Novel Compound Heterozygous Variations in MPDZ Gene Caused Isolated Bilateral Macular Coloboma in a Chinese Family
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Whole-Exome Sequencing (WES)
2.3. In Silico Analysis
2.4. Sanger Sequencing
2.5. Whole-Exome Sequencing (WES) and Bioinformatics Analysis of Zebrafish Line
2.6. Whole-Mount In Situ Hybridization
2.7. Immunofluorescence Staining
2.8. Generation of MPDZ Crispants
2.9. Capped Message RNA In Vitro Transcription
2.10. Zebrafish Histology
2.11. Cell Culture and Transfection
2.12. Immunoblot Analysis and Immunofluorescence (IF) Staining
2.13. Statistical Analysis
3. Results
3.1. Clinical Characteristics
3.2. Mutation Screening and Pathogenic Analysis
- (1)
- The two variants were observed in the database of normal subjects of the sequence company with a very low mutation frequency of 0;
- (2)
- Other potential virulent variants were not detected in this study;
- (3)
- Both the nonsense variant p.Ser1752Ter and the frameshift variant p.Asp1434fs*3 were nonfunctional variations and were considered solid pathogenic evidence;
- (4)
- There was a sufficient correlation between the gene variations and MC phenotype.
3.3. MPDZ Knockdown Results in Cytoskeleton Rearrangement and Enhanced Motility
3.4. Expression of MPDZ in OLM of Zebrafish
3.5. Developmental Defects in MPDZ Crispants Zebrafish
4. Discussion
4.1. MPDZ Variation and Influence
4.2. MPDZ Location and Function in the Retina
4.3. MC-Related Gene Variations
4.4. The Phenotype Varied According to Previously Reported Cases
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hornby, S.J.; Adolph, S.; Gilbert, C.E.; Dandona, L.; Foster, A. Visual acuity in children with coloboma: Clinical features and a new phenotypic classification system. Ophthalmology 2000, 107, 511–520. [Google Scholar] [CrossRef]
- Varghese, M.; Kavalakatt, J.A.; Pandey, S.; Kolath, J.J. Macular coloboma. Oman. J. Ophthalmol. 2016, 9, 67–68. [Google Scholar] [CrossRef] [PubMed]
- Oh, J.Y.; Yu, Y.S.; Hwang, J.M.; Park, K.H. Optical coherence tomographic finding in a case of macular coloboma. Korean J. Ophthalmol. 2007, 21, 175–177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Plaza-Ramos, P.; Tabuenca-Del Barrio, L.; Zubicoa-Eneriz, A.; Goldaracena-Tanco, B. Michaelis-Manz syndrome. A case report. An. Sist. Sanit. Navar. 2018, 41, 393–396. [Google Scholar] [PubMed] [Green Version]
- Kiratli, H.; Tatlipinar, S. Agenesis of the corpus callosum in a child with Leber’s congenital amaurosis. Ophthalmic Genet. 1999, 20, 183–187. [Google Scholar] [CrossRef] [PubMed]
- Phillips, C.I. Hereditary macular coloboma. J. Med. Genet. 1970, 7, 224–226. [Google Scholar] [CrossRef] [Green Version]
- Li, T.; Lin, Y.; Gao, H.; Chen, C.; Zhu, Y.; Liu, B.; Lian, Y.; Li, Y.; Zhou, W.; Jiang, H.; et al. Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma. Mol. Med. Rep. 2017, 16, 2505–2510. [Google Scholar] [CrossRef] [Green Version]
- Ali, M.; Hocking, P.M.; McKibbin, M.; Finnegan, S.; Shires, M.; Poulter, J.A.; Prescott, K.; Booth, A.; Raashid, Y.; Jafri, H.; et al. Mpdz null allele in an avian model of retinal degeneration and mutations in human leber congenital amaurosis and retinitis pigmentosa. Investig. Ophthalmol. Vis. Sci. 2011, 52, 7432–7440. [Google Scholar] [CrossRef] [Green Version]
- Al-Jezawi, N.K.; Al-Shamsi, A.M.; Suleiman, J.; Ben-Salem, S.; John, A.; Vijayan, R.; Ali, B.R.; Al-Gazali, L. Compound heterozygous variants in the multiple PDZ domain protein (MPDZ) cause a case of mild non-progressive communicating hydrocephalus. BMC Med. Genet. 2018, 19, 34. [Google Scholar] [CrossRef] [Green Version]
- Al-Dosari, M.S.; Al-Owain, M.; Tulbah, M.; Kurdi, W.; Adly, N.; Al-Hemidan, A.; Masoodi, T.A.; Albash, B.; Alkuraya, F.S. Mutation in MPDZ causes severe congenital hydrocephalus. J. Med. Genet. 2013, 50, 54–58. [Google Scholar] [CrossRef]
- Shaheen, R.; Sebai, M.A.; Patel, N.; Ewida, N.; Kurdi, W.; Altweijri, I.; Sogaty, S.; Almardawi, E.; Seidahmed, M.Z.; Alnemri, A.; et al. The genetic landscape of familial congenital hydrocephalus. Ann. Neurol. 2017, 81, 890–897. [Google Scholar] [CrossRef]
- Feldner, A.; Adam, M.G.; Tetzlaff, F.; Moll, I.; Komljenovic, D.; Sahm, F.; Bäuerle, T.; Ishikawa, H.; Schroten, H.; Korff, T.; et al. Loss of Mpdz impairs ependymal cell integrity leading to perinatal-onset hydrocephalus in mice. EMBO Mol. Med. 2017, 9, 890–905. [Google Scholar] [CrossRef]
- Hui, X.; Yang, J.; Zhang, J.; Sun, J.; Wang, X. Optical Genomic Mapping Identified a Heterozygous Structural Variant in NCF2 Related to Chronic Granulomatous Disease. J. Clin. Immunol. 2022, 1–4. [Google Scholar] [CrossRef]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [Green Version]
- Yuan, S.; Qi, R.; Fang, X.; Wang, X.; Zhou, L.; Sheng, X. Two novel PDE6C gene mutations in Chinese family with achromatopsia. Ophthalmic Genet. 2020, 41, 591–598. [Google Scholar] [CrossRef]
- Green, D.J.; Lenassi, E.; Manning, C.S.; McGaughey, D.; Sharma, V.; Black, G.C.; Ellingford, J.M.; Sergouniotis, P.I. North Carolina Macular Dystrophy: Phenotypic Variability and Computational Analysis of Disease-Associated Noncoding Variants. Investig. Ophthalmol. Vis. Sci. 2021, 62, 16. [Google Scholar] [CrossRef]
- Namburi, P.; Khateb, S.; Meyer, S.; Bentovim, T.; Ratnapriya, R.; Khramushin, A.; Swaroop, A.; Schueler-Furman, O.; Banin, E.; Sharon, D. A unique PRDM13-associated variant in a Georgian Jewish family with probable North Carolina macular dystrophy and the possible contribution of a unique CFH variant. Mol. Vis. 2020, 26, 299–310. [Google Scholar]
- Small, K.W.; DeLuca, A.P.; Whitmore, S.S.; Rosenberg, T.; Silva-Garcia, R.; Udar, N.; Puech, B.; Garcia, C.A.; Rice, T.A.; Fishman, G.A.; et al. North Carolina Macular Dystrophy Is Caused by Dysregulation of the Retinal Transcription Factor PRDM13. Ophthalmology 2016, 123, 9–18. [Google Scholar] [CrossRef] [Green Version]
- Silva, R.S.; Arno, G.; Cipriani, V.; Pontikos, N.; Defoort-Dhellemmes, S.; Kalhoro, A.; Carss, K.J.; Raymond, F.L.; Dhaenens, C.M.; Jensen, H.; et al. Unique noncoding variants upstream of PRDM13 are associated with a spectrum of developmental retinal dystrophies including progressive bifocal chorioretinal atrophy. Hum. Mutat. 2019, 40, 578–587. [Google Scholar] [CrossRef]
- Cunningham, R.L.; Monk, K.R. Whole Mount In Situ Hybridization and Immunohistochemistry for Zebrafish Larvae. Methods Mol. Biol. 2018, 1739, 371–384. [Google Scholar]
- Wu, R.S.; Lam, I.I.; Clay, H.; Duong, D.N.; Deo, R.C.; Coughlin, S.R. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Dev. Cell 2018, 46, 112–125.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blenkinsop, T.A.; Salero, E.; Stern, J.H.; Temple, S. The culture and maintenance of functional retinal pigment epithelial monolayers from adult human eye. Methods Mol. Biol. 2013, 945, 45–65. [Google Scholar] [PubMed]
- Adachi, M.; Hamazaki, Y.; Kobayashi, Y.; Itoh, M.; Tsukita, S.; Furuse, M.; Tsukita, S. Similar and distinct properties of MUPP1 and Patj, two homologous PDZ domain-containing tight-junction proteins. Mol. Cell. Biol. 2009, 29, 2372–2389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Estévez, M.A.; Henderson, J.A.; Ahn, D.; Zhu, X.R.; Poschmann, G.; Lübbert, H.; Marx, R.; Baraban, J.M. The neuronal RhoA GEF, Tech, interacts with the synaptic multi-PDZ-domain-containing protein, MUPP1. J. Neurochem. 2008, 106, 1287–1297. [Google Scholar] [CrossRef] [PubMed]
- Jang, W.H.; Choi, S.H.; Jeong, J.Y.; Park, J.H.; Kim, S.J.; Seog, D.H. Neuronal cell-surface protein neurexin 1 interaction with multi-PDZ domain protein MUPP1. Biosci. Biotechnol. Biochem. 2014, 78, 644–646. [Google Scholar] [CrossRef]
- van de Pavert, S.A.; Kantardzhieva, A.; Malysheva, A.; Meuleman, J.; Versteeg, I.; Levelt, C.; Klooster, J.; Geiger, S.; Seeliger, M.W.; Rashbass, P.; et al. Crumbs homologue 1 is required for maintenance of photoreceptor cell polarization and adhesion during light exposure. J. Cell Sci. 2004, 117, 4169–4177. [Google Scholar] [CrossRef] [Green Version]
- Hamazaki, Y.; Itoh, M.; Sasaki, H.; Furuse, M.; Tsukita, S. Multi-PDZ domain protein 1 (MUPP1) is concentrated at tight junctions through its possible interaction with claudin-1 and junctional adhesion molecule. J. Biol. Chem. 2002, 277, 455–461. [Google Scholar] [CrossRef] [Green Version]
- Coyne, C.B.; Voelker, T.; Pichla, S.L.; Bergelson, J.M. The coxsackievirus and adenovirus receptor interacts with the multi-PDZ domain protein-1 (MUPP-1) within the tight junction. J. Biol. Chem. 2004, 279, 48079–48084. [Google Scholar] [CrossRef] [Green Version]
- Becamel, C.; Figge, A.; Poliak, S.; Dumuis, A.; Peles, E.; Bockaert, J.; Lubbert, H.; Ullmer, C. Interaction of serotonin 5-hydroxytryptamine type 2C receptors with PDZ10 of the multi-PDZ domain protein MUPP1. J. Biol. Chem. 2001, 276, 12974–12982. [Google Scholar] [CrossRef] [Green Version]
- Guerra, M.M.; Henzi, R.; Ortloff, A.; Lichtin, N.; Vío, K.; Jiménez, A.J.; Dominguez-Pinos, M.D.; González, C.; Jara, M.C.; Hinostroza, F.; et al. Cell Junction Pathology of Neural Stem Cells Is Associated with Ventricular Zone Disruption, Hydrocephalus, and Abnormal Neurogenesis. J. Neuropathol. Exp. Neurol. 2015, 74, 653–671. [Google Scholar] [CrossRef] [Green Version]
- Naylor, A.; Hopkins, A.; Hudson, N.; Campbell, M. Tight Junctions of the Outer Blood Retina Barrier. Int. J. Mol. Sci. 2019, 21, 211. [Google Scholar] [CrossRef] [Green Version]
- Pearson, R.A.; Barber, A.C.; West, E.L.; MacLaren, R.E.; Duran, Y.; Bainbridge, J.W.; Sowden, J.C.; Ali, R.R. Targeted disruption of outer limiting membrane junctional proteins (Crb1 and ZO-1) increases integration of transplanted photoreceptor precursors into the adult wild-type and degenerating retina. Cell Transplant. 2010, 19, 487–503. [Google Scholar] [CrossRef]
- Conte, I.; Lestingi, M.; den Hollander, A.; Miano, M.G.; Alfano, G.; Circolo, D.; Pugliese, M.; Testa, F.; Simonelli, F.; Rinaldi, E.; et al. Characterization of MPP4, a gene highly expressed in photoreceptor cells, and mutation analysis in retinitis pigmentosa. Gene 2002, 297, 33–38. [Google Scholar] [CrossRef]
- Cho, S.H.; Kim, J.Y.; Simons, D.L.; Song, J.Y.; Le, J.H.; Swindell, E.C.; Jamrich, M.; Wu, S.M.; Kim, S. Genetic ablation of Pals1 in retinal progenitor cells models the retinal pathology of Leber congenital amaurosis. Hum. Mol. Genet. 2012, 21, 2663–2676. [Google Scholar] [CrossRef] [Green Version]
- Pichaud, F. PAR-Complex and Crumbs Function During Photoreceptor Morphogenesis and Retinal Degeneration. Front. Cell. Neurosci. 2018, 12, 90. [Google Scholar] [CrossRef] [Green Version]
- Hayasaka, Y.; Hayasaka, S. Bilateral congenital macular coloboma in a boy with Down syndrome. Eur. J. Ophthalmol. 2004, 14, 565–567. [Google Scholar] [CrossRef]
- Yuan, T.; Pang, Q.; Xing, X.; Wang, X.; Li, Y.; Li, J.; Wu, X.; Li, M.; Wang, O.; Jiang, Y.; et al. First report of a novel missense CLDN19 mutations causing familial hypomagnesemia with hypercalciuria and nephrocalcinosis in a Chinese family. Calcif. Tissue Int. 2015, 96, 265–273. [Google Scholar] [CrossRef]
- Reis, L.M.; Basel, D.; McCarrier, J.; Weinberg, D.V.; Semina, E.V. Compound heterozygous splicing CDON variants result in isolated ocular coloboma. Clin. Genet. 2020, 98, 486–492. [Google Scholar] [CrossRef] [PubMed]
- Khajavi, M.; Inoue, K.; Lupski, J.R. Nonsense-mediated mRNA decay modulates clinical outcome of genetic disease. Eur. J. Hum. Genet. 2006, 14, 1074–1081. [Google Scholar] [CrossRef] [Green Version]
- Nagy, E.; Maquat, L.E. A rule for termination-codon position within intron-containing genes: When nonsense affects RNA abundance. Trends Biochem. Sci. 1998, 23, 198–199. [Google Scholar] [CrossRef]
- Le Hir, H.; Gatfield, D.; Izaurralde, E.; Moore, M.J. The exon-exon junction complex provides a binding platform for factors involved in mRNA export and nonsense-mediated mRNA decay. Embo J. 2001, 20, 4987–4997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holbrook, J.A.; Neu-Yilik, G.; Hentze, M.W.; Kulozik, A.E. Nonsense-mediated decay approaches the clinic. Nat. Genet. 2004, 36, 801–808. [Google Scholar] [CrossRef] [PubMed]
- Kashima, I.; Yamashita, A.; Izumi, N.; Kataoka, N.; Morishita, R.; Hoshino, S.; Ohno, M.; Dreyfuss, G.; Ohno, S. Binding of a novel SMG-1-Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1 phosphorylation and nonsense-mediated mRNA decay. Genes Dev. 2006, 20, 355–367. [Google Scholar] [CrossRef] [Green Version]
- Lindeboom, R.G.H.; Vermeulen, M.; Lehner, B.; Supek, F. The impact of nonsense-mediated mRNA decay on genetic disease, gene editing and cancer immunotherapy. Nat. Genet. 2019, 51, 1645–1651. [Google Scholar] [CrossRef]
- Boehm, V.; Haberman, N.; Ottens, F.; Ule, J.; Gehring, N.H. 3′ UTR length and messenger ribonucleoprotein composition determine endocleavage efficiencies at termination codons. Cell Rep. 2014, 9, 555–568. [Google Scholar] [CrossRef]
Name | Sequence of Oligonucleotide (5′–3′) |
---|---|
Scaffold Primer | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC |
MPDZ-oligo-1 | TAATACGACTCACTATAGGCTTTCTGCAGCTGTGGACGTTTTAGAGCTAGAAATAGC |
MPDZ-oligo-2 | TAATACGACTCACTATAGGCACGCTGGCCGCACGCTCGTTTTAGAGCTAGAAATAGC |
MPDZ-oligo-3 | TAATACGACTCACTATAGGATTAAAGGTAATGCCGAGGTTTTAGAGCTAGAAATAGC |
MPDZ-oligo-4 | TAATACGACTCACTATAGGACGTGGCTCCGCCGGGCTGTTTTAGAGCTAGAAATAGC |
MPDZ probe F | CGACGAGCTGTTGGAGATAAA |
MPDZ probe R | TTCCCGCCGACTATACTAAGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, S.; Zhang, F.; Wang, J.; Yang, S.; Ren, Y.; Rui, X.; Xia, X.; Sheng, X. Novel Compound Heterozygous Variations in MPDZ Gene Caused Isolated Bilateral Macular Coloboma in a Chinese Family. Cells 2022, 11, 3602. https://doi.org/10.3390/cells11223602
Zhang S, Zhang F, Wang J, Yang S, Ren Y, Rui X, Xia X, Sheng X. Novel Compound Heterozygous Variations in MPDZ Gene Caused Isolated Bilateral Macular Coloboma in a Chinese Family. Cells. 2022; 11(22):3602. https://doi.org/10.3390/cells11223602
Chicago/Turabian StyleZhang, Shuang, Fangxia Zhang, Juan Wang, Shangying Yang, Yinghua Ren, Xue Rui, Xiaobo Xia, and Xunlun Sheng. 2022. "Novel Compound Heterozygous Variations in MPDZ Gene Caused Isolated Bilateral Macular Coloboma in a Chinese Family" Cells 11, no. 22: 3602. https://doi.org/10.3390/cells11223602