Pro-Fibrotic Effects of CCL18 on Human Lung Fibroblasts Are Mediated via CCR6
Abstract
:1. Introduction
2. Materials and Methods
2.1. Phage Display Peptide Library Screenings
2.2. Patients
2.3. Immunohistochemistry
2.4. Isolation of Primary Fibroblasts
2.5. Cell Lines
2.6. Flow Cytometry
2.7. FGF2 Determination
2.8. Real-Time PCR
2.9. Stable Transfection of RLE-6TN
2.10. Knock Down of CCR6 in NIH/3T3 Cells by CRISPR/Cas9
2.11. Receptor Internalization
2.12. Co-Immunoprecipitation
2.13. Statistical Analysis
3. Results
3.1. Identification of a CCL18-Binding Peptide Using Phage Display
3.2. CCR6 Expression in Human Fibrotic Lung Tissue
3.3. CCR6 Expression in Human Primary Fibroblast Lines
3.4. CCL18 Binding to CCR6
3.4.1. CCL18 Binds to CCR6 (Co-IP)
3.4.2. CCL18-Induced Internalization of CCR6
3.5. Functional Analysis of CCR6
3.5.1. CCL18-Induced Activation of Human Primary Lung Fibroblasts
3.5.2. CCL18-Induced Activation of Wild-Type and CCR6-KO NIH 3T3 Cells
4. Discussion
5. Conclusions
6. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- King, T.E., Jr.; Pardo, A.; Selman, M. Idiopathic pulmonary fibrosis. Lancet 2011, 378, 1949–1961. [Google Scholar] [CrossRef]
- Travis, W.D.; King, T.E.; Bateman, E.D.; Lynch, D.A.; Capron, F.; Center, D.; Colby, T.V.; Cordier, J.F.; DuBois, R.M.; Galvin, J.; et al. American Thoracic Society/European Respiratory Society international multidisciplinary consensus classification of the idiopathic interstitial pneumonias. This joint statement of the American Thoracic Society (ATS), and the European Respiratory Society (ERS) was adopted by the ATS board of directors, June 2001 and by the ERS executive committee, June 2001. Am. J. Respir. Crit. Care Med. 2002, 165, 277–304. [Google Scholar]
- Raghu, G.; Collard, H.R.; Egan, J.J.; Martinez, F.J.; Behr, J.; Brown, K.K.; Colby, T.V.; Cordier, J.F.; Flaherty, K.R.; Lasky, J.A.; et al. An official ATS/ERS/JRT/ALAT statement: Idiopathic pulmonary fibrosis: Evidence-based guidelines for diagnosis and management. Am. J. Respir. Crit. Care Med. 2011, 183, 788–824. [Google Scholar] [CrossRef]
- Selman, M.; Pardo, A.; Richeldi, L.; Cerri, S. Emerging drugs for idiopathic pulmonary fibrosis. Expert Opin. Emerg. Drugs 2011, 16, 341–362. [Google Scholar] [CrossRef]
- Ley, B.; Collard, H.R.; King, T.E., Jr. Clinical course and prediction of survival in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 2011, 183, 431–440. [Google Scholar] [CrossRef]
- Travis, W.D.; Matsui, K.; Moss, J.; Ferrans, V.J. Idiopathic nonspecific interstitial pneumonia: Prognostic significance of cellular and fibrosing patterns: Survival comparison with usual interstitial pneumonia and desquamative interstitial pneumonia. Am. J. Surg. Pathol. 2000, 24, 19–33. [Google Scholar] [CrossRef] [PubMed]
- Richeldi, L.; du Bois, R.M.; Raghu, G.; Azuma, A.; Brown, K.K.; Costabel, U.; Cottin, V.; Flaherty, K.R.; Hansell, D.M.; Inoue, Y.; et al. Efficacy and safety of nintedanib in idiopathic pulmonary fibrosis. N. Engl. J. Med. 2014, 370, 2071–2082. [Google Scholar] [CrossRef] [PubMed]
- King, T.E., Jr.; Bradford, W.Z.; Castro-Bernardini, S.; Fagan, E.A.; Glaspole, I.; Glassberg, M.K.; Gorina, E.; Hopkins, P.M.; Kardatzke, D.; Lancaster, L.; et al. A phase 3 trial of pirfenidone in patients with idiopathic pulmonary fibrosis. N. Engl. J. Med. 2014, 370, 2083–2092. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, N.I.; Roth, G.J.; Hilberg, F.; Muller-Quernheim, J.; Prasse, A.; Zissel, G.; Schnapp, A.; Park, J.E. Inhibition of PDGF VEGF and FGF signalling attenuates fibrosis. Eur. Respir. J. 2007, 29, 976–985. [Google Scholar] [CrossRef] [PubMed]
- Salvatore, M.; Ishikawa, G.; Padilla, M. Is it idiopathic pulmonary fibrosis or not? J. Am. Board Fam. Med. 2018, 31, 151–162. [Google Scholar] [CrossRef] [PubMed]
- Wells, A.U. Patterns of progression in non-ipf fibrotic interstitial lung disease. Curr. Opin. Pulm. Med. 2023, 29, 459–464. [Google Scholar] [CrossRef]
- Selman, M.; King, T.E.; Pardo, A. Idiopathic pulmonary fibrosis: Prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 2001, 134, 136–151. [Google Scholar] [CrossRef]
- Spagnolo, P.; Semenzato, U. Revealing the pathogenic and ageing-related mechanisms of the enigmatic idiopathic pulmonary fibrosis (and chronic obstructive pulmonary disease). Curr. Opin. Pulm. Med. 2022, 28, 296–302. [Google Scholar] [CrossRef]
- Spagnolo, P.; Kropski, J.A.; Jones, M.G.; Lee, J.S.; Rossi, G.; Karampitsakos, T.; Maher, T.M.; Tzouvelekis, A.; Ryerson, C.J. Idiopathic pulmonary fibrosis: Disease mechanisms and drug development. Pharmacol. Ther. 2021, 222, 107798. [Google Scholar] [CrossRef] [PubMed]
- Lederer, D.J.; Martinez, F.J. Idiopathic pulmonary fibrosis. N. Engl. J. Med. 2018, 378, 1811–1823. [Google Scholar] [CrossRef] [PubMed]
- Richeldi, L.; Collard, H.R.; Jones, M.G. Idiopathic pulmonary fibrosis. Lancet 2017, 389, 1941–1952. [Google Scholar] [CrossRef] [PubMed]
- Daniil, Z.D.; Gilchrist, F.C.; Nicholson, A.G.; Hansell, D.M.; Harris, J.; Colby, T.V.; du Bois, R.M. A histologic pattern of nonspecific interstitial pneumonia is associated with a better prognosis than usual interstitial pneumonia in patients with cryptogenic fibrosing alveolitis. Am. J. Respir. Crit. Care Med. 1999, 160, 899–905. [Google Scholar] [CrossRef] [PubMed]
- Schutyser, E.; Richmond, A.; Van Damme, J. Involvement of cc chemokine ligand 18 (ccl18) in normal and pathological processes. J. Leukoc. Biol. 2005, 78, 14–26. [Google Scholar] [CrossRef] [PubMed]
- Schraufstatter, I.U.; Zhao, M.; Khaldoyanidi, S.K.; Discipio, R.G. The chemokine CCL18 causes maturation of cultured monocytes to macrophages in the M2 spectrum. Immunology 2012, 135, 287–298. [Google Scholar] [CrossRef]
- Porcheray, F.; Viaud, S.; Rimaniol, A.C.; Leone, C.; Samah, B.; Dereuddre-Bosquet, N.; Dormont, D.; Gras, G. Macrophage activation switching: An asset for the resolution of inflammation. Clin. Exp. Immunol. 2005, 142, 481–489. [Google Scholar] [CrossRef]
- Gordon, S. Alternative activation of macrophages. Nat. Rev. Immunol. 2003, 3, 23–35. [Google Scholar] [CrossRef]
- Mantovani, A.; Sica, A.; Sozzani, S.; Allavena, P.; Vecchi, A.; Locati, M. The chemokine system in diverse forms of macrophage activation and polarization. Trends. Immunol. 2004, 25, 677–686. [Google Scholar] [CrossRef]
- Tasaki, Y.; Fukuda, S.; Iio, M.; Miura, R.; Imai, T.; Sugano, S.; Yoshie, O.; Hughes, A.L.; Nomiyama, H. Chemokine PARC gene (SCYA18) generated by fusion of two Mip-1alpha/Ld78alpha-like genes. Genomics 1999, 55, 353–357. [Google Scholar] [CrossRef] [PubMed]
- Hieshima, K.; Imai, T.; Baba, M.; Shoudai, K.; Ishizuka, K.; Nakagawa, T.; Tsuruta, J.; Takeya, M.; Sakaki, Y.; Takatsuki, K.; et al. A novel human CC chemokine PARC that is most homologous to macrophage-inflammatory protein-1 alpha/Ld78 alpha and chemotactic for T lymphocytes, but not for monocytes. J. Immunol. 1997, 159, 1140–1149. [Google Scholar] [CrossRef]
- Prasse, A.; Pechkovsky, D.V.; Toews, G.B.; Jungraithmayr, W.; Kollert, F.; Goldmann, T.; Vollmer, E.; Muller-Quernheim, J.; Zissel, G. A vicious circle of alveolar macrophages and fibroblasts perpetuates pulmonary fibrosis via CCL18. Am. J. Respir. Crit. Care Med. 2006, 173, 781–792. [Google Scholar] [CrossRef] [PubMed]
- Prasse, A.; Pechkovsky, D.V.; Toews, G.B.; Schafer, M.; Eggeling, S.; Ludwig, C.; Germann, M.; Kollert, F.; Zissel, G.; Muller-Quernheim, J. CCL18 as an indicator of pulmonary fibrotic activity in idiopathic interstitial pneumonias and systemic sclerosis. Arthritis Rheum. 2007, 56, 1685–1693. [Google Scholar] [CrossRef]
- Zanatta, E.; Martini, A.; Depascale, R.; Gamba, A.; Tonello, M.; Gatto, M.; Giraudo, C.; Balestro, E.; Doria, A.; Iaccarino, L. CCL18 as a biomarker of interstitial lung disease (ILD) and progressive fibrosing ILD in patients with idiopathic inflammatory myopathies. Diagnostics 2023, 13, 1715. [Google Scholar] [CrossRef] [PubMed]
- Prasse, A.; Probst, C.; Bargagli, E.; Zissel, G.; Toews, G.B.; Flaherty, K.R.; Olschewski, M.; Rottoli, P.; Muller-Quernheim, J. Serum CC-chemokine ligand 18 concentration predicts outcome in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 2009, 179, 717–723. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Liu, C.; Tan, C.; Zhang, J. Predictive biomarkers of disease progression in idiopathic pulmonary fibrosis. Heliyon 2024, 10, e23543. [Google Scholar] [CrossRef]
- Atamas, S.P.; Luzina, I.G.; Choi, J.; Tsymbalyuk, N.; Carbonetti, N.H.; Singh, I.S.; Trojanowska, M.; Jimenez, S.A.; White, B. Pulmonary and activation-regulated chemokine stimulates collagen production in lung fibroblasts. Am. J. Respir. Cell Mol. Biol. 2003, 29, 743–749. [Google Scholar] [CrossRef] [PubMed]
- Stahl, M.; Schupp, J.; Jager, B.; Schmid, M.; Zissel, G.; Muller-Quernheim, J.; Prasse, A. Lung collagens perpetuate pulmonary fibrosis via CD204 and M2 macrophage activation. PLoS ONE 2013, 8, e81382. [Google Scholar] [CrossRef] [PubMed]
- Plönes, T.; Krohn, A.; Burger, M.; Veelken, H.; Passlick, B.; Muller-Quernheim, J.; Zissel, G. Serum level of CC-chemokine ligand 18 is increased in patients with non-small-cell lung cancer and correlates with survival time in adenocarcinomas. PLoS ONE 2012, 7, e41746. [Google Scholar] [CrossRef] [PubMed]
- Trepel, M.; Arap, W.; Pasqualini, R. Modulation of the immune response by systemic targeting of antigens to lymph nodes. Cancer Res. 2001, 61, 8110–8112. [Google Scholar]
- Müller, O.J.; Kaul, F.; Weitzman, M.D.; Pasqualini, R.; Arap, W.; Kleinschmidt, J.A.; Trepel, M. Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors. Nat. Biotechnol. 2003, 21, 1040–1046. [Google Scholar] [CrossRef]
- Marwitz, S.; Abdullah, M.; Vock, C.; Fine, J.; Visvanathan, S.; Gaede, K.; Hauber, H.; Zabel, P.; Goldmann, T. Hope-bal: Improved molecular diagnostics by application of a novel technique for fixation and paraffin-embedding. J. Histochem. Cytochem. 2011, 59, 601–614. [Google Scholar] [CrossRef]
- Goldmann, T.; Vollmer, E.; Gerdes, J. What’s cooking? Detection of important biomarkers in hope-fixed, paraffin-embedded tissues eliminates the need for antigen retrieval. Am. J. Pathol. 2003, 163, 2638–2640. [Google Scholar] [CrossRef] [PubMed]
- Jullien, N. Amplifx 1.7.0. 2004–2008. Available online: https://inp.univ-amu.fr/en/amplifx-manage-test-and-design-your-primers-for-pcr (accessed on 14 January 2024).
- Hemmerich, W. Calculator for Adjusting the α Level (Rechner zur Adjustierung des α-Niveaus). Available online: https://statistikguru.de/rechner/adjustierung-des-alphaniveaus.html (accessed on 14 January 2024).
- El Agha, E.; Thannickal, V.J. The lung mesenchyme in development, regeneration, and fibrosis. J. Clin. Investig. 2023, 133, e170498. [Google Scholar] [CrossRef]
- Luzina, I.G.; Tsymbalyuk, N.; Choi, J.; Hasday, J.D.; Atamas, S.P. CCL18-stimulated upregulation of collagen production in lung fibroblasts requires Sp1 signaling and basal Smad3 activity. J. Cell Physiol. 2006, 206, 221–228. [Google Scholar] [CrossRef]
- Islam, S.A.; Ling, M.F.; Leung, J.; Shreffler, W.G.; Luster, A.D. Identification of human CCR8 as a CCL18 receptor. J. Exp. Med. 2013, 210, 1889–1898. [Google Scholar] [CrossRef]
- Chen, J.; Yao, Y.; Gong, C.; Yu, F.; Su, S.; Chen, J.; Liu, B.; Deng, H.; Wang, F.; Lin, L.; et al. CCL18 from tumor-associated macrophages promotes breast cancer metastasis via PITPNM3. Cancer Cell 2011, 19, 541–555. [Google Scholar] [CrossRef]
- Catusse, J.; Wollner, S.; Leick, M.; Schrottner, P.; Schraufstatter, I.; Burger, M. Attenuation of CXCR4 responses by CCL18 in acute lymphocytic leukemia B cells. J. Cell Physiol. 2010, 225, 792–800. [Google Scholar] [CrossRef]
- Kodelja, V.; Muller, C.; Politz, O.; Hakij, N.; Orfanos, C.E.; Goerdt, S. Alternative macrophage activation-associated CC-chemokine-1, a novel structural homologue of macrophage inflammatory protein-1 alpha with a Th2-associated expression pattern. J. Immunol. 1998, 160, 1411–1418. [Google Scholar] [CrossRef]
- Pardo, A.; Smith, K.M.; Abrams, J.; Coffman, R.; Bustos, M.; McClanahan, T.K.; Grein, J.; Murphy, E.E.; Zlotnik, A.; Selman, M. CCL18/DC-CK-1/PARC up-regulation in hypersensitivity pneumonitis. J. Leukoc. Biol. 2001, 70, 610–616. [Google Scholar] [CrossRef]
- Baba, M.; Imai, T.; Nishimura, M.; Kakizaki, M.; Takagi, S.; Hieshima, K.; Nomiyama, H.; Yoshie, O. Identification of CCR6, the specific receptor for a novel lymphocyte-directed CC chemokine LARC. J. Biol. Chem. 1997, 272, 14893–14898. [Google Scholar] [CrossRef]
- Perez-Canadillas, J.M.; Zaballos, A.; Gutierrez, J.; Varona, R.; Roncal, F.; Albar, J.P.; Marquez, G.; Bruix, M. Nmr solution structure of murine CCL20/Mip-3alpha, a chemokine that specifically chemoattracts immature dendritic cells and lymphocytes through its highly specific interaction with the beta-chemokine receptor CCR6. J. Biol. Chem. 2001, 276, 28372–28379. [Google Scholar] [CrossRef]
- Oku, H.; Shimizu, T.; Kawabata, T.; Nagira, M.; Hikita, I.; Ueyama, A.; Matsushima, S.; Torii, M.; Arimura, A. Antifibrotic action of pirfenidone and prednisolone: Different effects on pulmonary cytokines and growth factors in bleomycin-induced murine pulmonary fibrosis. Eur. J. Pharmacol. 2008, 590, 400–408. [Google Scholar] [CrossRef] [PubMed]
- Pochetuhen, K.; Luzina, I.G.; Lockatell, V.; Choi, J.; Todd, N.W.; Atamas, S.P. Complex regulation of pulmonary inflammation and fibrosis by CCL18. Am. J. Pathol. 2007, 171, 428–437. [Google Scholar] [CrossRef] [PubMed]
- Adema, G.J.; Hartgers, F.; Verstraten, R.; de Vries, E.; Marland, G.; Menon, S.; Foster, J.; Xu, Y.; Nooyen, P.; McClanahan, T.; et al. A dendritic-cell-derived c-c chemokine that preferentially attracts naive T cells. Nature 1997, 387, 713–717. [Google Scholar] [CrossRef]
- Chenivesse, C.; Chang, Y.; Azzaoui, I.; Ait Yahia, S.; Morales, O.; Ple, C.; Foussat, A.; Tonnel, A.B.; Delhem, N.; Yssel, H.; et al. Pulmonary CCL18 recruits human regulatory T cells. J. Immunol. 2012, 189, 128–137. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.; de Nadai, P.; Azzaoui, I.; Morales, O.; Delhem, N.; Vorng, H.; Tomavo, S.; Ait Yahia, S.; Zhang, G.; Wallaert, B.; et al. The chemokine CCL18 generates adaptive regulatory T cells from memory CD4+ T cells of healthy but not allergic subjects. FASEB J. 2007, 24, 5063–5072. [Google Scholar]
- Azzaoui, I.; Yahia, S.A.; Chang, Y.; Vorng, H.; Morales, O.; Fan, Y.; Delhem, N.; Ple, C.; Tonnel, A.B.; Wallaert, B.; et al. CCL18 differentiates dendritic cells in tolerogenic cells able to prime regulatory T cells in healthy subjects. Blood 2011, 118, 3549–3558. [Google Scholar] [CrossRef]
- Schutyser, E.; Struyf, S.; Van Damme, J. The CC chemokine CCL20 and its receptor CCR6. Cytokine Growth Factor Rev. 2003, 14, 409–426. [Google Scholar] [CrossRef]
- Facco, M.; Baesso, I.; Miorin, M.; Bortoli, M.; Cabrelle, A.; Boscaro, E.; Gurrieri, C.; Trentin, L.; Zambello, R.; Calabrese, F.; et al. Expression and role of CCR6/CCL20 chemokine axis in pulmonary sarcoidosis. J. Leukoc. Biol. 2007, 82, 946–955. [Google Scholar] [CrossRef]
- Singh, S.P.; Zhang, H.H.; Foley, J.F.; Hedrick, M.N.; Farber, J.M. Human T cells that are able to produce IL-17 express the chemokine receptor CCR6. J. Immunol. 2008, 180, 214–221. [Google Scholar] [CrossRef]
- Voo, K.S.; Wang, Y.H.; Santori, F.R.; Boggiano, C.; Wang, Y.H.; Arima, K.; Bover, L.; Hanabuchi, S.; Khalili, J.; Marinova, E.; et al. Identification of IL-17-producing FOXP3+ regulatory T cells in humans. Proc. Natl. Acad. Sci. USA 2009, 106, 4793–4798. [Google Scholar] [CrossRef]
- Gerritsen, M.E.; Tomlinson, J.E.; Zlot, C.; Ziman, M.; Hwang, S. Using gene expression profiling to identify the molecular basis of the synergistic actions of hepatocyte growth factor and vascular endothelial growth factor in human endothelial cells. Br. J. Pharmacol. 2003, 140, 595–610. [Google Scholar] [CrossRef]
- Alaaeddine, N.; Hilal, G.; Baddoura, R.; Antoniou, J.; Di Battista, J.A. CCL20 stimulates proinflammatory mediator synthesis in human fibroblast-like synoviocytes through a map kinase-dependent process with transcriptional and posttranscriptional control. J. Rheumatol. 2011, 38, 1858–1865. [Google Scholar] [CrossRef]
- Steinfelder, S.; Floess, S.; Engelbert, D.; Haeringer, B.; Baron, U.; Rivino, L.; Steckel, B.; Gruetzkau, A.; Olek, S.; Geginat, J.; et al. Epigenetic modification of the human CCR6 gene is associated with stable CCR6 expression in T cells. Blood 2011, 117, 2839–2846. [Google Scholar] [CrossRef] [PubMed]
- Cruz, M.T.; Goncalo, M.; Paiva, A.; Morgado, J.M.; Figueiredo, A.; Duarte, C.B.; Lopes, M.C. Contact sensitizers downregulate the expression of the chemokine receptors CCR6 and CXCR4 in a skin dendritic cell line. Arch. Dermatol. Res. 2005, 297, 43–47. [Google Scholar] [CrossRef] [PubMed]
- Jordana, M.; Schulman, J.; McSharry, C.; Irving, L.B.; Newhouse, M.T.; Jordana, G.; Gauldie, J. Heterogeneous proliferative characteristics of human adult lung fibroblast lines and clonally derived fibroblasts from control and fibrotic tissue. Am. Rev. Respir. Dis. 1988, 137, 579–584. [Google Scholar] [CrossRef] [PubMed]
- Kaarteenaho, R. The current position of surgical lung biopsy in the diagnosis of idiopathic pulmonary fibrosis. Respir. Res. 2013, 14, 43. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Forward Primer | Reverse Primer |
---|---|---|---|
hGAPDH | NM_002046 | CACCAGGGCTGCTTTTAACT | GATCTCGCTCCTGGAAGATG |
hCCR6 | NM_004367 NM_031409 | GCACAAAATGATGGCAGTGG | CCGAAGCACTTCCAGGTTGT |
hCollagen 1A1 | NM_000088 | CCCTGTCTGCTTCCTGTAAACT | CATGTTCGGTTGGTCAAAGATA |
hαSMA | NM_001141945 | CATCATGCGTCTGGATCTGG | GGACAATCTCACGCTCAGCA |
mGAPDH | NM_001289726 | GCGAGACCCCACTAACATCAAA | CTTTTGGCTCCACCCTTCAAGT |
mCollagen 1A1 | NM_007742 | TGCTGGGAAACATGGAAACCGA | AGGTTCTCCTTTGTCACCTCGGAT |
mαSMA | NM_007392 | CACCCAGCACCATGAAGATCAAGA | CCTGTTTGCTGATCCACATCTGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Höhne, K.; Wagenknecht, A.; Maier, C.; Engelhard, P.; Goldmann, T.; Schließmann, S.J.; Plönes, T.; Trepel, M.; Eibel, H.; Müller-Quernheim, J.; et al. Pro-Fibrotic Effects of CCL18 on Human Lung Fibroblasts Are Mediated via CCR6. Cells 2024, 13, 238. https://doi.org/10.3390/cells13030238
Höhne K, Wagenknecht A, Maier C, Engelhard P, Goldmann T, Schließmann SJ, Plönes T, Trepel M, Eibel H, Müller-Quernheim J, et al. Pro-Fibrotic Effects of CCL18 on Human Lung Fibroblasts Are Mediated via CCR6. Cells. 2024; 13(3):238. https://doi.org/10.3390/cells13030238
Chicago/Turabian StyleHöhne, Kerstin, Annett Wagenknecht, Corinna Maier, Peggy Engelhard, Torsten Goldmann, Stephan J. Schließmann, Till Plönes, Martin Trepel, Hermann Eibel, Joachim Müller-Quernheim, and et al. 2024. "Pro-Fibrotic Effects of CCL18 on Human Lung Fibroblasts Are Mediated via CCR6" Cells 13, no. 3: 238. https://doi.org/10.3390/cells13030238