Next Article in Journal
Identification and Regulatory Network Analysis of Genes Related to Reproductive Performance in the Hypothalamus and Pituitary of Angus Cattle
Next Article in Special Issue
Ethylene Plays a Dual Role during Infection by Plasmodiophora brassicae of Arabidopsis thaliana
Previous Article in Journal
Transcriptome Analysis Reveals Altered Expression of Genes Involved in Hypoxia, Inflammation and Immune Regulation in Pdcd10-Depleted Mouse Endothelial Cells
Previous Article in Special Issue
Phenotyping Mediterranean Durum Wheat Landraces for Resistance to Zymoseptoria tritici in Tunisia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 13
Issue 6
10.3390/genes13060964
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development

by
Harbans S. Bariana
1,*,
Prashanth Babu
1,2,
Kerrie L. Forrest
3,
Robert F. Park
1 and
Urmil K. Bansal
1
1
Plant Breeding Institute, School of Life and Environmental Sciences, Faculty of Science, The University of Sydney, 107 Cobbitty Road, Cobbitty, NSW 2570, Australia
2
Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
3
AgriBio, Centre for AgriBioscience, Agriculture Victoria, 5 Ring Road, Bundoora, VIC 3083, Australia
*
Author to whom correspondence should be addressed.
Genes 2022, 13(6), 964; https://doi.org/10.3390/genes13060964
Submission received: 13 April 2022 / Revised: 21 May 2022 / Accepted: 23 May 2022 / Published: 27 May 2022
(This article belongs to the Special Issue Coping with Fungal Diseases in Crops: New Advances in Genomics, Breeding and Management)
Browse Figures
Review Reports Versions Notes

Abstract

:
Breeding for leaf rust resistance has been successful worldwide and is underpinned by the discovery and characterisation of genetically diverse sources of resistance. An English scientist, Arthur Watkins, collected pre-Green Revolution wheat genotypes from 33 locations worldwide in the early part of the 20th Century and this collection is now referred to as the ‘Watkins Collection’. A common wheat genotype, Aus27352 from Yugoslavia, showed resistance to currently predominating Australian pathotypes of the wheat leaf rust pathogen. We crossed Aus27352 with a leaf rust susceptible wheat selection Avocet S and a recombinant inbred line (RIL) F6 population of 200 lines was generated. Initial screening at F3 generation showed monogenic segregation for seedling response to leaf rust in Aus27352. These results were confirmed by screening the Aus27352/Avocet S RIL population. The underlying locus was temporarily named LrAW2. Bulked segregant analysis using the 90K Infinium SNP array located LrAW2 in the long arm of chromosome 2B. Tests with molecular markers linked to two leaf rust resistance genes, Lr50 and Lr58, previously located in chromosome 2B, indicated the uniqueness of LrAW2 and it was formally designated Lr82. Kompetitive allele-specific polymerase chain reaction assays were developed for Lr82-linked SNPs. KASP_22131 mapped 0.8 cM proximal to Lr82 and KASP_11333 was placed 1.2 cM distal to this locus. KASP_22131 showed 91% polymorphism among a set of 89 Australian wheat cultivars. We recommend the use of KASP_22131 for marker assisted pyramiding of Lr82 in breeding programs following polymorphism check on parents.

1. Introduction

Leaf rust, caused by Puccinia triticina Eriks. (Pt), is a major disease of wheat (Triticum aestivum L.) in many parts of the world. A recent global survey of the impact of pests and pathogens in wheat rated leaf rust as the most damaging globally [1]. Deployment of host resistance has been and continues to be an effective measure to control rust diseases, including leaf rust [2,3]. Sources of resistance that condition near-complete protection against avirulent pathogen isolates throughout the entire life of the plant are referred to as all stage resistance (ASR), whereas those that provide low to moderate levels of resistance at the post-seedling stages are classified as adult plant resistance (APR). A combination of more than two APR genes is needed to condition commercially acceptable level of resistance [4,5]. Combinations of ASR and APR genes are desirable to achieve durable control of rust pathogens. In the 1980s, two groups of wheat cultivars became popular in north-eastern Australia that were derivatives of cultivars Hartog (Pavon S) and Cook. Hartog carries the resistance gene combination Lr1 and Lr13 and in addition the APR gene Lr46. In contrast, Cook carries ASR gene Lr3a and APR gene Lr34. Leaf rust resistance gene Lr24 was backcrossed into both backgrounds. Lr24 and Sr24 are located on an alien segment and inherit together [6]. Wheat cultivars possessing Lr24 covered approximately 28% and 20% of 1999 and 2000 crop season receivals by the Australian Wheat Board in eastern Australia, respectively [7]. Similarly, backcross derivatives of cultivars Cook and Hartog with leaf rust resistance gene Lr37 covered 33.2% and 21.2% receivals in Queensland and New South Wales, respectively, during the 1999 crop season [7].
Despite evolution among Pt populations, the leaf rust resistance gene combination Lr1 and Lr13 remained effective for a long time in Australia [8]. The introduction of Pt pathotype 104-(2),3,(6),(7),11 in 1984 was not significantly different from previously present pathotypes in terms of pathogenicity on Australian wheat cultivars [9]. It did however evolve to render Lr24 [10] and Lr37 [11] ineffective. A putative somatic hybrid pathotype that carried full virulence for Lr1 and partial virulence for Lr13 rendered several hybrid wheats that were heterozygous for these resistance genes susceptible [12]. The Pt pathotype typed as 10-1,3,9,10,11,12 in 2005 was also virulent on genotypes with the Lr1 and Lr13 combination and it led to the discovery of a widely ineffective leaf rust resistance gene Lr73 [13]. Although this pathotype affected some winter wheats, it did not have much effect on spring wheats (H.S. Bariana personal observation). An exotic incursion first detected in 2006, pathotype 76-3,5,7,9,10+Lr37, underwent mutation to give rise to new pathotypes, of which the most significant was one combining virulence for Lr13 and Lr24 and was first detected in 2013 (R.F. Park personal observation). Another exotic pathotype 104-1,3,4,6,7,8,10,12+Lr37 was detected in 2014 and it carried virulence for the gene combination Lr13, Lr27+Lr31 and Lr37 (https://www.sydney.edu.au/content/dam/corporate/documents/sydney-institute-of-agriculture/research/plant-breeding-and-production/cereal_rust_report_2016_14_6.pdf (accessed on 20 May 2022). Another significant pathotype 104-1,3,5,7,9,10,12+Lr37 was first detected in 2016 and in the years since has been the most commonly isolated pathotype of Pt in Australia (R.F. Park personal observation).
Eighty-one leaf rust resistance loci have been formally named [14]. Most of these genes belong to the ASR category and follow the gene-for-gene hypothesis [15,16]. Virulence shifts in Pt populations have reduced the effectiveness of several leaf rust resistance genes [17,18], and in some cases has allowed the recycling of defeated genes due to their resistance to newly evolved/exotic pathotypes and the concurrent decline of older pre-existing pathotypes. For example, Lr23 was ineffective to dominant pre-1984 Pt pathotypes in Australia, and the 1984 exotic introduction 104-(2),3,(6),(7),11 and its derivatives carry partial virulence for this gene (https://www.sydney.edu.au/content/dam/corporate/documents/sydney-institute-of-agriculture/research/plant-breeding-and-production/cereal_rust_report_2012_vol_10_3.pdf (accessed on 20 May 2022)). Virulence for Lr23 has been rare or absent in Australia since 2004 (R.F. Park personal observation). These pathotypic changes stress the need for continuous discovery and characterisation of APR and ASR loci from diverse germplasm (landraces and wheat wild relatives) collections for sustained wheat production [19].
A set of 838 pre-Green Revolution common wheat landrace genotypes, referred to as the ‘Watkins Collection’ [20], was available in Australia at the Australian Winter Cereal Collection, Tamworth, New South Wales (now Australian Grains Genebank, Horsham, VIC, Australia). These genotypes were screened for leaf rust response at the adult plant growth stages in artificially inoculated leaf rust field nurseries and at seedling growth stages under greenhouse conditions. Entry Aus27352, originally collected from Yugoslavia, showed resistance to the currently predominant Pt pathotypes including 104-1,3,4,6,7,8,10,12+Lr37. This investigation covers mode of inheritance, molecular mapping and identification of markers closely linked with ASR to leaf rust in Aus27352.

2. Materials and Methods

2.1. Development of a Mapping Population

Aus27352 was crossed with the wheat selection Avocet S (AvS) and an F2:6 recombinant inbred line (RIL) population was developed using the single head descent method. Briefly, a single head was harvested from each plant from the F2 generation onwards and two seeds from each family were planted in the F3, F4 and F5 generations and a single head was harvested from each family. The whole plant was harvested at the F6 generation to generate 200 F2:6 RILs.

2.2. Seedling Tests

Six sets of parental lines Aus27352 and AvS (8–10 seeds) were sown following the procedure described by Qureshi et al. [21]. Ten to twelve day-old seedlings were inoculated with Pt pathotypes 104-2,3,6,(7) (Plant Breeding Institute culture no. 231), 10-1,2,3,4 (348), 104-1,(2),3,(6),(7),11,13 (547), 10-1,3,9,10,11,12 (592); 104-1,3,4,6,7,8,10,12+Lr37 (634); and 76-3,5,7,9,10,12,13 +Lr37 (625) and incubated for 24 h in a room with 100% humidity before moving to temperature and irrigation-controlled microclimate rooms set at 25 °C. Twenty seeds of each Aus27352/AvS F3 line were sown as a single line per pot using the potting mixture outlined in Qureshi et al. [21] and the Aus27352/AvS RIL population was sown as four lines per pot, 10 seeds per line and inoculated with Pt pathotype 104-1,3,4,6,7,8,10,12+Lr37. Variation in leaf rust responses was scored following a scale described in McIntosh et al. [6].

2.3. Molecular Mapping

Genomic DNA was extracted from parents and the entire RIL population using a modified CTAB method [22]. DNA was quantified with the Nanodrop 1000 (Thermofisher Technologies, Inc., Waltham, MA, USA) and quality of DNA was tested by agarose gel electrophoresis. Equal amounts of DNA were pooled from 40 homozygous resistant and 40 homozygous susceptible RILs to prepare resistant and susceptible DNA bulks. Both DNA bulks, parental lines and an artificial F1 (DNA from 40 random RILS were mixed in equal quantity) were subjected to genotyping using 90K Infinium SNP array at AgriBio, La Trobe University, Bundoora, VIC, Australia to conduct bulked segregant analysis (BSA). Linked SNPs were converted to Kompetitive Allele Specific PCR (KASP) markers using the software Polymarker (http://www.polymarker.info (accessed on 20 May 2022)). These KASP markers were tested on the entire RIL population following a procedure described by Nsabiyera et al. [23].

2.4. Statistical Analysis

Chi-squared (χ2) analyses were performed to check the goodness-of-fit of the observed leaf rust response and marker loci segregation to the expected genetic ratios. Recombination fractions were computed using MapDisto [24]. A genetic linkage map was drawn using MapChart software version 2.3 [25] to show the graphical representation of locus order.

3. Results

Aus27352 and AvS were tested with six Pt pathotypes at the seedling stage and results are presented in Table 1. Aus27352 was susceptible to four pathotypes, and resistant to pathotypes 104-1,3,4,6,7,8,10,12+Lr37 (IT “;11+c”) and 76-3,5,7,9,10,12,13+Lr37 (IT “11-”), whereas AvS produced ITs “3+” against pathotypes 104-1,3,4,6,7,8,10,12+Lr37 and 76-3,5,7,9,10,12,13+Lr37. The low infection type (IT “23-”) produced by AvS against pathotypes 104-2,3,6,(7); 10-1,2,3,4 and 104-1,(2),3,(6),(7),11,13 was conditioned by leaf rust resistance gene Lr13 and IT “;” against 10-1,3,9,10,11,12 was due to the presence of Lr73. Aus27352/AvS F1 seedlings produced susceptible infection types when inoculated with pathotype 104-1,3,4,6,7,8,10,12+Lr37 indicating a recessive mode of inheritance. Due to a smaller quantity of seed for 30 Aus27352/AvS-derived F3 lines, only 170 lines were tested and monogenic segregation (36 homozygous resistant: 85 segregating: 49: homozygous susceptible, χ2(1:2:1) = 1.99; non-significant at p = 0.05 and 2 d.f.) for leaf rust resistance was observed. Resistant and susceptible seedlings were counted among 85 segregating families and a recessive mode of inheritance was confirmed (361 resistant: 1152 susceptible, χ2(1:3) = 1.08; non-significant at p = 0.05 and 1 d.f.). The Aus27352/AvS RIL population was tested with pathotype 104-1,3,4,6,7,8,10,12+Lr37 and segregation at a single locus (homozygous resistant 88: homozygous susceptible 112, χ2(1:1) = 2.88; non-significant at p = 0.05 and 1 d.f.) was confirmed (Table 2). The underlying resistance locus was temporarily named LrAW2.

3.1. Molecular Mapping of LrAW2

BSA with the 90 K Infinium SNP wheat array was performed. Thirty-nine SNPs from the long arm of chromosome 2B differentiated resistant and susceptible bulks. These SNPs spanned the 761,279,407 to 794,886,621 bp region of the Chinese Spring physical map (IWGSC RefSeq_V2.0). KASP marker assays were designed for these SNPs and were tested on parental lines. Fourteen SNPs that produced clear clusters (Table 3) were genotyped on the entire RIL population. LrAW2 was flanked by KASP_22131 (0.8 cM) on the proximal side (towards centromere) and KASP_11333 (1.2 cM) on the distal side in the long arm of chromosome 2B (Figure 1).

3.2. Testing of Flanking Markers for Polymorphism on a Wheat Panel

Markers KASP_22131 and KASP_11333 were assayed on a set of 89 Australian wheat cultivars to assess their roles in marker assisted selection of LrAW2 in wheat breeding programs. KASP_22131 and KASP_11333 amplified G:G and A:A alleles, respectively, in the resistant parental stock Aus27352 and the alternate alleles in the susceptible parent AvS (Table 4). KASP_22131 was polymorphic in 81 cultivars and produced the AvS allele (A:A), whereas KASP_11333 was polymorphic in 64 cultivars with the AvS allele (G:G). The amplification of LrAW2-linked allele of the closer marker KASP_22131 occurred in nine cultivars (Correll, Espada, LRPB Kittyhawk, Orion, Chief CL Plus, Gladius, Impose CL Plus, LRPB Arrow and Wedin). Cultivar Correll may carry LrAW2 or another gene with similar pathogenic specificity based on leaf rust response data against several pathotypes. Kittyhawk lacked this gene and the presence of other effective leaf rust resistance genes in the remaining cultivars did not allow postulation of this locus. Taking into consideration the polymorphism, we recommend that KASP_22131 can be used for pyramiding of LrAW2 with other marker-tagged ASR and APR genes for leaf rust resistance.

4. Discussion

Leaf rust is prevalent in almost all wheat growing areas globally [2] and causes widespread and at times severe damage to wheat crops [1]. Most of the race specific genes for leaf rust resistance have been overcome by the evolution in local Pt populations and/or by exotic introductions in Australia [8,11,12]. These events however shaped gene-based control measures for leaf rust. The Australian wheat industry relied on the Lr1 and Lr13 combination, Lr24 was introduced in the 1980s following the development of white-seeded recombinants [6]. It was then supplemented by Lr37 in the 1990s [26]. The value of the APR genes Lr34 and Lr46 became widely evident in the 21st century. These observations led to the realisation that durable leaf rust control could be achieved by combinations of ASR and APR genes [3,27,28].
This study identified a new leaf rust resistance locus LrAW2 in the long arm of chromosome 2B and it is effective against Pt pathotypes 104-1,3,4,6,7,8,10,12 +Lr37 and 76-3,5,7,9,10,12,13 +Lr37, which along with several derivative pathotypes currently prevail in Australia. The markers flanking LrAW2, KASP_21133 and KASP_11333, are located in the 788 and 790 Mb regions of the physical map of Chinese Spring, respectively (IWGSC_RefSeq_v2.0). There are two known leaf rust resistance genes located in the long arm of chromosome 2B, Lr50 [29] and Lr58 [30]. Lr50 was introgressed from T. timopheevi and Lr58 from Aegilops triuncialis. Lr50 (gwm382) and Lr58 (ncw-Lr58-1) linked markers were tested on the parental lines and 22 RILs from the population. Marker gwm382 is a dominant marker and produces 139 bp and none of the test lines produced 139 bp amplicon. The Lr58-linked marker ncw-Lr58-1 is a co-dominant marker and produced about 400 bp amplicon in lines carrying Lr58 and 250 bp in non-carriers. All test lines produced 250 bp products. Both Lr50 and Lr58 follow dominant inheritance, whereas LrAW2 has recessive inheritance. Based on these results LrAW2 is unlikely to be either of these genes. Hence a permanent gene symbol Lr82 was allocated to LrAW2.
Annotated genes located between the markers flanking LrAW2 were extracted from the IWGSC genome assembly of wheat cv. Chinese Spring v1.0 using the tool Pretzel (https://plantinformatics.io (accessed on 20 May 2022). Functional annotations for these genes were obtained from the IWGSC RefSeq data repository at INRA (https://urgi.versailles.inra.fr/download/iwgsc/IWGSC_RefSeq_Annotations/v1.0 (accessed on 20 May 2022). Ninety annotated genes (36 high-confidence and 54 low-confidence) were identified between the two KASP markers that flanked Lr82. Of these, two genes (TraesCS2B01G608500 and TraesCS2B01G608800) are predicted to encode TIR-NBS-LRR disease resistance proteins, based on the IWGSC RefSeq gene annotation. These could be candidate genes for Lr82 (Figure 2).
The ‘Watkins Collection’ has been a rich source of new rust resistance genes that are yet to be deployed in agriculture. Previously leaf rust resistance gene Lr52 was formally named by Canadian workers in a landrace from Iran [31]. Bansal et al. [32] showed close association of Lr52 with a new stripe rust resistance locus Yr47. The Yr47/Lr52 combination is currently being used in Australian and Indian wheat breeding programs (H.S. Bariana personal communication with breeders). Several stripe rust resistance genes have been discovered from this collection [19].
The concept of triple rust resistance is often not addressed holistically, with new cultivars lacking adequate resistance to one or the other of the three rust pathogens [19]. The long arm of chromosome 2B carries several rust resistance genes, two of which that are intriguing from the exotic introduction point of view and can protect Australia against the Puccinia graminis f. sp. tritici pathotype Ug99 and its derivatives are Sr28 [33] and Sr9h [34]. Although both genes are ineffective to extant pathotypes of P. graminis f. sp. tritici in Australia, they would assume importance if one or more of the Ug99 group of pathotypes were to be detected in Australia. Sr9e could be more useful against predominating Australian pathotypes of P. graminis f. sp. tritici. In addition, stem rust resistance genes Sr36 and Sr39 could be useful candidates for pyramiding [35]. Similarly, stripe rust resistance genes Yr5a, Yr5b, Yr43, Yr44, Yr53 and Yr72 are effective against a majority of P. striiformis f. sp. tritici pathotypes and are located in the long arm of chromosome 2B [36,37,38,39]. Development of recombinants carrying combinations of Lr82 with leaf rust, stem rust and stripe rust resistance genes can lead to achievement of durable triple rust resistance.
Markers have been developed for many ASR genes conditioning resistance to leaf rust; Lr23 [40], Lr24 [41], Lr42 [42], Lr52 [21], Lr53 [43], Lr57 [44], Lr76 [44], Lr80 [14] and APR genes Lr34 [45], Lr48 [23], Lr49 [46], Lr67 [47] and Lr68 [48]. These ASR and APR genes can be pyramided in different combinations to combat evolution in Pt populations. In particular, the combination of Lr82 with Lr23 and Lr24 and at least one APR gene would contribute towards long-lasting control of this disease in Australia.

5. Conclusions

This study identified and characterised a new leaf rust resistance gene, Lr82, in the common wheat Yugoslavian landrace Aus27352. Lr82 was mapped 0.8 cM distal to KASP_22131 in the long arm of chromosome 2B. KASP_22131 amplified the allele alternate to that linked with Lr82 in 91% of 89 Australian wheat cultivars. These results support the implementation of KASP_22131 in marker assisted pyramiding of Lr82 with other marker tagged rust resistance genes to achieve durable triple rust control in new wheat cultivars.

Author Contributions

H.S.B. and U.K.B. planned this research and developed mapping population, P.B. screened F3 population and conducted multi-pathotype tests, K.L.F. conducted bulked segregant analysis, U.K.B. developed markers and performed mapping, H.S.B. phenotyped RIL population, U.K.B. and H.S.B. wrote manuscript, K.L.F. and P.B. read it and R.F.P. charactersied all rust isolates used, contributed information on some cultivars and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

Grains Research Development Corporation (GRDC), Australia. Grant: 9176057 and Ministry of Science and Technology, Department of Biotechnology, Government of India. Grant: BT/IACBGF/03/12/2015.

Institutional Review Board Statement

Not applicable for studies not involving humans or animals. This study involved wheat.

Informed Consent Statement

This study did not involve humans and hence consent was not required.

Data Availability Statement

All data are given in the manuscript. Publicly available statistical tools are used in this study.

Acknowledgments

Prashanth Babu thanks Department of Biotechnology, India for Indo-Australian Career Boosting Gold Fellowship to work at the University of Sydney Plant Breeding Institute, Cobbitty as a visiting scientist. The authors acknowledge financial support received from the Grains Research and Development Corporation (GRDC). We thank Akanksha Sharma and Hanif Miah for excellent technical assistance.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430. [Google Scholar] [CrossRef] [PubMed]
  2. Kolmer, J.A. Genetics of resistance to wheat leaf rust. Annu. Rev. Phytopathol. 1996, 34, 435. [Google Scholar] [CrossRef] [PubMed]
  3. Bariana, H.; Brown, G.; Bansal, U.; Miah, H.; Standen, G.; Lu, M. Breeding triple rust resistant wheat cultivars for Australia using conventional and marker-assisted selection technologies. Crop Pasture Sci. 2007, 58, 576. [Google Scholar] [CrossRef]
  4. Bariana, H.S.; McIntosh, R.A. Genetics of adult plant stripe rust resistance in four Australian wheats and the French cultivar Hybride-de-Bersee. Plant Breed. 1995, 114, 485. [Google Scholar] [CrossRef]
  5. Singh, R.; Huerta-Espino, J.; Rajaram, S. Achieving near-immunity to leaf and stripe rust in wheat by combining slow rusting resistance genes. Acta Phytothol. Entomol. Hungrica 2000, 35, 133. [Google Scholar]
  6. McIntosh, R.; Wellings, C.R.; Park, R.F. Wheat Rusts: An Atlas of Resistance Genes; CSIRO Publishing: Melbourne, VIC, Australia, 1995; p. 204. [Google Scholar]
  7. Bariana, H.S.; Cupitt, C.F.; Warburton, T. Diversity of resistance to rust diseases in Australian wheat in 1999 and 2000 crop seasons. In Proceedings of the 10th Wheat Breeding Assembly, Mildura, VIC, Australia, 16–21 September 2001; pp. 230–233. [Google Scholar]
  8. Park, R.F. Long term surveys of pathogen populations underpin sustained control of the rust diseases of wheat. Aust. J. R. Soc. N. S. W. 2015, 148, 15. [Google Scholar]
  9. Park, R.F.; Burdon, J.J.; McIntosh, R.A. Studies on the origin, spread, and evolution of an important group of Puccinia recondita f. sp. tritici pathotypes in Australasia. Eur. J. Plant Pathol. 1995, 101, 613. [Google Scholar] [CrossRef]
  10. Park, R.F.; Bariana, H.S.; Wellings, C.R.; Wallwork, H. Detection and occurrence of a new pathotype of Puccinia triticina with virulence for Lr24 in Australia. Aust. J. Agric. Res. 2002, 53, 1. [Google Scholar] [CrossRef]
  11. Park, R.F. Breeding cereal for rust resistance in Australia. Plant Pathol. 2008, 57, 591. [Google Scholar] [CrossRef]
  12. Park, R.F.; Burdon, J.J.; Jahoor, A. Evidence for somatic hybridisation in the leaf rust pathogen of wheat (Puccinia recondita f. sp. tritici). Mycol. Res. 1999, 103, 715. [Google Scholar] [CrossRef]
  13. Park, R.F.; Mohler, V.; Nazari, K.; Singh, D. Characterisation and mapping of gene Lr73 conferring seedling resistance to Puccinia triticina in common wheat. Theor. Appl. Genet. 2014, 127, 2041. [Google Scholar] [CrossRef] [PubMed]
  14. Kumar, S.; Bharadwaj, S.C.; Gangwar, O.P.; Sharma, A.; Qureshi, N.; Kumaran, V.V.; Khan, H.; Prasad, P.; Miah, H.; Singh, G.P.; et al. Lr80—A new and widely effective source of leaf rust resistance of wheat to enhance diversity of resistance among modern cultivars. Theor. Appl. Genet. 2021, 134, 849. [Google Scholar] [CrossRef] [PubMed]
  15. Flor, H.H. Genetics of pathogenicity in Melampsora lini. J. Agric. Res. 1946, 73, 335. [Google Scholar]
  16. Samborski, D.J.; Dyck, P.L. Inheritance of virulence in wheat leaf rust on the standard differential wheat varieties. Can. J. Genet. Cytol. 1968, 10, 24. [Google Scholar] [CrossRef]
  17. Kolmer, J.A. Virulence and race dynamics of Puccinia recondita f. sp. tritici in Canada during 1956–1987. Phytopathology 1989, 79, 349. [Google Scholar] [CrossRef]
  18. Pathan, A.K.; Park, R.F. Evaluation of seedling and adult plant resistance to leaf rust in European wheat cultivars. Euphytica 2006, 149, 327. [Google Scholar] [CrossRef]
  19. Bariana, H.S.; Bansal, U.K. Breeding for disease resistance. In Encyclopedia of Applied Plant Sciences; Thomas, B., Murray, B.G., Murphy, D., Eds.; Academic Press: Waltham, MA, USA, 2017; Volume 3, pp. 69–76. [Google Scholar]
  20. Miller, T.E.; Reader, S.M.; Ambrose, M.J. The Watkins wheat collection. Ann. Wheat Newsl. 2000, 46, 172. [Google Scholar]
  21. Qureshi, N.; Bariana, H.; Forrest, K.; Hayden, M.; Keller, B.; Wicker, T.; Faris, J.; Salina, E.; Bansal, U. Fine mapping of the chromosome 5B region carrying closely linked rust resistance genes Yr47 and Lr52 in wheat. Theor. Appl. Genet. 2017, 130, 495. [Google Scholar] [CrossRef]
  22. Bansal, U.K.; Kazi, A.G.; Singh, B.; Hare, R.; Bariana, H.S. Mapping of durable stripe rust resistance in a durum wheat cultivar Wollaroi. Mol. Breed. 2014, 33, 51. [Google Scholar] [CrossRef]
  23. Nsabiyera, V.; Qureshi, N.; Bariana, H.S.; Wong, D.; Forrest, K.L.; Hayden, M.J.; Bansal, U.K. Molecular markers for adult plant leaf rust resistance gene Lr48 in wheat. Mol. Breed. 2016, 36, 1. [Google Scholar] [CrossRef]
  24. Lorieux, M. MapDisto: Fast and efficient computation of genetic linkage maps. Mol. Breed. 2012, 30, 1231. [Google Scholar] [CrossRef]
  25. Voorrips, R. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome 1993, 36, 476. [Google Scholar] [CrossRef] [PubMed]
  27. Singh, D.; Park, R.F.; McIntosh, R.A. Characterisation of wheat leaf rust resistance gene Lr34 in Australian wheats using components of resistance and the linked molecular marker csLV34. Aust. J. Agric. Res. 2007, 58, 1106. [Google Scholar] [CrossRef]
  28. Kolmer, J.A.; Singh, R.P.; Garvin, D.F.; Viccars, L.; William, H.M.; Huerta-Espino, J.H.; Obonnaya, F.C.; Raman, H.; Orford, S.; Bariana, H.S.; et al. Analysis of the Lr34/Yr18 rust resistance region in wheat germplasm. Crop Sci. 2008, 48, 1841. [Google Scholar] [CrossRef] [Green Version]
  29. Brown-Guedira, G.L.; Singh, S.; Fritz, A.K. Performance and mapping of leaf rust resistance transferred to wheat from Triticum timopheevii subsp. armeniacum. Phytopathology 2003, 93, 784. [Google Scholar] [CrossRef] [Green Version]
  30. Kuraparthy, V.; Sood, S.; Guedira, G.B.; Gill, B. Development of a PCR assay and marker-assisted transfer of leaf rust resistance gene Lr58 into adapted winter wheats. Euphytica 2011, 180, 227. [Google Scholar] [CrossRef]
  31. Hiebert, C.; Thomas, J.; McCallum, B. Locating the broad-spectrum wheat leaf rust resistance gene Lr52 (LrW) to chromosome 5B by a new cytogenetic method. Theor. Appl. Genet. 2005, 110, 1453. [Google Scholar] [CrossRef]
  32. Bansal, U.K.; Forrest, K.L.; Hayden, M.J.; Miah, H.; Singh, H.; Bariana, H.S. Characterization of a new stripe rust resistance gene Yr47 and its genetic association with the leaf rust resistance gene Lr52. Theor. Appl. Genet. 2011, 122, 1461. [Google Scholar] [CrossRef]
  33. Bansal, U.K.; Zwart, R.; Bhavani, S.; Wanyera, R.; Gupta, V.; Bariana, H.S. Microsatellite mapping identifies TTKST-effective stem rust resistance gene in wheat cultivar VL404 Janz. Mol. Breed. 2012, 30, 1757. [Google Scholar] [CrossRef]
  34. Rouse, M.N.; Nirmala, J.; Jin, Y.; Chao, S.; Fetch, T.G., Jr.; Pretorius, Z.A.; Heibert, C.W. Characterization of Sr9h, a wheat stem rust resistance allele effective to Ug99. Theor. Appl. Genet. 2014, 127, 1681. [Google Scholar] [CrossRef] [PubMed]
  35. Chemayek, B.; Bansal, U.K.; Qureshi, N.; Zhang, P.; Wagoire, W.W.; Bariana, H.S. Tight repulsion linkage revealed between Sr36 and Sr39 revealed by genetic, cytogenetic and molecular analyses. Theor. Appl. Genet. 2017, 130, 587–595. [Google Scholar] [CrossRef] [PubMed]
  36. Marchal, C.; Zhang, J.; Zhang, P.; Fenwick, P.; Steuernagel, B.; Adamski, N.M.; Boyd, L.; McIntosh, R.; Wulff, B.B.H.; Berry, S.; et al. BED-domain-containing immune receptors confer diverse resistance spectra to yellow rust. Nat. Plants 2018, 4, 662–668. [Google Scholar] [CrossRef] [PubMed]
  37. Cheng, P.; Chen, X.M. Molecular mapping of a gene for stripe rust resistance in spring wheat cultivar IDO377s. Theor. Appl. Genet. 2010, 121, 195. [Google Scholar] [CrossRef]
  38. Xu, L.S.; Wang, M.N.; Cheng, P.; Kang, Z.; Hulbert, S.; Chen, X. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat. Theor. Appl. Genet. 2013, 126, 523. [Google Scholar] [CrossRef]
  39. Chhetri, M. Molecular Mapping and Genetic Characterization of Rust Resistance in Wheat. Ph.D. Thesis, University of Sydney, Sydney, NSW, Australia, 2015. [Google Scholar]
  40. Chhetri, M.; Bariana, H.; Wong, D.; Sohail, Y.; Hayden, M.; Bansal, U.K. Development of robust molecular markers for marker-assisted selection of leaf rust resistance gene Lr23 in common and durum wheat breeding programs. Mol. Breed. 2017, 37, 21. [Google Scholar] [CrossRef]
  41. Mago, R.; Bariana, H.S.; Dundas, I.S.; Spielmeyer, W.; Lawrence, G.J.; Pryor, A.J.; Ellis, J.G. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor. Appl. Genet. 2005, 111, 496. [Google Scholar] [CrossRef]
  42. Liu, Y.; Chen, H.; Li, C.; Zhang, L.; Shao, M.; Pang, Y.; XU, X.; Bai, G. development of disgnostic markers for a wheat leaf rust resistance gene Lr42 using RNA-sequencing. Crop J. 2021, 9, 1357. [Google Scholar] [CrossRef]
  43. Dadkhodaie, N.A.; Karaoglou, H.; Wellings, C.R.; Park, R.F. Mapping genes Lr53 and Yr35 on the short arm of chromosome 6B of common wheat with microsatellite markers and studies of their association with Lr36. Theor. Appl. Genet. 2011, 122, 479. [Google Scholar] [CrossRef]
  44. Bansal, M.; Adamski, N.M.; Toor, P.I.; Kaur, S.; Sharma, A.; Srivastava, P.; Bansal, U.; Uauy, C.; Chhuneja, P. A robust KASP marker for selection of four pairs of linked leaf rust and stripe rust resistance genes introgressed on chromosome arm 5DS from different wheat genomes. Mol. Biol. Rep. 2021, 48, 5209. [Google Scholar] [CrossRef]
  45. Lagudah, E.; McFadden, H.; Singh, R.; Huerta-Espino, J.; Bariana, H.; Spielmeyer, W. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet. 2006, 114, 21. [Google Scholar] [CrossRef] [PubMed]
  46. Nsabiyera, V.; Baranwal, D.; Qureshi, N.; Kay, P.; Forrest, K.; Valárik, M.; Doležel, J.; Hayden, M.J.; Bariana, H.S.; Bansal, U.K. Fine mapping of Lr49 using 90K SNP chip array and flow sorted chromosome sequencing in wheat. Front. Plant Sci. 2020, 10, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Moore, J.W.; Herrera-Foessel, S.; Lan, C.; Schnippenkoetter, W.; Ayliffe, M.; Huerta-Espino, J.; Lillemo, M.; Viccars, L.; Milne, R.; Periyannan, S. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat. Genet. 2015, 47, 1494. [Google Scholar] [CrossRef] [PubMed]
  48. Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; Rosewarne, G.M.; Periyannan, S.K.; Viccar, L.; Calvo-Salazar, V.; Lan, C.; Lagudah, E.S. Lr68: A new gene conferring slow rusting resistance to leaf rust in wheat. Theor. Appl. Genet. 2012, 124, 1475. [Google Scholar] [CrossRef] [PubMed]
Genes 13 00964 g001 550
Figure 1. Genetic linkage map of Aus27352/AvS RIL population showing the location of LrAW2.
Figure 1. Genetic linkage map of Aus27352/AvS RIL population showing the location of LrAW2.
Genes 13 00964 g001
Genes 13 00964 g002 550
Figure 2. Physical location of annotated genes in the interval containing Lr82. Positions (Mbp) shown refer to the International Wheat Genome Sequencing Consortium (IWGSC) Chinese Spring wheat genome assembly v1.0. Orange marks are high confidence (HC) gene annotations and pink marks are low confidence (LC) gene annotations. The location of flanking KASP markers and two genes predicted to encode TIR-NBS-LRR disease resistance proteins are indicated with triangles.
Figure 2. Physical location of annotated genes in the interval containing Lr82. Positions (Mbp) shown refer to the International Wheat Genome Sequencing Consortium (IWGSC) Chinese Spring wheat genome assembly v1.0. Orange marks are high confidence (HC) gene annotations and pink marks are low confidence (LC) gene annotations. The location of flanking KASP markers and two genes predicted to encode TIR-NBS-LRR disease resistance proteins are indicated with triangles.
Genes 13 00964 g002
Table
Table 1. Responses of parental lines to six pathotypes of P. triticina.
Table 1. Responses of parental lines to six pathotypes of P. triticina.
Pathotype ^Culture Number *Aus27352Avocet S
104-2,3,6,(7)2313+23-
10-1,2,3,43483+23-
104-1,(2),3,(6),(7),11,135473+23-
10-1,3,9,10,11,125923+;
104-1,3,4,6,7,8,10,12+Lr37634;11+c3+
76-3,5,7,9,10,12,13+Lr3762511-3+
^ 1= Lr20, 2 = Lr23, 3 = Lr14a, 4 = Lr15, 5 = Lr3Ka, 6 = Lr27+Lr31, 7 = Lr17a, 8 = Lr28, 9 = Lr26, 10 = Lr13, 11 = Lr16, 12 = Lr17b, 13 = Lr24; Lr37+ denotes virulence for Lr37; the Pt group 104 is virulent on Lr1 and Lr3a; culture 592 is avirulent on Lr73 and virulent on Lr1. Pt group 76 is virulent on Lr3a and Lr13, and avirulent on Lr1. * These numbers represent the unique identity of a purified and confirmed pathotype.
