scholar] [CrossRef]
  33. Van Doorn, L.J.; Figueiredo, C.; Sanna, R.; Plaisier, A.; Schneeberger, P.; de Boer, W.; Quint, W. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 1998, 115, 58–66. [Google Scholar] [CrossRef] [PubMed]
  34. Proença-Modena, J.L.; Acrani, G.O.; Brocchi, M. Helicobacter pylori: Phenotypes, genotypes and virulence genes. Future Microbiol. 2009, 4, 223–240. [Google Scholar] [CrossRef]
  35. Keikha, M.; Karbalaei, M. EPIYA motifs of Helicobacter pylori cagA genotypes and gastrointestinal diseases in the Iranian population: A systematic review and meta-analysis. New Microbes New Infect. 2021, 41, 100865. [Google Scholar] [CrossRef] [PubMed]
  36. Ghorbani, F.; Gheisari, E.; Dehkordi, F.S. Genotyping of vacA alleles of Helicobacter pylori strains recovered from some Iranian food items. Trop. J. Pharm. Res. 2016, 15, 1631–1636. [Google Scholar] [CrossRef]
  37. Farzi, N.; Yadegar, A.; Aghdaei, H.A.; Yamaoka, Y.; Zali, M.R. Genetic diversity and functional analysis of oipA gene in association with other virulence factors among Helicobacter pylori isolates from Iranian patients with different gastric diseases. Infect. Genet. Evol. 2018, 60, 26–34. [Google Scholar] [CrossRef]
  38. Gilani, A.; Razavilar, V.; Rokni, N.; Rahimi, E. VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran. In Veterinary Research Forum; Faculty of Veterinary Medicine, Urmia University: Urmia, Iran, 2017; Volume 8, p. 75. [Google Scholar]
  39. Meng, X.; Zhang, H.; Law, J.; Tsang, R.; Tsang, T. Detection of Helicobacter pylori from food sources by a novel multiplex PCR assay. J. Food Saf. 2008, 28, 609–619. [Google Scholar] [CrossRef]
  40. El Dairouty, R.K.; Murad, H.A.; El Shenawy, M.A.; Hosny, I.M.; Okda, A.Y.; El Shamy, S.M. Helicobacter pylori and its interrelations with other foodborne pathogenic bacteria in Egyptian meat and some meat products. Curr. Sci. Int. 2016, 5, 139–146. [Google Scholar]
  41. Talimkhani, A.; Mashak, Z. Prevalence and genotyping of Helicobacter pylori isolated from meat, Milk and vegetable in Iran. Jundishapur J. Microbiol. 2017, 10, e14240. [Google Scholar] [CrossRef]
  42. Momtaz, H.; Dabiri, H.; Souod, N.; Gholami, M. Study of Helicobacter pylori genotype status in cows, sheep, goats and human beings. BMC Gastroenterol. 2014, 14, 61. [Google Scholar] [CrossRef]
  43. Dabiri, H.; Jafari, F.; Baghaei, K.; Shokrzadeh, L.; Abdi, S.; Pourhoseingholi, M.A.; Mohammadzadeh, A. Prevalence of Helicobacter pylori vacA, cagA, cagE, oipA, iceA, babA2 and babB genotypes in Iranian dyspeptic patients. Microb. Pathog. 2017, 105, 226–230. [Google Scholar] [CrossRef]
  44. Khaji, L.; Banisharif, G.; Alavi, I. Genotyping of the Helicobacter pylori isolates of raw milk and traditional dairy products. Microbiol. Res. 2017, 8, 43–46. [Google Scholar] [CrossRef]
  45. Hemmatinezhad, B.; Momtaz, H.; Rahimi, E. VacA, cagA, iceA and oipA genotypes status and antimicrobial resistance properties of Helicobacter pylori isolated from various types of ready to eat foods. Ann. Clin. Microbiol. Antimicrob. 2016, 15, 2. [Google Scholar] [CrossRef]
  46. Torkan, S.; Shahreza, M.H. VacA, CagA, IceA and OipA genotype status of Helicobacter pylori isolated from biopsy samples from Iranian dogs. Trop. J. Pharm. Res. 2016, 15, 377–384. [Google Scholar] [CrossRef]
  47. Podzorski, R.P.; Podzorski, D.S.; Wuerth, A.; Tolia, V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn. Microbiol. Infect. Dis. 2003, 46, 83–88. [Google Scholar] [CrossRef]
  48. Mashak, Z.; Jafariaskari, S.; Alavi, I.; Sakhaei Shahreza, M.; Safarpoor Dehkordi, F. Phenotypic and genotypic assessment of antibiotic resistance and genotyping of vacA, cagA, iceA, oipA, cagE, and babA2 alleles of Helicobacter pylori bacteria isolated from raw meat. Infect. Drug Resist. 2020, 13, 257–272. [Google Scholar] [CrossRef]
  49. Elrais, A.M.; Arab, W.S.; Sallam, K.I.; Elmegid, W.A.; Elgendy, F.; Elmonir, W.; Imre, K.; Morar, A.; Herman, V.; Elaadli, H. Prevalence, Virulence Genes, Phylogenetic Analysis, and Antimicrobial Resistance Profile of Helicobacter Species in Chicken Meat and Their Associated Environment at Retail Shops in Egypt. Foods 2022, 11, 1890. [Google Scholar] [CrossRef] [PubMed]
  50. Mousavi, S.; Dehkordi, F.S. Virulence factors and antibiotic resistance of Helicobacter pylori isolated from raw milk and unpasteurized dairy products in Iran. J. Venom. Anim. Toxins Incl. Trop. Dis. 2015, 20, 1–7. [Google Scholar] [CrossRef] [PubMed]
  51. Yahaghi, E.; Khamesipour, F.; Mashayekhi, F.; Safarpoor Dehkordi, F.; Sakhaei, M.H.; Masoudimanesh, M.; Khameneie, M.K. Helicobacter pylori in vegetables and salads: Genotyping and antimicrobial resistance properties. BioMed Res. Int. 2014, 2014, 757941. [Google Scholar] [CrossRef] [PubMed]
  52. Li, J.; Deng, J.; Wang, Z.; Li, H.; Wan, C. Antibiotic resistance of Helicobacter pylori strains isolated from pediatric patients in Southwest China. Front. Microbiol. 2020, 11, 621791. [Google Scholar] [CrossRef]
  53. Sabbagh, P.; Mohammadnia-Afrouzi, M.; Javanian, M.; Babazadeh, A.; Koppolu, V.; Vasigala, V.R.; Nouri, H.R.; Ebrahimpour, S. Diagnostic methods for Helicobacter pylori infection: Ideals, options, and limitations. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 38, 55–66. [Google Scholar] [CrossRef] [PubMed]
  54. Taneike, I.; Nami, A.; O’connor, A.; Fitzgerald, N.; Murphy, P.; Qasim, A.; O’connor, H.; O’morain, C. Analysis of drug resistance and virulence-factor genotype of Irish Helicobacter pylori strains: Is there any relationship between resistance to metronidazole and cagA status? Aliment. Pharmacol. Ther. 2009, 30, 784–790. [Google Scholar] [CrossRef] [PubMed]
  55. Boyanova, L.; Markovska, R.; Yordanov, D.; Gergova, G.; Mitov, I. Clarithromycin resistance mutations in Helicobacter pylori in association with virulence factors and antibiotic susceptibility of the strains. Microb. Drug Resist. 2016, 22, 227–232. [Google Scholar] [CrossRef]
  56. Ghotaslou, R.; Leylabadlo, H.E.; Asl, Y.M. Prevalence of antibiotic resistance in Helicobacter pylori: A recent literature review. World J. Methodol. 2015, 5, 164. [Google Scholar] [CrossRef] [PubMed]
Table
Table 2. Prevalence of H. pylori in different types of raw poultry meat samples.
Table 2. Prevalence of H. pylori in different types of raw poultry meat samples.
Raw Meat SamplesNo Samples Collectedn (%) of H. pylori Positive SamplesH. pylori 16SrRNA PCR Confirmation (%)
Chicken609 (15.00)9 (15.00)
Turkey557 (12.72)7 (12.72)
Quebec6500
Goose6500
Ostrich754 (5.33)4 (5.33)
Total32020 (6.25) (95%)20 (6.25) (95%)
Table
Table 3. Antibiotic resistance pattern of H. pylori strains isolated from different types of raw poultry meat samples.
Table 3. Antibiotic resistance pattern of H. pylori strains isolated from different types of raw poultry meat samples.
Type of Raw Milk Samples (Number of H. pylori Strains)Number (%) Isolates Resistant to Each Antibiotic
AM10aMet5ER5CLR2AMX 10Tet30Lev5S10RIF30Cef30TRP25FZL1Spi100
Chicken (9)8 (88.88)6 (66.66)4 (44.44)4 (44.44)7 (77.77)7 (77.77)3 (33.33)2 (22.22)3 (33.33)2 (22.22)3 (33.33)2 (22.22)3 (33.33)
Turkey (7)5 (71.42)2 (28.57)3 (42.85)2 (28.57)5 (71.42)7 (100)2 (28.57)7 (100)4 (57.14)4 (57.14)3 (42.85)3 (42.85)3 (42.85)
Ostrich (4)4 (100)2 (50)1 (25)1 (25)3 (75)3 (75)1 (25)1 (25)1 (25)–1 (25)––
Total (20)17 (85)10 (50)8 (40)7 (35)15 (75)17 (85)6 (30)10 (50)8 (40)6 (30)7 (35)5 (25)6 (30)
Table
Table 4. Antimicrobial resistance profile of H. pylori strains (n = 20).
Table 4. Antimicrobial resistance profile of H. pylori strains (n = 20).
No.Antimicrobial Resistance ProfileMAR Index
1AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef30, TRP25, FZL1, Spi1001
2AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef30, TRP25, FZL1, Spi1001
3AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef30, TRP25, FZL10.923
4AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef30, TRP25, FZL10.923
5AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef30, TRP25, FZL10.923
6AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef30, TRP250.846
7AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef30, TRP250.846
8AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef300.769
9AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef300.769
10AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF30, Cef300.769
11AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S10, RIF300.692
12AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S100.615
13AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev5, S100.615
14AM10, Met5, ER5, CLR2, AMX10, Tet30, Lev50.538
15AM10, Met5, ER5, CLR2, AMX100.384
16AM10, Met5, ER5, CLR20.307
17AM10, Met5, ER50.230
18AM10, Met50.153
19AM100.076
20AM100.076
Average0.622
Table
Table 5. Distribution of genotypes amongst the H. pylori strains isolated from different types of raw poultry meat samples.
Table 5. Distribution of genotypes amongst the H. pylori strains isolated from different types of raw poultry meat samples.
Type of Raw Milk Samples (Number of H. pylori Strains)Number (%) Isolates Harbor Each Genotype
VacACagAIceAOipABabA2
s1as1bs1cs2m1am1bm2IceA1IceA2
Chicken (9)7 (77.77)3 (33.33)1 (11.11)6 (66.66)7 (77.77)3 (33.33)6 (66.66)6 (66.66)4 (44.44)2 (22.22)3 (33.33)4 (44.44)
Turkey (7)6 (85.71)2 (28.57)-6 (85.71)6 (85.71)1 (14.28)5 (71.42)5 (71.42)3 (42.85)1 (14.28)2 (28.57)3 (42.85)
Ostrich (4)2 (50)--2 (50)2 (50)1 (25)2 (50)1 (25)1
(25)		--1
(25)
Total (20)15 (75)5 (25)1 (5)14 (70)15 (75)5 (25)13 (65)12 (60)8 (40)3 (15)5 (25)8 (40)
Table
Table 6. Genotyping pattern of H. pylori strains isolated from different types of raw poultry meat samples.
Table 6. Genotyping pattern of H. pylori strains isolated from different types of raw poultry meat samples.
Type of Raw Milk Samples (Number of H. pylori Strains)Genotyping Pattern (%)
s1am1as1am1bs1am2s1bm1as1bm1bs1bm2s1cm1as1cm1bs1cm2s2m1as2m1bs2m2CagA+CagA−IceA1/IceA2OipA+OipA−BabA2+BabA2−
Chicken (9)5 (55.55)2 (22.22)4 (44.44)2 (22.22)1 (11.11)2 (22.22)1 (11.11)–1 (11.11)4 (44.44)2 (22.22)3 (33.33)6 (66.66)3 (33.33)1 (11.11)3 (33.33)6 (66.66)4 (44.44)5 (55.55)
Turkey (7)3 (42.85)1 (14.28)1 (14.28)1 (14.28)1 (14.28)--––3 (42.85)1 (14.28)2 (28.57)3 (42.85)2 (28.57)1 (14.28)2 (28.571)-1 (14.28)2 (28.57)
Ostrich (4)1 (25)–--––-––2 (50)–1 (25)1 (25)-–1 (25)--1 (25)
Total (20)9 (45)3 (15)5 (25)3 (15)2 (10)2 (10)1 (5)-1 (5)9 (45)3 (15)6 (30)10 (5)5 (25)2 (10)6 (30)6 (30)5 (25)8 (40)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Asadi, S.; Rahimi, E.; Shakerian, A. Helicobacter pylori Strains Isolated from Raw Poultry Meat in the Shahrekord Region, Iran: Frequency and Molecular Characteristics. Genes 2023, 14, 1006. https://doi.org/10.3390/genes14051006

AMA Style

Asadi S, Rahimi E, Shakerian A. Helicobacter pylori Strains Isolated from Raw Poultry Meat in the Shahrekord Region, Iran: Frequency and Molecular Characteristics. Genes. 2023; 14(5):1006. https://doi.org/10.3390/genes14051006

Chicago/Turabian Style

Asadi, Sepehr, Ebrahim Rahimi, and Amir Shakerian. 2023. "Helicobacter pylori Strains Isolated from Raw Poultry Meat in the Shahrekord Region, Iran: Frequency and Molecular Characteristics" Genes 14, no. 5: 1006. https://doi.org/10.3390/genes14051006

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop