PLAG1 g.8795C>T Mutation Regulates Early Body Weight in Hu Sheep by Weakening miR-139 Binding
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Primer Designing
2.3. Rapid-Amplification of cDNA Ends (RACE)
2.4. Cloning, Sequencing, and Genotyping
2.5. Real-Time PCR
2.6. Prediction of miRNA Binding Site
2.7. Plasmid Construction
2.8. Transfection and Dual-Luciferase Reporter Assay
2.9. Statistical Analyses
3. Results
3.1. 3′-UTR Identification and Characteristics of Ovine PLAG1 Gene
3.2. SNP Screening in the 3′-UTR of the Ovine PLAG1 Gene
3.3. Effect of g.8795 C>T Mutation on the Post-Transcriptional Activity of the Ovine PLAG1 Gene
3.4. Role of miR-139 in Regulating the Post-Transcriptional Activity of the PLAG1 Gene
3.5. Correlation between miR-139 and PLAG1 Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Goto, T.; Ishikawa, A.; Nishibori, M.; Tsudzuki, M. A longitudinal quantitative trait locus mapping of chicken growth traits. Mol. Genet. Genom. 2019, 294, 243–252. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zhang, X.; Jiang, E.; Yan, H.; Zhu, H.; Chen, H.; Liu, J.; Qu, L.; Pan, C.; Lan, X. InDels within caprine IGF2BP1 intron 2 and the 3′-untranslated regions are associated with goat growth traits. Anim. Genet. 2020, 51, 117–121. [Google Scholar] [CrossRef] [PubMed]
- Parraguez, V.H.; Sales, F.; Peralta, O.A.; Narbona, E.; Lira, R.; De Los Reyes, M.; González-Bulnes, A. Supplementation of Underfed Twin-Bearing Ewes with Herbal Vitamins C and E: Impacts on Birth Weight, Postnatal Growth, and Pre-Weaning Survival of the Lambs. Animals 2020, 10, 652. [Google Scholar] [CrossRef]
- Ajafar, M.H.; Al-Thuwaini, T.M.; Dakhel, H.H. Association of OLR1 gene polymorphism with live body weight and body morphometric traits in Awassi ewes. Mol. Biol. Rep. 2022, 49, 4149–4153. [Google Scholar] [CrossRef]
- Al-Thuwaini, T.M.; Al-Hadi, A.B.A. Association of lamb sex with body measurements in single and twin on the Awassi ewes. Adv. Anim. Vet. Sci. 2022, 10, 1849–1853. [Google Scholar] [CrossRef]
- Kas, K.; Voz, M.L.; Roijer, E.; Astrom, A.K.; Meyen, E.; Stenman, G.; Van De Ven, W.J. Promoter swapping between the genes for a novel zinc finger protein ad β-catenin in pleiomorphic adenomas with t(3;8) (p21;q12) translocations. Nat. Genet. 1997, 15, 170–174. [Google Scholar] [CrossRef] [PubMed]
- Habib, W.A.; Brioude, F.; Edouard, T.; Bennett, J.T.; Lienhardt-Roussie, A.; Tixier, F.; Salem, J.; Yuen, T.; Azzi, S.; Bouc, Y.L.; et al. Genetic disruption of the oncogenic HMGA2-PLAG1-IGF2 pathway causes fetal growth restriction. Genet. Med. 2018, 20, 250–258. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.Q.; Wu, W.; Xu, X.; Huang, L.; Gao, Q.; Chen, H.; Sun, H.; Xia, Y.K.; Sha, J.H.; Wang, X.; et al. miR-141 contributes to fetal growth restriction by regulation PLAG1 expression. PLoS ONE 2013, 8, e58737. [Google Scholar]
- Zheng, J.; Yu, S.; Jiang, Z.C.; Shi, C.X.; Li, J.; Du, X.D.; Wang, H.L.; Jiang, J.Y. Microarray comparison of the gene expression profiles in the adult vs. embryonic day 14 rat liver. Biomed. Rep. 2014, 2, 664–670. [Google Scholar] [CrossRef]
- Hensen, K.; Braem, C.; Declercq, J.; Dyck, F.V.; Dewerchin, M.; Fiette, L.; Denef, C.; Van de Ven, W.J.M. Targeted disruption of the murine PLAG1 proto-oncogene causes growth retardation and reduced fertility. Dev. Growth Differ. 2004, 46, 459–470. [Google Scholar] [CrossRef]
- Li, Z.; Wu, M.; Zhao, H.; Fan, L.; Zhang, Y.; Yuan, T.T.; He, S.; Wang, P.F.; Zhang, Y.H.; Sun, X.Z.; et al. The PLAG1 mRNA expression analysis among genetic variants and relevance to growth traits in Chinese cattle. Anim. Biotechnol. 2020, 31, 504–511. [Google Scholar] [CrossRef] [PubMed]
- Takasugav, A. PLAG1 and NCAPG-LCORL in livestock. Anim. Sci. J. 2016, 87, 159–167. [Google Scholar] [CrossRef]
- Karim, L.; Takeda, H.; Lin, L.; Druet, T.; Arias, J.A.C.; Baurain, D.; Cambisano, N.; Davis, S.R.; Farnir, F.; Grisart, B.; et al. Variants modulating the expression of a chromosome domain encompassing PLAG1 influence bovine stature. Nat. Genet. 2011, 43, 405–413. [Google Scholar] [CrossRef] [PubMed]
- Littlejohn, M.; Grala, T.; Sanders, K.; Walker, C.; Waghorn, G.; Macdonald, K.; Coppieters, W.; Georges, M.; Spelman, R.; Hillerton, E.; et al. Genetic variation in PLAG1 associates with early life body weight and peripubertal weight and growth in Bos taurus. Anim. Genet. 2012, 43, 591–594. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.S.; Go, M.J.; Kim, Y.J.; Heo, J.Y.; Oh, J.H.; Ban, H.; Yoon, D.; Lee, M.H.; Kim, D.; Park, M.; et al. A large-scale genome -wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. Nat. Genet. 2009, 41, 527–534. [Google Scholar] [CrossRef]
- Okada, Y.; Kamatani, Y.; Takahashi, A.; Matsuda, K.; Hosono, N.; Ohmiya, H.; Daigo, Y.; Yamamoto, K.; Kubo, M.; Nakamura, Y.; et al. A genome-wide association study in 19633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. Hum. Mol. Genet. 2010, 19, 2303–2312. [Google Scholar] [CrossRef]
- Fink, T.; Tiplady, K.; Lopdell, T.; Johnson, T.; Snell, R.G.; Spelman, R.J.; Davis, S.R.; Littlejohn, M.D. Functional confirmation of PLAG1 as the candidate causative gene underlying major pleiotropic effects on body weight and milk characteristics. Sci. Rep. 2017, 7, 44793. [Google Scholar] [CrossRef]
- Qiao, R.; Gao, J.; Zhang, Z.Y.; Li, L.; Xie, X.H.; Fan, Y.; Cui, L.L.; Ma, J.W.; Ai, H.; Ren, J.; et al. Genome-wide association analyses reveal significant loci and strong candidate genes for growth and fatness traits in two pig populations. Genet. Sel. Evol. 2015, 47, 17. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, M.; Yuan, J.; Zhou, X.; Xu, S.P.; Liu, B. Association of polymorphisms in NR6A1, PLAG1 and VRTN with the number of vertebrae in Chinese Tongcheng×Large White crossbred pigs. Anim. Genet. 2018, 49, 353–354. [Google Scholar] [CrossRef]
- Li, Y.X.; Zhang, J.; Qian, Y.; Meng, C.C.; Wang, H.L.; Zhong, J.F.; Cao, S.X. A T>G mutation in the NR5A2 gene is associated with litter size in Hu sheep through upregulation of promoter activity by transcription factor MTF-1. Front. Genet. 2019, 10, 1011. [Google Scholar] [CrossRef]
- Gudbjartsson, D.F.; Walters, G.B.; Thorleifsson, G.; Stefansson, H.; Halldorsson, B.V.; Zusmanovich, P.; Sulem, P.; Thorlacius, S.; Gylfason, A.; Steinberg, S.; et al. Many sequence variants affecting diversity of adult human height. Nat. Genet. 2008, 40, 609–615. [Google Scholar] [CrossRef] [PubMed]
- Metzger, J.; Philipp, U.; Lopes, M.S.; Da Camara Machado, A.; Felicetti, M.; Silvestrelli, M.; Distl, O. Analysis of copy number variants by three detection algorithms and their association with body size in horses. BMC Genom. 2013, 14, 487. [Google Scholar] [CrossRef] [PubMed]
- Zhong, J.L.; Xu, J.W.; Wang, J.; Wen, Y.F.; Niu, H.; Zheng, L.; He, H.; Peng, K.; He, P.; Shi, S.Y.; et al. A novel SNP of PLAG1 gene and its association with growth traits in Chinese cattle. Gene 2019, 689, 166–171. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Qu, K.; Jia, P.; Hanif, Q.; Zhang, J.; Chen, N.; Dang, R.; Chen, H.; Huang, B.; Lei, C. A SNP in PLAG1 is associated with body height trait in Chinese cattle. Anim. Genet. 2020, 51, 87–90. [Google Scholar] [CrossRef]
- Xu, W.; He, H.; Zheng, L.; Xu, J.W.; Lei, C.Z.; Zhang, G.M.; Dang, R.H.; Niu, H.; Qi, X.L.; Chen, H.; et al. Detection of 19-bp deletion within PLAG1 gene and its effect on growth traits in cattle. Gene 2018, 675, 144–149. [Google Scholar] [CrossRef]
- Cahyadi, M.; Sukaryo, S.; Dhiaurridho, M.I.; Bramastya, T.A.; Yanti, Y.; Riyanto, J.; Volkandari, S.D.; Sudrajad, P. Association of pleomorphic adenoma gene 1 with body weight and measurement of Bali cattle (Bos javanicus). Vet. World 2022, 15, 782–788. [Google Scholar] [CrossRef]
- Wei, Z.Y.; Wang, K.; Wu, H.; Wang, Z.; Pan, C.Y.; Chen, H.; Lan, X.Y. Detection of 15-bp Deletion Mutation within PLAG1 Gene and Its Effects on Growth Traits in Goats. Animals 2021, 11, 2064. [Google Scholar] [CrossRef]
- Pan, Y.; Wang, M.; Wu, H.; Akhatayeva, Z.; Lan, X.Y.; Fei, P.F.; Mao, C.; Jiang, F.G. Indel mutations of sheep PLAG1 gene and their associations with growth traits. Anim. Biotechnol. 2022, 33, 1459–1465. [Google Scholar] [CrossRef]
- Chaudhuri, K.; Chatterjee, R. MicroRNA detection and target prediction: Integration of computational and experimental approaches. DNA Cell Biol. 2007, 26, 321–337. [Google Scholar] [CrossRef]
- Chen, Y.L.; Zhao, J.F.; Duan, Z.Q.; Gong, T.; Chen, W.; Wang, S.N.; Xu, H.Q. MiR-27b-3p and miR-607 cooperatively regulate BLM gene expression by directly targeting the 3′-UTR in PC3 cells. Mol. Med. Rep. 2019, 19, 4819–4831. [Google Scholar] [CrossRef]
- Ge, G.H.; Yang, D.L.; Tan, Y.; Chen, Y.; Jiang, D.M.; Jiang, A.A.; Li, Q.; Liu, Y.H.; Zhong, Z.J.; Li, X.W.; et al. MiR-10b-5p regulates C2C12 myoblasts proliferation and differentiation. Biosci. Biotechnol. Biochem. 2019, 83, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Teng, M.S.; Hsu, L.A.; Juan, S.H.; Lin, W.C.; Lee, M.C.; Su, C.W.; Wu, S.; Ko, Y.L. A GDF15 3′UTR variant, rs1054564, results in allele-specific translational repression of GDF15 by has-miR- 1233-3p. PLoS ONE 2017, 12, e0183187. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.H.; Li, J.L.; Zhang, X.Y.; Dai, Y.Y.; Yang, N.S.; Bao, Z.Y.; Chen, Y.; Wu, X.S. Exosomal miRNA-181a-5p from the cells of the hair follicle dermal papilla promotes the hair follicle growth and development via the Wnt/β-catenin signaling pathway. Int. J. Biol. Macromol. 2022, 207, 110–120. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.H.; Abdalla, B.A.; Zheng, M.; He, X.M.; Cai, B.L.; Han, P.G.; Ouyang, H.J.; Chen, B.; Nie, Q.H.; Zhang, X.Q. Systematic transcriptome-wide analysis of mRNA-miRNA interactions reveals the involvement of miR-142-5p and its target (FOXO3) in skeletal muscle growth in chickens. Mol. Genet. Genom. 2018, 293, 69–80. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.K.; Guo, Y.H. MiR-139-5p suppresses osteosarcoma cell growth and invasion through regulating DNMT1. Biochem. Biophys. Res. Commun. 2018, 503, 459–466. [Google Scholar] [CrossRef]
- Li, P.; Xiao, Z.W.; Luo, J.J.; Zhang, Y.J.; Lin, L.Z. MiR-139-5p, miR-940 and miR-193a-5p inhibit the growth of hepatocellular carcinoma by targeting SPOCK1. J. Cell. Mol. Med. 2019, 23, 2475–2488. [Google Scholar] [CrossRef]
- Doench, J.G.; Sharp, P.A. Specificity of microRNA target selection in translational repression. Genes Dev. 2004, 18, 504–511. [Google Scholar] [CrossRef]
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef]
- Shi, L.; Li, X.; Wu, Z.Q.; Li, X.L.; Nie, J.; Guo, M.Z.; Mei, Q.; Han, W.D. DNA methylation-mediated repression of miR-181a/135a/302c expression promotes the microsatellite-unstable colorectal cancer development and 5-FU resistance via targeting PLAG1. J. Genet. Genom. 2018, 45, 205–214. [Google Scholar] [CrossRef]
- Abelson, J.F.; Kwan, K.Y.; O’Roak, B.J.; Baek, D.Y.; Stillman, A.A.; Morgan, T.M.; Mathews, C.A.; Pauls, D.L.; Rasin, M.R.; Gunel, M.; et al. Sequence variants in SLITRK1 are associated with Tourette’s syndrome. Science 2005, 310, 317–320. [Google Scholar] [CrossRef]
Number | Gene Name | Primer Sequence (5′–3′) | Annealing Temperature (°C) | Fragment Length (bp) | Useful |
---|---|---|---|---|---|
P1 | PLAG1 | F: ACCCGTTCAGTTCTACCTCAT R: CGTGGTTCCCAGACAAGTC | 56 | 1529 | PCR amplification and SNP identification |
P2 | PLAG1 | F: AGCGCACCAGTATTTGTAGCA R: ACATGGAAATCCGCAGTGATA | 56 | 1131 | PCR amplification and SNP identification |
P3 | PLAG1 | F: GTTTGAGGAGGGAGGGTTTAT R: CTCGACGGTGATTAAAGCAAT | 56 | 658 | PCR amplification and SNP identification |
P4 | PLAG1 | F: CTGCCCGCTCTAGTTTCTAT R: GTCAGCTCTGGCTCATGTTT | 56 | 1256 | PCR amplification and SNP identification |
P5 | PLAG1 | F: TTTGCCGACGTGTTGCTTGT R: CCGAATGGATGCCCAGTTTT | 57 | 1473 | PCR amplification and SNP identification |
P6 | PLAG1 | F: TACAGATGACCCAGAATGAATG R: TGAAAGAGGTGCTATGAGAAAT | 56 | 1599 | PCR amplification and SNP identification |
P7 | PLAG1 | F: TCCCTTGGCATTTACTGTCTG R: ACATTCTGGGCTTGGTTGTTT | 54 | 1032 | PCR amplification and SNP identification |
P8 | PLAG1 | F: CAAACCATTCCACATAAGCATTGCACCAT R: CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT(UPM) | 71 | 519 | 3′ RACE |
P9 | PLAG1 | F: GCAAAGTCCTGGGCTGTT R: CTAATACGACTCACTATAGGGC(shortP) | 56 | 294 | 3′ RACE |
P10 | PLAG1 | F: TGAAGAAGAGCCACAACCAG R: CTTGATGGGCACCGACAC | 58 | 109 | Real-time PCR |
P11 | β-Actin | F: CAGCCATCTTCTTGGGTAT R: CTGTGATCTCCTTCTGCATCC | 60 | 150 | Real-time PCR |
P12 | miR-139 | F: GCCGAGTGGAGACGCGGCCCT R: CCAGCCACAAAAGAGCACAAT | 60 | Real-time PCR | |
P13 | U6 | F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT | 60 | 94 | Real-time PCR |
P14 | Mimics NC | F: UUCUCCGAACGUGUCACGUTT R: ACGUGACACGUUCGGAGAATT | Cell transfection | ||
P15 | miR-139 mimics | F: UGGAGAUACAGCCCUGUUGGAAU R: UCCAACAGGGCUGUAUCUCCAUU | Cell transfection | ||
P16 | Inhibitor NC | F: CAGUACUUUUGUGUAGUACAA | Cell transfection | ||
P17 | miR-139 inhibitor | F: AUUCCAACAGGGCUGUAUCUCCA | Cell transfection | ||
P18 | miR-139 (stem-loop) | CCTGTTGTCTCCAGCCACAAAAGAGCACAATATTTCAGGAGACAACAGGACTCCAAC | Reverse transcription |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Li, Y.-x.; Zhang, J.; Qian, Y.; Meng, C.-h.; Zhong, J.-f.; Cao, S.-x. PLAG1 g.8795C>T Mutation Regulates Early Body Weight in Hu Sheep by Weakening miR-139 Binding. Genes 2023, 14, 467. https://doi.org/10.3390/genes14020467
Wang Y, Li Y-x, Zhang J, Qian Y, Meng C-h, Zhong J-f, Cao S-x. PLAG1 g.8795C>T Mutation Regulates Early Body Weight in Hu Sheep by Weakening miR-139 Binding. Genes. 2023; 14(2):467. https://doi.org/10.3390/genes14020467
Chicago/Turabian StyleWang, Yue, Yin-xia Li, Jun Zhang, Yong Qian, Chun-hua Meng, Ji-feng Zhong, and Shao-xian Cao. 2023. "PLAG1 g.8795C>T Mutation Regulates Early Body Weight in Hu Sheep by Weakening miR-139 Binding" Genes 14, no. 2: 467. https://doi.org/10.3390/genes14020467