Table
Table 2. Distribution of Aus27352/AvS RIL population when tested with pathotype 104-1,3,4,6,7,8,10,12+Lr37.
Table 2. Distribution of Aus27352/AvS RIL population when tested with pathotype 104-1,3,4,6,7,8,10,12+Lr37.
Leaf Rust ResponseInfection TypeNo. of Linesχ2 (1:1)
ObservedExpected
Homozygous resistant;11+881001.44
Homozygous susceptible3+1121001.44
Total 2002002.88
Table value of χ2 (1:1) at p = 0.05 is 3.84 and 1 d.f.
Table
Table 3. KASP markers used to generate a genetic linkage map of Aus27352/AvS RIL population.
Table 3. KASP markers used to generate a genetic linkage map of Aus27352/AvS RIL population.
MarkerPhysical Distance (bp)Allele 1 aAllele 2 bCommon
KASP_77643785,138,741gagccactgatctgatcacttgagccactgatctgatcactctcgtcggtgtttccctgttt
KASP_5978784,551,365ctgaagcacttcgccccactgaagcacttcgccccggaatctacgacgaggctgc
KASP_48388785,890,263ttgtgtatgtatgttcatttggcattgtgtatgtatgttcatttggcgtctttgtaggttgaaagggct
KASP_78325786,230,653tgacccatactttgcaacacaatgacccatactttgcaacacagacacgtgatggaaaaggttct
KASP_54389786,105,954gacatggcggggtcgactgacatggcggggtcgaccgaactgacgtgagccatgct
KASP_78057786,229,479ttacaacgataaggccaccaattacaacgataaggccaccagcagtgaacttcttcaggcgg
KASP_28691789,608,961cggatttctggacatcgtcacggatttctggacatcgtcgtcaaactttccttgttgttcgtac
KASP_12117788,524,814tccaccatcccgcagcaatccaccatcccgcagcagaggccttggggacacaatcc
KASP_12118788,524,885ccccaaggcctctttcgtccccaaggcctctttcgggccagtttgatgtcgaagagat
KASP_81209788,657,195tggtagtgctgcaaaacgatggtagtgctgcaaaacggggtgttggttactacagcagc
KASP_53122788,655,517gtccaaggccgaggaggatgtccaaggccgaggaggaccctgctcagccaacaccattatg
KASP_22131788,656,700ggctagtgttgtttttgtaccaggctagtgttgtttttgtaccgcatacaggtagcagatacgcaa
KASP_11333790,751,851cacggaaccagactggcacacggaaccagactggcggaacccgttctcagcgaat
KASP_8699793,148,680cagatgatggtggatggtatgtattcagatgatggtggatggtatgtatcatggttgtgggaagcacgaa
a A1 primer labelled with FAM: GAAGGTGACCAAGTTCATGCT; b A2 primer labelled with HEX: GAAGGTCGGAGTCAACGGATT.
Table
Table 4. Genotyping of markers flanking Lr82 for polymorphism on Australian wheat cultivars.
Table 4. Genotyping of markers flanking Lr82 for polymorphism on Australian wheat cultivars.
Cultivars *KASP_22131KASP_11333
Aus27352G:GA:A
Avocet SA:AG:G
AGT Katana, Axe, Baxter, Bolac, Carnamah, Catalina, Chara, Cobra, Corack, Crusader, Dart, Derrimut, EGA Bonnie Rock, EGA Burke, EGA Gregory, EGA Wedgetail, EGA Wylie, Elmore CL PLus, Emu Rock, Envoy, Estoc, Forrest, Gauntlet, Gazelle, GBA Sapphire, Giles, Grenade CL Plus, Harper, Impala, Janz, Justica CL Plus, King Rock, Kord CL Plus, Kunjin, Lancer, Lang, Lincoln, Livingston, LRPB Reliant, Mace, Magenta, Mansfield, Merinda, Preston, SF Adagio, SF Scenario, Shield, Sunco, Sunguard, SunMax, Sunvale, Sunzell, Wallup, Westonia, Wyalkatchem, Wylah, Yandanooka, Yitpi, YoungA:AG:G
Beaufort, Calingiri, Coolah, DS Faraday, EGA Bounty, Fortune, LRPB Flanker, Mackellar, Merlin, Naparoo, Ninja, Phantom, Scout, Sentinel, Spitfire, SQP Revenue, Strzelecki, Suntop, Trojan, Ventura, WaaganA:AA:A
Correll, Espada, LRPB Kittyhawk, OrionG:GA:A
Chief CL Plus, Gladius, Impose CL Plus, LRPB Arrow, WedinG:GG:G
* Leaf rust responses of these cultivars can be viewed at https://www.sydney.edu.au/content/dam/corporate/documents/faculty-of-science/research/life-and-environmental-sciences/cereal-rust-research/cereal-rust-report--2020-vol-17-3.pdf (accessed on 20 May 2022).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Bariana, H.S.; Babu, P.; Forrest, K.L.; Park, R.F.; Bansal, U.K. Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development. Genes 2022, 13, 964. https://doi.org/10.3390/genes13060964

AMA Style

Bariana HS, Babu P, Forrest KL, Park RF, Bansal UK. Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development. Genes. 2022; 13(6):964. https://doi.org/10.3390/genes13060964

Chicago/Turabian Style

Bariana, Harbans S., Prashanth Babu, Kerrie L. Forrest, Robert F. Park, and Urmil K. Bansal. 2022. "Discovery of the New Leaf Rust Resistance Gene Lr82 in Wheat: Molecular Mapping and Marker Development" Genes 13, no. 6: 964. https://doi.org/10.3390/genes13060964

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop