Next Article in Journal
Phytoremediation of Toxic Lead from Contaminated Soil Using Neyraudia reynaudiana: Soil of Xuzhou as a Case Study
Previous Article in Journal
Potassium and Sulfur Fertilizer Sources Influence Alfalfa Yield and Nutritive Value and Residual Soil Characteristics in an Arid, Moderately Low-Potassium Soil
Previous Article in Special Issue
Insecticide Use against Desert Locust in the Horn of Africa 2019–2021 Reveals a Pressing Need for Change
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 1
10.3390/agronomy14010116
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparison of the Virulence of Space Mutants of Aspergillus oryzae XJ-1 against Adult Locusta migratoria

by
Xin Fu
1,2,
Hui Liu
1,3,
Xiao Xu
1,3,
Jin Guo
1,
Shaojing Hu
1,
Yinwei You
1,3,* and
Long Zhang
1,3,*
1
Institute of Plant Protection, Shandong Academy of Agricultural Sciences, Jinan 250100, China
2
College of Grassland Science and Technology, China Agricultural University, Beijing 100083, China
3
Shandong Provincial Engineering Technology Research Center on Bio-Control of Crops Diseases and Insect Pest, Jinan 250100, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(1), 116; https://doi.org/10.3390/agronomy14010116
Submission received: 8 December 2023 / Revised: 23 December 2023 / Accepted: 29 December 2023 / Published: 2 January 2024
(This article belongs to the Special Issue Locust and Grasshopper Management: Environmental Impacts and New Perspectives)
Browse Figures
Review Reports Versions Notes

Abstract

:
Biological control methods provide a sustainable approach for reducing agricultural losses caused by locust plagues. Space mutagenesis can generate high numbers of mutations using satellites and spacecrafts, including beneficial and stable mutants. Aspergillus oryzae XJ-1 was recently reported to show high virulence against locusts. We subjected this fungal pathogen to space mutagenesis to obtain more effective strains. Pathogen conidia powder was mutated in the China Space Station for 6 months. We obtained five mutants of A. oryzae XJ-1, TQ201, TQ238, TQ302, TQ549, and TQ555, and all mutants were identified as A. oryzae by molecular techniques. TQ549 showed the highest virulence against adult L. migratoria (LT50: 4.97 ± 0.21 days); the LT50 of A. oryzae XJ-1 was 5.67 ± 0.06 days. Both TQ549 and A. oryzae XJ-1 grew most rapidly at 33 °C on potato dextrose agar (PDA) plates. There was no significant difference in the growth rate of TQ549 and A. oryzae XJ-1 at 24 °C. The colony morphological characteristics of the five mutants on PDA plates differed from that of A. oryzae XJ-1. The space mutant TQ549, which showed high virulence against adult locusts, could be used as a biological control agent for the control of locust infestations.

Graphical Abstract

1. Introduction

Locusts are economically significant agricultural pests, and the livelihoods of approximately 1/10 of the human population are affected by locusts. Locust outbreaks are responsible for major losses of crops on an annual basis [1,2,3]. Chemical pesticides have been the main method for the control of locusts since the 1940s, but pesticide residues can have negative effects on the health of humans and the environment [1,4].
Environmentally friendly biopesticides have been widely applied [5]. Some microorganisms, such as protozoa (e.g., Nosema locustae), fungi (e.g., Metarhizium spp. and Beauveria spp.), and viruses (e.g., entomopoxvirus), have been reported to be important pathogens of locusts and grasshoppers [3,6,7,8,9,10,11,12,13,14,15], and protozoa and fungi have been widely used as microbial control agents; they have been shown to be effective alternatives to chemical pesticides for the control of locust infestations [1,14]. These two microbial control agents could induce the mortality of 60–80% of locust nymphs, but their effectiveness against adult locusts is poor. It is necessary to develop a new microbial control agent that has higher virulence to adult locusts.
Generally, Aspergillus oryzae has been one major component of the leaven in traditional fermented food such as soy sauce, soybean paste and rice wine in China, Japan, and other Asian countries for centuries [16]. A. oryzae does not produce the most potent natural carcinogen, aflatoxin, or any other carcinogenic metabolites. It is listed as Generally Recognized as Safe (GRAS) by the Food and Drug Administration (FDA) in the USA. The pathogenicity of Aspergillus to locust is rarely reported. A. flavus was reported to have high virulence to the desert locust Schistocerca gregaria in 1975, but until now, no further research was reported [17]. We had isolated and identified a new fungal locust pathogen A. oryzae XJ-1 from a dead locust collected in the Chonghuer grassland of Altay Prefecture, Xinjiang Uyghur Autonomous Region, China, in 2011, which was highly virulent in third-instar nymphs of L. migratoria in a laboratory study [18]. Recently, we found that A. oryzae XJ-1 could also effectively control adult locust infestations in both laboratory experiments and field trials [19].
The main factor limiting the efficacy of most microbial control agents is that locusts are not rapidly killed, and mortality is often not achieved until 10 days after application, or even longer [1,2,4,6,7,8,9,10,11]. Locusts can grow and develop rapidly and form heavy swarms [1,3]. Adult locust swarms can migrate long distances; for instance, desert locust adult swarms can migrate more than 150 km/day [2]. Achieving rapid control of adult locust populations remains a major challenge in the biological control of locust plagues.
Physical and chemical mutagenesis [20] and space mutagenesis [21] have been used to generate mutant microorganisms for screening highly efficient strains. Space mutagenesis can generate high numbers of mutations and yield variable and stable mutants [22]. The vast, cold, and radiation-filled conditions of outer space pose major challenges for all organisms [23]. Microorganisms rapidly adapt to environmental changes by altering the expression of their genes [24]. A variety of mutants of bacteria, fungi, animals, and plants have been generated by space mutagenesis using satellites and spacecrafts. To obtain strains with greater virulence, we conducted space mutagenesis of the conidia powder of A. oryzae XJ-1 in the China Space Station; we then screened the mutants based on the morphological characteristics of colonies on potato dextrose agar (PDA) plates and determined their virulence against adult locusts. We also evaluated the growth rate of the strains at different temperatures on PDA plates in the lab. We obtained a highly virulent space mutant strain, TQ549, which has white colonies and has the potential to be used for the control of locust infestations.

2. Materials and Methods

2.1. Screening and Identification of A. oryzae XJ-1 Mutants

Space mutagenesis of 5 g of conidia powder of A. oryzae XJ-1 was performed on the Shenzhou-14 crewed spaceship from 5 June 2022 to 4 December 2022. A small quantity of conidia powder was suspended in 120 mL of sterile distilled water with 0.3% (v/v) Tween-80. A hemocytometer was used to determine the concentration; it was then adjusted to 1000 conidia mL−1. Next, 100 µL of conidia suspension was spread on a PDA plate and incubated at 30 °C for 3 days in an incubator. No more than 10 colonies will grow on every PDA plate. A total of 1200 PDA plates were inoculated. Observations of these agar plates were made every day, and mutants were screened by comparing colony shape and color to that of A. oryzae XJ-1. These mutants were placed in a freezer at −40 °C for subsequent experiments. Mutants of A. oryzae XJ-1 were grown in PDA liquid medium broth for 3 days. The mycelia were harvested and then ground using the liquid nitrogen method. DNA was extracted using the TIANgel Midi Purification Kit (Tiangen, Beijing, China), according to the manufacturer’s instructions. The ITS sequences of mutants were amplified using the universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) and the Go Taq® Green Master Mix (Promega Corporation, Madison, WI, USA). The thermal cycling conditions were as follows: initial denaturation at 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s; and a final extension of 72 °C for 10 min. These ITS sequences were cloned in the pGEM-T vector using the pGEM®-T Vector System I (Promega Corporation, Madison, WI, USA) and sequenced. This process was repeated 3 times for each strain. Multiple sequence alignment was performed using BioEdit 7.0.9 software to analyze the relationships between the mutants and A. oryzae XJ-1 (GenBank: KP067321).

2.2. Comparison of the Virulence of A. oryzae Mutants and XJ-1 against Adult L. migratoria

L. migratoria adults were reared in the Biocontrol Laboratory of the Institute of Plant Protection at the Shandong Academy of Agricultural Sciences. Adult locusts were tested 2–8 days after eclosion. Locusts were fed fresh wheat seedlings daily at 28–30 °C and 60% relative humidity and under an 18 h/6 h light/dark photoperiod. Feces were regularly removed from the locust enclosures.
A bioassay experiment was preliminarily conducted to screen mutants with high virulence, mainly according to You et al. (2023) [19]. Briefly, a total of 100 healthy adults of L. migratoria were equally divided into five groups for virulence bioassays of TQ201, TQ238, TQ302, TQ549, and TQ555. The tested locusts were inoculated by individually immersing them in 106 conidia mL−1 suspension in Petri dishes for less than 1 s. All treated locusts were dried and then individually reared after treatment in a plastic box with a round top (diameter, 14 cm), round bottom (diameter, 9 cm), and height of 14. Dead locusts were collected and recorded daily for 15 days after treatment. Another bioassay was performed to compare the virulence of TQ549 and A. oryzae XJ-1. A total of 60 healthy adults of L. migratoria were equally divided into three groups and inoculated with 106 conidia mL−1 suspension of TQ549, A. oryzae XJ-1, and 0.3% (vol/vol) Tween-80 solution, which was used as a control. Three replications of all experiments were performed. The virulence of A. oryzae XJ-1 and mutants was analyzed. An infection experiment was performed as described in You et al. (2023) [19]. Briefly, dead locusts inoculated with A. oryzae XJ-1 and mutants were collected in the bioassay experiment. Each dead locust was placed on a sterilized glass slide on a sterilized filter paper in a sterilized Petri dish, and 200 μL of sterile water was added to soak the filter paper. The Petri dish was placed in an incubator at 28 °C for 7 days. Every two days, the growth of A. oryzae XJ-1 and the mutants on the locusts was observed and recorded. We used these two methods to demonstrate the virulence of the mutants.

2.3. Comparison of the Optimal Growth Temperature of TQ549 and A. oryzae XJ-1

One µL of conidia suspension of TQ549 and A. oryzae XJ-1 was inoculated on the center of a PDA plate and incubated at 24, 26, 28, 30, 32, 33, 34, 35, 36, and 38 °C in incubators. The growth rates of TQ549 and A. oryzae XJ-1 were evaluated by measuring colony diameters every day with a ruler from the back of culture dishes until the 8th day after inoculation. Three replications of the experiments were performed.

2.4. Statistical Analysis

All analyses were conducted in Origin 2022b software (OriginLab, Northampton, MA, USA). One-way ANOVA followed by Tukey’s post hoc test was used to evaluate differences in the corrected mortality and the median lethal time (LT50) between TQ549 and A. oryzae XJ-1. A Student’s t-test was used to analyze differences in the colony diameter between groups. LT50 was determined using probit (logit) analysis with Excel 2016 Software (Microsoft, Redmond, WA, USA).

3. Results

3.1. Screening and Identification of XJ-1 Mutants

Five mutants were obtained from 564 colonies developed from a monospore following treatment with space mutagenesis. The colonies of TQ201, TQ238, and TQ302 were fluffier than the colony of A. oryzae XJ-1 on the PDA plate, and the conidial color of these three mutants was all green, just like A. oryzae XJ-1; the conidial color of TQ549 and TQ555 was white and golden yellow on the PDA plate, respectively, whereas the conidial color of A. oryzae XJ-1 was green (Figure 1). These five mutants could infect and grow in adult locusts; they eventually covered the bodies of dead locusts, especially TQ549, and as a result they mainly exhibited a white color (Figure 1). To further identify whether these mutants were A. oryzae XJ-1 mutants, the ITS sequences of these five mutants were amplified by PCR, then cloned and sequenced (Figure 2). The ITS sequences of A. oryzae XJ-1 and its mutants were all 595 bp. These ITS sequences were deposited in the GenBank database (accession numbers: OR866213.1, OR878662.1, OR875384.1, OR878663.1, and OR878664.1). The ITS sequences of the five mutants were compared with that of A. oryzae XJ-1 (GenBank accession number: KP067321). The ITS sequence of TQ302 differed from that of A. oryzae XJ-1 by three base pairs, and the sequence similarity was 99.50%; however, only two base pair differences were detected between the ITS sequences of the other four mutants and that of A. oryzae XJ-1, and their sequence similarities were all 99.66% (Table 1, Supplementary Figure S1). These findings indicated that these five mutants were all A. oryzae XJ-1 mutants generated by space mutagenesis.

3.2. Virulence of Mutants against L. migratoria Adults in the Laboratory

We examined the virulence of five mutants against L. migratoria adults by inoculation at a concentration of 106 conidia mL−1. TQ549 induced the highest cumulative mortality within the shortest time as the curve of mortality peaked at 96.67 ± 1.67% on the 9th day after inoculation. The cumulative mortality of locusts caused by TQ201 was second to that caused by TQ549 and peaked on the 15th day after inoculation. The mortalities of locusts caused by the other three mutants were not over 95%, even on the 15th day in the same experimental period. The cumulative mortality of the adult locusts caused by TQ302 was the lowest and peaked at 50.00 ± 5.78% on the 15th day after inoculation (Figure 3). We also conducted an experiment to compare the virulence of TQ549 and A. oryzae XJ-1. The corrected cumulative mortalities of TQ549 on the 6th (72.71 ± 3.24%), 7th (81.01 ± 2.33%), 8th (86.49 ± 2.08%), and 9th (90.41 ± 1.86%) days after treatment were significantly higher than those of wild type, A. oryzae XJ-1, on the 6th (56.34 ± 0.78%), 7th (67.70 ± 2.99%), 8th (74.95 ± 2.21%), and 9th (82.68 ± 0.33%) days, respectively (Figure 4A). The LT50 of TQ549 (4.97 ± 0.21 days) was significantly lower than that of A. oryzae XJ-1 (5.67 ± 0.06 days), indicating that TQ549 caused the death of locust adults more rapidly than A. oryzae XJ-1, and the virulence of TQ549 was higher than that of A. oryzae XJ-1 (Figure 4B).

3.3. Comparison of the Growth Rates of TQ549 and A. oryzae XJ-1 at Different Temperatures

The diameters of the colonies of both TQ549 and A. oryzae XJ-1 peaked at 33 °C within 5–6 days among the various temperatures tested (24, 26, 28, 30, 32, 33, 34, 35, 36, and 38 °C); however, at other temperatures, more time was required for the peak diameter to be achieved, indicating that 33 °C was the optimal growth temperature for the two strains on the PDA plate (Figure 5). No significant differences in growth between TQ549 and A. oryzae XJ-1 were observed on all days at 24 °C (Table 2). However, significant differences in their growth were observed on the 3rd, 4th, and 5th days after inoculation at 33 °C, indicating that TQ549 grew slower than A. oryzae XJ-1 during the middle of the experimental period at 33 °C; however, no significant differences in growth were observed after this period (Table 2). Significant differences in the growth of the two strains were observed on the 2nd, 3rd, 4th, and 8th days after inoculation at 38 °C (Table 2).

4. Discussion

Five mutants were screened from 564 strains of A. oryzae XJ-1 generated by space mutagenesis. The colony morphological characteristics of these five mutants on PDA plates differed from that of A. oryzae XJ-1. Identification of these mutants according to analysis of their ITS sequences revealed that they belonged to A. oryzae. Experiments aimed at evaluating the mortality rates of these mutants and A. oryzae XJ-1 against L. migratoria adults showed that only one white colony of the mutant TQ549 exhibited higher virulence than the original strain A. oryzae XJ-1; the virulences of the other four mutants were lower than that of A. oryzae XJ-1. Changes in virulence may stem from the radiation-filled conditions of outer space [23]. In the filamentous fungus Aspergillus fumigatus, low-nutrient environments combined with enhanced irradiation and microgravity might trigger changes in the molecular suite of microorganisms with increased virulence and resistance to microbes [25]. Pathogenicity genes of the mutants might contribute to the observed changes in the mutants. Five mutants had different virulence against adult locusts, indicating that different pathogen-related genes might be mutated in every mutant. So, these mutants were good materials for exploring the pathogenic molecular mechanism of A. oryzae XJ-1. Comparison of the genes in these mutants and A. oryzae XJ-1 coupled with molecular biological methods could provide insights into the molecular mechanism by which A. oryzae XJ-1 infects locusts. Such studies could shed light on how genes could be modified to increase the virulence of Aspergillus spp., which could aid the development of more effective biological control agents for the control of locusts.
In our experiment, two colonies of mutants on PDA plates were acquired with different conidial colors, TQ549 (white) and TQ555 (golden yellow), and changes in their pathogenicity were detected. The virulence of TQ549 was higher than that of A. oryzae XJ-1; however, TQ555 was lower. This is consistent with the results of previous studies showing that conidial color might affect the pathogenicity of A. flavus [26] and A. fumigatus [27,28,29]. However, additional studies are needed to clarify the relationships between the color and pathogenicity of Aspergillus spp., including for our mutants. When we cultured the mutants and A. oryzae XJ-1 on PDA plates, we found TQ555 grew much slower than the other four mutants and A. oryzae XJ-1. Low growth rate of TQ555 may be one reason for low virulence against adult locusts.
Adaptation to a wide range of temperatures is important for the control of locusts, because locusts are widely distributed in tropical and temperate regions. Our experiment on the effect of temperature on A. oryzae XJ-1 and the space mutant TQ549 showed that the optimal growth temperature was 33 °C for both TQ549 and A. oryzae XJ-1. TQ549 and A. oryzae XJ-1 could grow relatively rapidly on a PDA plate at 24 and 38 °C, indicating that these two strains might be adapted to a wide temperature range. The temperatures of central and southern China when locusts are most active often exceed 35 °C. A. oryzae XJ-1 had been applied for the control of locusts at temperatures ranging from 26 to 38 °C in China during 2022 in a large-scale field experiment, and the control efficacy of A. oryzae XJ-1 under these conditions was high [19]. Therefore, TQ549 might be effective for the control of locusts over a wide temperature range as well.
The space mutant TQ549 caused the highest cumulative mortality within the shortest time when L. migratoria adults were inoculated at a concentration of 106 conidia mL−1 in five mutants; the mortality was over 80% on the 6th day and reached the peak at 96.67 ± 1.67% on the 9th day after inoculation. By comparing the corrected cumulative mortality and the LT50 between TQ549 and wild type, A. oryzae XJ-1, we can conclude that the mutant TQ549 could kill locust adults more quickly than A. oryzae XJ-1. This is important to overcome the main challenge: that most locust microbial control agents cannot kill locusts rapidly, particularly adult locusts. Metarhizium spp. and P. locustae are the main biological pesticides used in locust control nowadays, but they need over 10 days to achieve good control efficacy [1,2,4,6,7,8,9,10,11]. The most notorious migratory desert locust can form heavy adult swarms rapidly and then migrate long distances [1,2,3]. East Africa suffered from the worst desert locust outbreak in decades in 2019–2020, about 360 billion desert locusts in Ethiopia, Kenya, Somalia, South Sudan, Uganda, and the United Republic of Tanzania [30]. Controlling locust as quickly as possible will not only prevent locust adult swarms from dispersing and infesting large area but also reduce the loss of crops. This mutant provides a possibility to develop a relatively quicker biological control agent as an alternative to chemical pesticide in adult locust control.
Though we have screened a more virulent space mutant, TQ549, as a potential biological control agent against locust adults in laboratory and demonstrated its original fungus, A. oryzae XJ-1, effectively controlling locusts in a field trial [18,19], more experiments in the field are needed to develop application methods, such as application rates and conditions, and to understand factors that influence the efficacy of TQ549 in controlling locust adults. Furthermore, we only demonstrated the efficacy of TQ549 on L. migratoria adult in this experiment. As we know, the locust has quite a long nymphal developmental stage, including 1–5 or 6 instar nymphs; as such, to save crops, it is also very important to control nymphs. Therefore, more experiments must be conducted to check the efficacy of TQ549 against locust nymphs.
In the world, there are more than 500 species of acridids (Orthoptera: Acridoidea) that can cause damage to pastures and crops, and about 50 are considered major pests [1]. Previous reports indicated that microbial control agents including N. locustae and Metarhizium could cause different pathogenicity in different species of locusts and grasshoppers [31]. It is necessary to determine the pathogenicity of the mutant TQ549 against each economically important species of grasshopper and locust in the world and particularly those in China, such as Calliptamus italicus, Oedaleus asiaticus, Ceracris kiangsu, Calliptamus abbreviates, Oxya chinensis, and Epacromius coerulipes. This will be very useful for expanding the application of the mutant TQ549 in the future.
In addition, to develop a more sophisticated biological control system in locust and grasshopper whole life cycles, more research is required to determine how the mutant TQ549 may be integrated with A. oryzae XJ-1, or N. locustae, or Metarhizium spp. for better applications according to the features of these previous biological control agents. Previous studies have demonstrated that concurrent use of N. locustae and Metarhizium spp. could result in additive effects on locusts and grasshoppers [31]. So, this work will help to develop a better integrated locust management system.

5. Conclusions

  • Five mutants were screened from A. oryzae XJ-1 generated by space mutagenesis, and the morphological characteristics of their colonies on PDA plates differed from that of A. oryzae XJ-1. Analysis of their ITS sequences indicated that all these mutants belonged to A. oryzae.
  • Experiments on the mortality rates of these mutants and A. oryzae XJ-1 against L. migratoria adults showed that only one mutant, TQ549, exhibited higher virulence than the original strain, A. oryzae XJ-1, and the virulences of the other four mutants were all lower than that of A. oryzae XJ-1.
  • Our results indicated that space mutant TQ549, which had white conidia, high virulence against adult locusts, and tolerance of a wide temperature range, had the potential to be used as a biological agent for the control of locusts.
  • These mutants with different virulence against adult locusts will provide us with good materials to research the pathogenic molecular mechanism of A. oryzae XJ-1 by comparison of genomes and transcriptomes of A. oryzae XJ-1 and the mutants.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy14010116/s1, Figure S1: ITS multiple sequence alignment between five mutants and A. oryzae XJ-1.

Author Contributions

L.Z. and Y.Y. conceived and designed research; X.F., H.L., X.X., J.G., S.H., Y.Y. and L.Z. conducted the experiments; Y.Y. and L.Z. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key R&D Program of China 2022YFD1400500 and the Agricultural Scientific and Technological Innovation Project of Shandong Academy of Agricultural Sciences CXGC2023F04.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors are thankful for the help of Shuhan Liu, Pengfei Liu, Weijia Song, and Ruipeng Li for screening and bioassay experiments.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  1. Zhang, L.; Lecoq, M.; Latchininsky, A.; Hunter, D. Locust and grasshopper management. Annu. Rev. Entomol. 2019, 64, 15–34. [Google Scholar] [CrossRef] [PubMed]
  2. Lecoq, M.; Zhang, L. Encyclopedia of Pest Orthoptera of the World; China Agricultural University Press: Beijing, China, 2019. [Google Scholar]
  3. Bennett, L.V. Development of a desert locust plague. Nature 1975, 256, 486–487. [Google Scholar] [CrossRef] [PubMed]
  4. Lomer, C.J.; Bateman, R.P.; Johnson, D.L.; Langewald, J.; Thomas, M. Biological control of locusts and grasshoppers. Annu. Rev. Entomol. 2001, 46, 667–702. [Google Scholar] [CrossRef] [PubMed]
  5. Kumar, J.; Ramlal, A.; Mallick, D.; Mishra, V. An overview of some biopesticides and their importance in plant protection for commercial acceptance. Plants 2021, 10, 1185. [Google Scholar] [CrossRef]
  6. Brooks, W.M. Entomogenous protozoa. In CRC Handbook of Natural Pesticides. Microbial Insecticides, Part A: Entomogenous Protozoa and Fungi; Ignoffo, C.M., Ed.; CRC Press: Boca Raton, FL, USA, 1988; Volume 5, pp. 1–49. [Google Scholar]
  7. Henry, J.E.; Oma, E.A. Pest control by Nosema locustae, a pathogen of grasshoppers and crickets. In Microbial Control of Pests and Plant Diseases (1970–1980); Burges, H.D., Ed.; Academic Press: New York, NY, USA, 1981; pp. 573–586. [Google Scholar]
  8. Henry, J.E. Epizootiology of infections by Nosema locustae Canning (Microsporidia: Nosematidae) in grasshoppers. Acrida 1972, 1, 111. [Google Scholar]
  9. Henry, J.E. Experimental application of Nosema locustae for control of grasshoppers. J. Invertebr. Pathol. 1971, 18, 389. [Google Scholar] [CrossRef]
  10. Henry, J.E.; Tiahrt, K.; Omaha, E.A. Importance of timing, spore concentrations, and levels of spore carrier in application of Nosema locustae (Microsporida: Nosematidae) for control of grasshoppers. J. Invertebr. Pathol. 1973, 21, 263. [Google Scholar] [CrossRef]
  11. Lomer, C.J.; Prior, C.; Kooyman, C. Development of Metarhizium spp. for the control of grasshoppers and locusts. Mem. Entomol. Soc. Can. 1997, 129, 265–286. [Google Scholar] [CrossRef]
  12. Streett, D.A.; Woods, S.A.; Erlandson, M.A. Entomopoxviruses of grasshoppers and locusts: Biology and biological control potential. Mem. Entomol. Soc. Can. 1997, 129, 115–130. [Google Scholar] [CrossRef]
  13. Bateman, R.; Carey, M.; Batt, D.; Prior, C.; Abraham, Y.; Moore, D.; Jenkins, N.; Fenlon, J. Screening for virulent isolates of entomopathogenic fungi against the desert locust, Schistocerca gregaria Forskal. Biocontrol Sci. Technol. 1996, 6, 549–560. [Google Scholar] [CrossRef]
  14. Jaronski, S.T.; Goettel, M.S. Development of Beauveria bassiana for control of grasshoppers and locusts. Mem. Entomol. Soc. Can. 1997, 129, 225–237. [Google Scholar] [CrossRef]
  15. Inglis, G.; Johnson, D.L.; Goettel, M.S. Field and laboratory evaluation of two conidial batches of Beauveria bassiana (balsamo) vuillemin against grasshoppers. Can. Entomol. 1997, 129, 171–186. [Google Scholar] [CrossRef]
  16. Zhong, Y.Y.; Lu, X.; Xing, L.; Ho, S.W.A.; Kwan, H.S. Genomic and transcriptomic comparison of Aspergillus oryzae strains: A case study in soy sauce koji fermentation. J. Ind. Microbiol. Biot. 2018, 45, 839–853. [Google Scholar] [CrossRef] [PubMed]
  17. Venkatesh, M.V.; Joshi, K.R.; Harjai, S.C.; Ramdeo, I.N. Aspergillosis in desert locust (Schistocerka gregaria Forsk). Mycopathologia 1975, 57, 135–138. [Google Scholar] [CrossRef]
  18. Zhang, P.; You, Y.; Song, Y.; Wang, Y.; Zhang, L. First record of Aspergillus oryzae (Eurotiales: Trichocomaceae) as an entomopathogenic fungus of the locust, Locusta migratoria (Orthoptera: Acrididae). Biocontrol Sci. Technol. 2015, 25, 1285–1298. [Google Scholar] [CrossRef]
  19. You, Y.; An, Z.; Zhang, X.; Liu, H.; Yang, W.; Yang, M.; Wang, T.; Xie, X.; Zhang, L. Virulence of the fungal pathogen, Aspergillus oryzae XJ-1 to adult locusts (Orthoptera: Acrididae) in both laboratory and field trials. Pest Manag. Sci. 2023, 79, 3767–3772. [Google Scholar] [CrossRef]
  20. Suryadi, H.; Irianti, M.I.; Septiarini, T.H. Methods of random mutagenesis of Aspergillus strain for increasing kojic acid production. Curr. Pharm. BiotechnoI. 2022, 23, 486–494. [Google Scholar] [CrossRef]
  21. Milojevic, T.; Weckwerth, W. Molecular mechanisms of microbial survivability in outer space: A systems biology approach. Front. Microbiol. 2020, 11, 923. [Google Scholar] [CrossRef]
  22. Wang, J.; Liu, C.; Liu, J.; Fang, X.; Xu, C.; Guo, Y.; Chang, D.; Su, L. Space mutagenesis of genetically engineered bacteria expressing recombinant human interferon α1b and screening of higher yielding strains. World J. Microbiol. Biotechnol. 2014, 30, 943–949. [Google Scholar] [CrossRef]
  23. Horneck, G.; Klaus, D.M.; Mancinelli, R.L. Space Microbiology. Microbiol. Mol. Biol. Rev. 2010, 74, 121–156. [Google Scholar] [CrossRef]
  24. Acres, J.M.; Youngapelian, M.J.; Nadeau, J. The influence of spaceflight and simulated microgravity on bacterial motility and chemotaxis. NPJ Microgravity 2021, 7, 7. [Google Scholar] [CrossRef] [PubMed]
  25. Blachowicz, A.; Chiang, A.J.; Romsdahl, J.; Kalkum, M.; Wang, C.C.C.; Venkateswaran, K. Proteomic characterization of Aspergillus fumigatus isolated from air and surfaces of the International Space Station. Fungal Genet. Biol. 2019, 124, 39–46. [Google Scholar] [CrossRef] [PubMed]
  26. Cary, J.W.; Harris-Coward, P.Y.; Ehrlich, K.C.; Di Mavungu, J.D.; Malysheva, S.V.; De Saeger, S.; Dowd, P.F.; Shantappa, S.; Martens, S.L.; Calvo, A.M. Functional characterization of a veA-dependent polyketide synthase gene in Aspergillus flavus necessary for the synthesis of asparasone, a sclerotium-specific pigment. Fungal Genet. Biol. 2014, 64, 25–35. [Google Scholar] [CrossRef] [PubMed]
  27. Jacobson, E.S. Pathogenic roles for fungal melanins. Clin. Microbiol. Rev. 2000, 13, 708–717. [Google Scholar] [CrossRef]
  28. Akoumianaki, T.; Kyrmizi, I.; Valsecchi, I.; Gresnigt, M.S.; Samonis, G.; Drakos, E.; Boumpas, D.; Muszkieta, L.; Prevost, M.C.; Kontoyiannis, D.P.; et al. Aspergillus cell wall melanin blocks LC3-associated phagocytosis to promote pathogenicity. Cell Host Microbe 2016, 19, 79–90. [Google Scholar] [CrossRef]
  29. Kyrmizi, I.; Ferreira, H.; Carvalho, A.; Figueroa, J.A.L.; Zarmpas, P.; Cunha, C.; Akoumianaki, T.; Stylianou, K.; Deepe, G.S., Jr.; Samonis, G.; et al. Calcium sequestration by fungal melanin inhibits calcium-calmodulin signalling to prevent LC3-associated phagocytosis. Nat. Microbiol. 2018, 3, 791–803. [Google Scholar] [CrossRef]
  30. Anonymous. Funding gap for locust crisis. Nat. Food 2020, 1, 143. [Google Scholar]
  31. Zhang, L.; Lecoq, M. Nosema locustae (Protozoa, Microsporidia), a biological agent for locust and grasshopper control. Agronomy 2021, 11, 711. [Google Scholar] [CrossRef]
Agronomy 14 00116 g001
Figure 1. The morphological characteristics of the colonies of mutants and A. oryzae XJ-1 in PDA plates and infected locust adults.
Figure 1. The morphological characteristics of the colonies of mutants and A. oryzae XJ-1 in PDA plates and infected locust adults.
Agronomy 14 00116 g001
Agronomy 14 00116 g002
Figure 2. The colony PCR of ITS sequences of five mutants and A. oryzae XJ-1. Three colony PCR reactions were performed for each sample.
Figure 2. The colony PCR of ITS sequences of five mutants and A. oryzae XJ-1. Three colony PCR reactions were performed for each sample.
Agronomy 14 00116 g002
Agronomy 14 00116 g003
Figure 3. The cumulative mortalities of locust adults caused by inoculation with mutants at a concentration of 106 conidia mL−1. Bar: SE.
Figure 3. The cumulative mortalities of locust adults caused by inoculation with mutants at a concentration of 106 conidia mL−1. Bar: SE.
Agronomy 14 00116 g003
Agronomy 14 00116 g004
Figure 4. Comparison of the virulence of TQ549 and A. oryzae XJ-1 against locust adults. (A) Corrected mortalities of two strains against locust adults at a concentration of 106 conidia mL−1. Asterisk indicates significant difference between treatments on the same day, according to One-way ANOVA comparison with Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Bar: SE; (B) LT50 of two strains. Bar: SE. One-way ANOVA comparison with Tukey’s multiple comparisons test. p = 0.019, *, p < 0.05, **, p < 0.01.
Figure 4. Comparison of the virulence of TQ549 and A. oryzae XJ-1 against locust adults. (A) Corrected mortalities of two strains against locust adults at a concentration of 106 conidia mL−1. Asterisk indicates significant difference between treatments on the same day, according to One-way ANOVA comparison with Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Bar: SE; (B) LT50 of two strains. Bar: SE. One-way ANOVA comparison with Tukey’s multiple comparisons test. p = 0.019, *, p < 0.05, **, p < 0.01.
Agronomy 14 00116 g004
Agronomy 14 00116 g005
Figure 5. Growth rates of A. oryzae XJ-1 (A) and TQ549 (B) at different temperatures, as indicated by the colony diameter. Bar: SE.
Figure 5. Growth rates of A. oryzae XJ-1 (A) and TQ549 (B) at different temperatures, as indicated by the colony diameter. Bar: SE.
Agronomy 14 00116 g005
Table 1. Molecular identification of five mutants by ITS sequences.
Table 1. Molecular identification of five mutants by ITS sequences.
StrainLength (bp)Result
TQ20159599.66% identity with A. oryzae XJ-1
TQ23859599.66% identity with A. oryzae XJ-1
TQ30259599.50% identity with A. oryzae XJ-1
TQ54959599.66% identity with A. oryzae XJ-1
TQ55559599.66% identity with A. oryzae XJ-1
Table 2. Comparison of the colony diameters of TQ549 and A. oryzae XJ-1 after inoculation from the 1st to 8th day at 24 °C, 33 °C, and 38 °C.
Table 2. Comparison of the colony diameters of TQ549 and A. oryzae XJ-1 after inoculation from the 1st to 8th day at 24 °C, 33 °C, and 38 °C.
Days24 °C33 °C38 °C
A. oryzae XJ-1TQ549A. oryzae XJ-1TQ549A. oryzae XJ-1TQ549
16.20 ± 0.37 a7.25 ± 0.37 a13.85 ± 0.31 a14.00 ± 0.22 a8.44 ± 0.26 a8.88 ± 0.13 a
220.60 ± 0.40 a21.38 ± 0.26 a33.25 ± 0.41 a33.00 ± 0.26 a25.38 ± 0.18 a23.88 ± 0.31 b
334.80 ± 0.20 a35.25 ± 0.16 a53.75 ± 0.56 a51.30 ± 0.20 b35.75 ± 0.16 a33.63 ± 0.13 b
447.80 ± 0.20 a47.13 ± 0.48 a70.81 ± 0.53 a67.20 ± 0.20 b43.50 ± 0.27 a40.50 ± 0.29 b
560.00 ± 0.55 a59.38 ± 0.84 a82.50 ± 0.50 a80.80 ± 0.49 b51.25 ± 0.46 a48.50 ± 0.87 a
670.60 ± 0.40 a69.25 ± 1.17 a82.50 ± 0.50 a83.40 ± 0.40 a59.00 ± 0.34 a56.87 ± 1.05 a
774.60 ± 0.51 a74.50 ± 0.73 a84.00 a83.60 ± 0.10 a67.13 ± 0.67 a66.00 ± 1.41 a
875.20 ± 0.37 a78.50 ± 1.51 a84.00 a84.00 a77.75 ± 0.49 a72.88 ± 1.09 b
Note: Different characters after the numbers indicate significant differences between TQ549 and A. oryzae XJ-1 on the same day and at the same temperature, according to t-tests.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Fu, X.; Liu, H.; Xu, X.; Guo, J.; Hu, S.; You, Y.; Zhang, L. Comparison of the Virulence of Space Mutants of Aspergillus oryzae XJ-1 against Adult Locusta migratoria. Agronomy 2024, 14, 116. https://doi.org/10.3390/agronomy14010116

AMA Style

Fu X, Liu H, Xu X, Guo J, Hu S, You Y, Zhang L. Comparison of the Virulence of Space Mutants of Aspergillus oryzae XJ-1 against Adult Locusta migratoria. Agronomy. 2024; 14(1):116. https://doi.org/10.3390/agronomy14010116

Chicago/Turabian Style

Fu, Xin, Hui Liu, Xiao Xu, Jin Guo, Shaojing Hu, Yinwei You, and Long Zhang. 2024. "Comparison of the Virulence of Space Mutants of Aspergillus oryzae XJ-1 against Adult Locusta migratoria" Agronomy 14, no. 1: 116. https://doi.org/10.3390/agronomy14010116

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop