P-Glycoprotein Inhibitor Tariquidar Plays an Important Regulatory Role in Pigmentation in Larval Zebrafish
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Chemicals and Study Design
2.3. Phenotype-Based Evaluation
2.4. RNA Extraction, Reverse Transcription, and qPCR Analysis
2.5. Statistical Analysis
3. Results
3.1. Effects of TQR on Size and Distribution of Melanophores
3.2. Effects of TQR on Size and Distribution of Iridophores
3.3. Effects of TQR on mRNA Expression Level of Chromatophore Differentiation Markers
3.4. Effects of TQR on mRNA Expression Level of Abcb4 and Abcb5
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
List of Abbreviations
Hpf | hours post fertilization |
Dpf | days post fertilization |
TQR | tariquidar (TQR; N-[2-[[[4-[2-(3,4-Dihydro-6,7-dimethoxy-2(1H)-isoquinolinyl)ethyl]phenyl]amino]carbonyl]-4,5-dimethoxyphenyl]-3-quinolinecarboxamide) |
RPE | retinal pigment epithelium |
gch2 | cyclohydrolase 2 |
tyrp1 | tyrosinase-related protein 1 |
tyr | tyrosinase |
dct | dopachrome tautomerase |
mitf | melanocyte inducing transcription factor |
pnp4a | purine nucleoside phosphorylase 4a |
foxd3 | forkhead box D3 |
ef1-α | elongation factor 1-alpha |
References
- Cooper, C.D. Insights from zebrafish on human pigment cell disease and treatment. Dev. Dyn. 2017, 246, 889–896. [Google Scholar] [CrossRef] [Green Version]
- Pickart, M.A.; Sivasubbu, S.; Nielsen, A.L.; Shriram, S.; King, R.A.; Ekker, S.C. Functional Genomics Tools for the Analysis of Zebrafish Pigment. Pigment. Cell Res. 2004, 17, 461–470. [Google Scholar] [CrossRef] [PubMed]
- Rawls, J.F.; Mellgren, E.M.; Johnson, S.L. How the Zebrafish Gets Its Stripes. Dev. Biol. 2001, 240, 301–314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raible, D.W.; Wood, A.; Hodsdon, W.; Henion, P.D.; Weston, J.A.; Eisen, J.S. Segregation and early dispersal of neural crest cells in the embryonic zebrafish. Dev. Dyn. 1992, 195, 29–42. [Google Scholar] [CrossRef]
- Hirata, M.; Nakamura, K.-I.; Kondo, S. Pigment cell distributions in different tissues of the zebrafish, with special reference to the striped pigment pattern. Dev. Dyn. 2005, 234, 293–300. [Google Scholar] [CrossRef]
- Kelsh, R.N.; Brand, M.; Jiang, Y.J.; Heisenberg, C.P.; Lin, S.; Haffter, P.; Odenthal, J.; Mullins, M.C.; Van Eeden, F.J.; Furutani-Seiki, M.; et al. Zebrafish pigmentation mutations and the processes of neural crest development. Development 1996, 123, 369–389. [Google Scholar]
- Bharti, K.; Nguyen, M.-T.T.; Skuntz, S.; Bertuzzi, S.; Arnheiter, H. The other pigment cell: Specification and development of the pigmented epithelium of the vertebrate eye. Pigment. Cell Res. 2006, 19, 380–394. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camp, E.; Lardelli, M. Tyrosinase gene expression in zebrafish embryos. Dev. Genes Evol. 2001, 211, 150–153. [Google Scholar] [CrossRef] [PubMed]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Curran, K.; Lister, J.A.; Kunkel, G.R.; Prendergast, A.; Parichy, D.M.; Raible, D.W. Interplay between Foxd3 and Mitf regulates cell fate plasticity in the zebrafish neural crest. Dev. Biol. 2010, 344, 107–118. [Google Scholar] [CrossRef] [Green Version]
- Mort, R.L.; Jackson, I.J.; Patton, E.E. The melanocyte lineage in development and disease. Development 2015, 142, 620–632. [Google Scholar] [CrossRef] [Green Version]
- Petratou, K.; Subkhankulova, T.; Lister, J.A.; Rocco, A.; Schwetlick, H.; Kelsh, R.N. A systems biology approach uncovers the core gene regulatory network governing iridophore fate choice from the neural crest. PLoS Genet. 2018, 14, e1007402. [Google Scholar] [CrossRef]
- Lopes, S.S.; Yang, X.; Müller, J.; Carney, T.J.; McAdow, A.R.; Rauch, G.-J.; Jacoby, A.S.; Hurst, L.D.; Delfino-Machín, M.; Haffter, P.; et al. Leukocyte Tyrosine Kinase Functions in Pigment Cell Development. PLoS Genet. 2008, 4, e1000026. [Google Scholar] [CrossRef] [Green Version]
- Choi, T.-Y.; Kim, J.-H.; Ko, D.H.; Kim, C.-H.; Hwang, J.-S.; Ahn, S.; Kim, S.Y.; Kim, C.-D.; Lee, J.-H.; Yoon, T.-J. Zebrafish as a new model for phenotype-based screening of melanogenic regulatory compounds. Pigment. Cell Res. 2007, 20, 120–127. [Google Scholar] [CrossRef] [PubMed]
- Lajis, A.F.B. A Zebrafish Embryo as an Animal Model for the Treatment of Hyperpigmentation in Cosmetic Dermatology Medicine. Med. (Kaunas, Lith.) 2018, 54, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Colanesi, S.; Taylor, K.L.; Temperley, N.D.; Lundegaard, P.R.; Liu, D.; North, T.E.; Ishizaki, H.; Kelsh, R.N.; Patton, E.E. Small molecule screening identifies targetable zebrafish pigmentation pathways. Pigment. Cell Melanoma Res. 2012, 25, 131–143. [Google Scholar] [CrossRef]
- Weidner, L.D.; Fung, K.L.; Kannan, P.; Moen, J.K.; Kumar, J.S.; Mulder, J.; Innis, R.B.; Gottesman, M.M.; Hall, M.D. Tariquidar Is an Inhibitor and Not a Substrate of Human and Mouse P-glycoprotein. Drug Metab. Dispos. 2016, 44, 275–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wagner, C.C.; Bauer, M.; Karch, R.; Feurstein, T.; Kopp, S.; Chiba, P.; Kletter, K.; Löscher, W.; Müller, M.; Zeitlinger, M.; et al. A Pilot Study to Assess the Efficacy of Tariquidar to Inhibit P-glycoprotein at the Human Blood-Brain Barrier with (R)-11C-Verapamil and PET. J. Nucl. Med. 2009, 50, 1954–1961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fox, E.; Bates, S.E. Tariquidar (XR9576): A P-glycoprotein drug efflux pump inhibitor. Expert Rev. Anticancer. Ther. 2007, 7, 447–459. [Google Scholar] [CrossRef]
- Thiebaut, F.; Tsuruo, T.; Hamada, H.; Gottesman, M.M.; Pastan, I.; Willingham, M.C. Cellular localization of the multi-drug-resistance gene product P-glycoprotein in normal human tissues. Proc. Natl. Acad. Sci. USA 1987, 84, 7735–7738. [Google Scholar] [CrossRef] [Green Version]
- Aryal, M.; Fischer, K.; Gentile, C.; Gitto, S.; Zhang, Y.-Z.; McDannold, N. Effects on P-Glycoprotein Expression after Blood-Brain Barrier Disruption Using Focused Ultrasound and Microbubbles. PLoS ONE 2017, 12, e0166061. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schinkel, A.H. P-Glycoprotein, a gatekeeper in the blood–brain barrier. Adv. Drug Deliv. Rev. 1999, 36, 179–194. [Google Scholar] [CrossRef]
- Van Assema, D.M.E.; Lubberink, M.; Boellaard, R.; Schuit, R.C.; Windhorst, A.D.; Scheltens, P.; Lammertsma, A.A.; Van Berckel, B.N.M. P-Glycoprotein Function at the Blood–Brain Barrier: Effects of Age and Gender. Mol. Imaging Biol. 2012, 14, 771–776. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Steuer, H.; Jaworski, A.; Elger, B.; Kaussmann, M.; Keldenich, J.; Schneider, H.; Stoll, D.; Schlosshauer, B. Functional char-acterization and comparison of the outer blood-retina barrier and the blood-brain barrier. Investig. Ophthalmol. Vis. Sci. 2005, 46, 1047–1053. [Google Scholar] [CrossRef] [PubMed]
- Constable, P.A.; Lawrenson, J.G.; Dolman, D.E.; Arden, G.B.; Abbott, N.J. P-Glycoprotein expression in human retinal pigment epithelium cell lines. Exp. Eye Res. 2006, 83, 24–30. [Google Scholar] [CrossRef]
- Kennedy, B.G.; Mangini, N.J. P-glycoprotein expression in human retinal pigment epithelium. Mol. Vis. 2002, 8, 422–430. [Google Scholar]
- Chen, K.G.; Szakács, G.; Annereau, J.P.; Rouzaud, F.; Liang, X.J.; Valencia, J.C.; Nagineni, C.N.; Hooks, J.J.; Hearing, V.J.; Michael, M.; et al. Principal expression of two mRNA isoforms (ABCB 5α and ABCB 5β) of the ATP-binding cassette transporter gene ABCB 5 in melanoma cells and melanocytes. Pigment. Cell Res. 2005, 18, 102–112. [Google Scholar] [CrossRef] [Green Version]
- Fischer, S.; Klüver, N.; Burkhardt-Medicke, K.; Pietsch, M.; Schmidt, A.-M.; Wellner, P.; Schirmer, K.; Luckenbach, T. Abcb4 acts as multixenobiotic transporter and active barrier against chemical uptake in zebrafish (Danio rerio) embryos. BMC Biol. 2013, 11, 69. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kasica-Jarosz, N.; Podlasz, P.; Kaleczyc, J. Pituitary adenylate cyclase–activating polypeptide (PACAP-38) plays an inhibitory role against inflammation induced by chemical damage to zebrafish hair cells. PLoS ONE 2018, 13, e0198180. [Google Scholar] [CrossRef]
- Oh, J.; Kim, J.; Jang, J.H.; Lee, S.; Park, C.M.; Kim, W.-K.; Kim, J.-S. Novel (1E,3E,5E)-1,6-bis(Substituted phenyl)hexa-1,3,5-triene Analogs Inhibit Melanogenesis in B16F10 Cells and Zebrafish. Int. J. Mol. Sci. 2018, 19, 1067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lister, J.A. Development of pigment cells in the zebrafish embryo. Microsc. Res. Tech. 2002, 58, 435–441. [Google Scholar] [CrossRef]
- Chen, K.G.; Valencia, J.C.; Gillet, J.-P.; Hearing, V.J.; Gottesman, M.M. Involvement of ABC transporters in melanogenesis and the development of multidrug resistance of melanoma. Pigment. Cell Melanoma Res. 2009, 22, 740–749. [Google Scholar] [CrossRef]
- Heimerl, S.; Bosserhoff, A.K.; Langmann, T.; Ecker, J.; Schmitz, G. Mapping ATP-binding cassette transporter gene expression profiles in melanocytes and melanoma cells. Melanoma Res. 2007, 17, 265–273. [Google Scholar] [CrossRef] [PubMed]
- Thisse, B.; Thisse, C. Fast Release Clones: A High Throughput Expression Analysis. ZFIN Direct Data Submission. Available online: http://zfin.org/cgi-bin/webdriver?MIval=aa-xpatselectapg&query_results=true&gene_name=abcb5&searchtype=equals (accessed on 6 September 2004).
- Frank, N.Y.; Pendse, S.S.; Lapchak, P.H.; Margaryan, A.; Shlain, D.; Doeing, C.; Sayegh, M.H.; Frank, M.H. Regulation of Progenitor Cell Fusion by ABCB5 P-glycoprotein, a Novel Human ATP-binding Cassette Transporter. J. Biol. Chem. 2003, 278, 47156–47165. [Google Scholar] [CrossRef] [Green Version]
- Cheli, Y.; Ohanna, M.; Ballotti, R.; Bertolotto, C. Fifteen-year quest for microphthalmia-associated transcription factor target genes. Pigment. Cell Melanoma Res. 2009, 23, 27–40. [Google Scholar] [CrossRef] [PubMed]
- Lister, J.A.; Capper, A.; Zeng, Z.; Mathers, M.E.; Richardson, J.; Paranthaman, K.; Jackson, I.J.; Patton, E.E. A Conditional Zebrafish MITF Mutation Reveals MITF Levels Are Critical for Melanoma Promotion vs. Regression In Vivo. J. Investig. Dermatol. 2014, 134, 133–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamanaka, H.; Kondo, S. In vitro analysis suggests that difference in cell movement during direct interaction can generate various pigment patterns in vivo. Proc. Natl. Acad. Sci. 2014, 111, 1867–1872. [Google Scholar] [CrossRef] [Green Version]
- Nakamasu, A.; Takahashi, G.; Kanbe, A.; Kondo, S. Interactions between zebrafish pigment cells responsible for the generation of Turing patterns. Proc. Natl. Acad. Sci. 2009, 106, 8429–8434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Inaba, M.; Yamanaka, H.; Kondo, S. Pigment Pattern Formation by Contact-Dependent Depolarization. Science 2012, 335, 677. [Google Scholar] [CrossRef] [Green Version]
- Patterson, L.B.; Parichy, D.M. Interactions with Iridophores and the Tissue Environment Required for Patterning Melano-phores and Xanthophores during Zebrafish Adult Pigment Stripe Formation. Barsh GS, editor. PLoS Genet. 2013, 9, e1003561. [Google Scholar] [CrossRef] [Green Version]
- Johnson, S.L.; Africa, D.; Walker, C.; Weston, J.A. Genetic Control of Adult Pigment Stripe Development in Zebrafish. Dev. Biol. 1995, 167, 27–33. [Google Scholar] [CrossRef] [Green Version]
- Lang, M.R.; Patterson, L.B.; Gordon, T.N.; Johnson, S.L.; Parichy, D.M. Basonuclin-2 Requirements for Zebrafish Adult Pigment Pattern Development and Female Fertility. PLoS Genet. 2009, 5, e1000744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parichy, D.M.; Mellgren, E.M.; Rawls, J.F.; Lopes, S.S.; Kelsh, R.N.; Johnson, S.L. Mutational Analysis of Endothelin Receptor b1 (rose) during Neural Crest and Pigment Pattern Development in the Zebrafish Danio rerio. Dev. Biol. 2000, 227, 294–306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krauss, J.; Frohnhöfer, H.G.; Walderich, B.; Maischein, H.-M.; Weiler, C.; Irion, U.; Nusslein-Volhard, C. Endothelin signalling in iridophore development and stripe pattern formation of zebrafish. Biol. Open 2014, 3, 503–509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frohnhöfer, H.G.; Krauss, J.; Maischein, H.M.; Nüsslein-Volhard, C. Iridophores and their interactions with other chroma-tophores are required for stripe formation in zebrafish. Development 2013, 140, 2997–3007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward 5′-3′ | Reverse 5′-3′ | Source/Accession No. |
---|---|---|---|
mitf | AGGACCTTGAAAACCGACAG | GTGGATGGGATAAGGGAAAG | [30]/NM_001178049 |
tyr | GATCCAGGTCAGCGGTTTGT | ACCGATGCGATTATTCCTGCT | [30]/NM_131013.3 |
tyrp1 | GGCCACCTATCAGAAACGCT | AGTGTATGCCCGAGTTGGC | [30]/NM_001002749.2 |
gch2 | GTTGTCATTGAAGCAGCTCACA | TCTGAACACACCCAGCATCG | NM_131667.1 |
dct | CAGCTTCAGGAATGCACTGG | GCTGGTCCCATTGAGGAACT | [30]/NM_131555.2 |
abcb4 | TACTGATGATGCTTGGCTTAATC | TCTCTGGAAAGGTGAAGTTAGG | [28]/JQ014001 |
abcb5 | CGCTGGTCATTCTGGCTGTC | CTCCTCTGCTACCGCTCCAG | [28]/JQ014002 |
ltk | GGTTTTGACAGCGACGGTTC | TGCCCGTTCTCCATCCGATA | NM_001006660.1 |
pnp4a | GGTTTTGACAGCGACGGTTC | CGGTGCTGTACTCATTCCAACT | NM_001002102.1 |
foxd3 | ATCAAATCCGAGCCGTCCAG | CGGGTTAAGGACAGGGACTG | NM_131290.2 |
ef1-α | CTGGAGGCCAGCTCAAACAT | ATCAAGAAGAGTAGTACCGCTAGCATTAC | NM_131263.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kasica, N.; Jakubowski, P.; Kaleczyc, J. P-Glycoprotein Inhibitor Tariquidar Plays an Important Regulatory Role in Pigmentation in Larval Zebrafish. Cells 2021, 10, 690. https://doi.org/10.3390/cells10030690
Kasica N, Jakubowski P, Kaleczyc J. P-Glycoprotein Inhibitor Tariquidar Plays an Important Regulatory Role in Pigmentation in Larval Zebrafish. Cells. 2021; 10(3):690. https://doi.org/10.3390/cells10030690
Chicago/Turabian StyleKasica, Natalia, Piotr Jakubowski, and Jerzy Kaleczyc. 2021. "P-Glycoprotein Inhibitor Tariquidar Plays an Important Regulatory Role in Pigmentation in Larval Zebrafish" Cells 10, no. 3: 690. https://doi.org/10.3390/cells10030690