Next Article in Journal
Rootstocks Alter the Seasonal Dynamics and Vertical Distribution of New Root Growth of Vitis vinifera cv. Shiraz grapevines
Next Article in Special Issue
Integrative Analysis of the DUF668 Gene Family in Nicotiana tabacum to Excavate Their Potential Roles in Abiotic Stress Responses
Previous Article in Journal
Breeding Novel Rice Hybrids for Aerobic Ecology: A Way Out from Global Warming and Water Crisis
Previous Article in Special Issue
A Cationic Amino Acid Transporter NtCAT1 Promotes Leaf Senescence by the Accumulation of ABA in Nicotiana tabacum
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 9
10.3390/agronomy13092354
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.)

by
Shaomei Wang
1,2,†,
Xinru Wu
1,†,
Yongfeng Guo
1,
Dawei Wang
1,
Lirui Cheng
1,
Yuanying Wang
1,
Aiguo Yang
1,* and
Guanshan Liu
1,*
1
Key Laboratory for Tobacco Gene Resources, Tobacco Research Institute, Chinese Academy of Agricultural Sciences, Qingdao 266101, China
2
Graduate School of Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2023, 13(9), 2354; https://doi.org/10.3390/agronomy13092354
Submission received: 29 June 2023 / Revised: 15 August 2023 / Accepted: 18 August 2023 / Published: 11 September 2023
(This article belongs to the Special Issue Emerging Topics in Tobacco Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:
Leaf morphology and plant height are two agronomic traits closely related to tobacco (Nicotiana tabacum L.) yield and quality. The study of leaf morphology and plant stature mutants will greatly contribute to the fields of plant architecture breeding and developmental biology. Here, we report the characterization of a spiral leaf and dwarf (sld) mutant identified from an ethylmethane sulfonate (EMS)-induced common tobacco population. The sld mutant displayed the phenotype of wrinkled, spiral, and miniature leaves, with the growth point as the central axis and plant dwarfing with shortened internodes. The inheritance pattern of the sld mutant phenotype was manipulated by a recessive nuclear monogene, which was linked to six tobacco simple sequence repeat (SSR) markers from linkage group 5 via gene mapping. Utilizing an F2 population, the sld mutant gene the sld mutant gene was located between the co-segregated markers PT51778, PT54913, and the marker PT61414, with an equal genetic distance of 0.16 cM. Taking advantage of a BC1F1 population, the markers PT51778, PT54913, the sld gene, and the marker PT61414 demonstrated co-segregation, located between the markers PT40040 and PT60933, respectively, with a genetic distance of 1.37 cM and 6.32 cM, respectively. These findings will be helpful in cloning the sld gene and in the further characterization of the regulatory genes controlling the spiral and dwarfing phenotypes in tobacco.

1. Introduction

Tobacco is a cash crop, distributed worldwide, whose leaves are harvested. Leaf morphology and plant height are two agronomic traits that directly contribute to yield and quality in tobacco. Appropriate leaf morphology and plant height can ensure the sufficient accumulation of dry matter in tobacco leaves, so as to reap high-quality tobacco leaves. Meanwhile, tobacco, as a typical model plant, is widely used in plant biological research and has a great effect on the development of plant biotechnologies such as transgenic plants [1]. Studies on tobacco leaf morphology and plant height in various mutation phenotypes are helpful in revealing the mechanisms of plant development and assisting in the genetic improvement of tobacco.
Plant leaf morphology is genetically governed and influenced by environmental factors. Many genes involved in regulating leaf development have been identified in model plants [2,3,4]. Genes mutations related to leaf development cause abnormal leaf development [5,6,7,8,9,10], for example, curled/curved/rolling leaves. The dominant mutations Curl (Cu) leaf and Mouse-ear (Me) leaf in tomato are caused by the different abnormal transcriptional regulation patterns of Knottedl (Knf)-like genes [11]. Overexpression of the tobacco NTH1 gene results in slightly wrinkled and curved leaves, which present a clockwise or anticlockwise spiral phyllotaxy looking down from the shoot apex toward the base [1]. Mutation of the vital gene Rolled Fine Striped (RFS), encoding a chromodomain helicase DNA-binding 3 (CHD3)/Mi-2 subfamily ATP-dependent chromatin remodeling factor, leads to lack of vascular cell development on the adaxial side, resulting in rolling leaves [12]. LRRK1 (leaf rolling receptor-like cytoplasmic kinase 1) in rice negatively regulates leaf up-rolling through reducing the size of bulliform cells in the adaxial cell layers [13]. Maize mutant abrl1, with extreme abaxial rolling leaf, may be caused by the number and area of bulliform cells increasing [14]. The CLD1/SRL1 (SEMI-ROLLED LEAF 1) allele encodes a glycophosphatidylinositol (GPI)-anchored membrane protein. The rice mutation curled leaf and dwarf 1 (cld1) loses function through DNA methylation of CLD1, and significant decreases in cellulose and lignin contents emerge in the secondary cell walls of leaves, thereby leading to a decrease in the water retention capacity of the defective leaf epidermis [15,16].
Plant-specific transcription factors can participate in the formation of a curly leaf shape by changing leaf polarity. Mutations of TCP (TEOSINTE BRANCHED1/ CYCLOIDEA/ PROLIFERATING CELL FACTOR 1 and 2) transcription factors lead to upward crinkly leaves in marginal regions [17], a curling-upward leaf phenotype [18], and leaves with a downward or backward curvature [19]. The SHALLOT-LIKE1 gene, which acts with KANADI, controls rice leaf rolling [20]. Mutation or over-expression of the HD-ZIP III gene results in curly leaves in cucumber and rice [21,22]. Different expression patterns of miRNA165 and miRNA166 define the expression initiation site of HD-ZIP III family genes, resulting in curly leaves of maize or cucumber [21,23], but HD-ZIPII/HD-ZIPIII interaction affects leaves’ morphological development by inhibiting MIR165/166 [24,25]. ROC5 and ROC8, of the rice HD-Zip IV family, regulate bulliform cell development and modulate leaf rolling [26,27]. WUSCHEL-RELATED HOMEOBOX (WOX) mutants display the curly leaves [28]. YAB3 RNAi and WOX3 overexpression cause a similar twisted and knotted leaf phenotype in transgenic rice [29]. Ectopic expression of LOB generates plant-dwarfed phenotypes with leaves that are curl slightly upward [30,31,32,33].
Leaf development is also regulated by plant hormone (auxins and cytokinins etc) biosynthesis, transport, and distribution [34,35]. Overexpression of Aux/IAA family genes produces leaf curling [36,37]. Double mutants of Auxin Response Factor 3 (ARF3)/ETT and the closely ETT-related gene ARF4 in Arabidopsis exhibit leaf up-curling [38]. Ectopic overexpression of the WINDING 1 (WIN1) gene in rice leads to a higher auxin concentration distribution in leaf sheath excurvature side cells, and a leaf spiral phenotype [39]. Mutation of YUCCA6, encoding putative flavin monooxygenase enzymes, leads to excessive production of auxin and curled leaves phenotype of Arabidopsis [40,41].
There are many genes and pathways regulating the dwarfing phenotype in plants, the most important of which are transcription factors and plant hormones [42]. TCP14 and TCP15 genes influence plant height by promoting cell proliferation of young internodes; shorter plant phenotypes are enhanced due to the Arabidopsis tcp14tcp15 double mutant [43]. Suppressed expression of the rice DNL-4 gene encoding a Phosphofructokinase B-type (pfkB) carbohydrate kinase protein causes a dwarfed and narrow-leaf phenotype [44]. Substitution of amino acids in DELLA proteins, which are nuclear-localized negative regulators of gibberellin signaling within the GRAS multi-functional protein family, leads to a gain-of-function mutant repressing GA-induced degradation of DELLA, and a Brassica napus semi-dwarf mutant phenotype [45]. The long terminal repeat (LTR) retrotransposon inserted at the N-terminal DELLA domain of wheat Rht-B1c and foxtail millet DWARF1 (D1) separately brings about completely dominant extreme dwarfism and GA-insensitive semi-dominant dwarfism [46,47]. Sequential deletion of the ent-kaurenoic acid oxidase1 (HaKAO1) gene causes the reduction of active GAs and the extreme dwarf phenotype of the sunflower dwarf2 (dw2) mutant [48]. Overexpression or induction of the tobacco NTH15 (Nicotiana tabacum homeobox 15) gene causes curly and shrunk leaf phenotypes, which arises from a GA 20-oxidase expression-inhibited sharp decrease in GA1, and an increase in cytokinins [49,50,51].
Brassinosteriod(BR)-deficient mutations may cause dwarfing, shortened internodes, a slightly dwarfed stature, and semi-dwarfing [52,53,54,55,56,57]. In BR-signaling pathways, rice BR-insensitive mutants show erect leaves and dwarf culms [58]. RNAi silencing of OsBZR1, a positive regulator of BR signaling, leads to semi-dwarfism, and erect leaves [59]. The mutant of rice OsDLT, which encodes the GRAS family protein and regulates BR responses, causes dark green erect leaves, low tillering and late flowering, and a compact semi-dwarf stature [60]. The interaction of D1/TUD1, a heterotrimeric G protein α subunit, with the U-box E3 ubiquitin ligase regulates brassinosteroid (BR)-mediated growth, resulting in a dwarfed phenotype of rice Taihu Dwarf1; this is due to a decrease in cell proliferation and the disordered morphology of the stem [61]. Knockdown of the BR signal-related gene SDG725 leads to dwarfing, shortened internodes, erect leaves, and smaller seeds [62]. The scp-1, scp-2, cpa mutants of cucumber are BR biosynthesis-deficient mutants based on base mutation or base insertion, and display extremely dwarfed phenotypes [63,64,65]. Strigolactone (SL) biosynthesis defects lead to high or excessive tillering and dwarf phenotypes [66,67]. A single-nucleotide transition of the carotene isomerase-encoding gene reduces carotenoid biosynthesis and the amount of carotenoid-derived SLs, leading to an excessive tiller number and a dwarfed stature phenotype in rice [68]. The tryptophan-deficient dwarf1 (tdd1) mutant exhibits dwarfed, narrow leaves and abnormal flowers in rice, via the tryptophan (Trp)-dependent IAA biosynthesis pathway [69]. However, the progress of research on the development of leaf and plant stature in tobacco is still very limited.
In the current study, we identified a spiral leaf and dwarf (sld) mutant from an EMS mutagenesis population of a tobacco (Nicotiana tabacum L.) variety named Honghuadajinyuan (HD, wild-type, WT, with normal leaf morphology and plant height). The sld mutant displays spiral-growth leaves with the growth point as central axis, wrinkled and smaller leaves, reduced internodes, and shortened plant height. We studied the phenotypic segregation between the sld mutant and the wild-type HD (or the cultivated tobacco variety named Gexinsanhao (G3)). Additionally, preliminary mapping of the corresponding sld gene was performed between G3 and the sld mutant. The results will be helpful for furthering interpretations of the genetic basis of tobacco spiraling and dwarfing traits, and may also serve as a basis for the molecular breeding of particular tobacco plant morphologies.

2. Materials and Methods

2.1. Plant Materials and Genetic Populations

A spiral leaf and dwarf (sld) mutant, self-crossed for five generations (M5) to ensure the stability of its mutant phenotype, was derived from a cultivated variety of flue-cured tobacco (Nicotiana tabacum L.) named Honghuadajinyuan (HD), whose mutant populations were treated with a semi-lethal dose of the chemical mutagen ethylmethane sulfonate (EMS) [70,71]. The sld mutant seeds were initially provided by the Chinese Tobacco Mutant Library Information Resource (http://www.tobaccomdb.com/ (accessed on 20 February 2014)) (Qingdao, China). HD and G3 seeds were initially provided by the Tobacco Germplasm Resources Sub-Infrastructure of the National Crop Germplasm Resources Infrastructure (Qingdao, China).
HD and G3, as female parents, were, respectively, hybridized with the sld mutant, as the male parent, to produce two F1 generation plants. F1 self-crossed to gain an F2 segregation population. Moreover, the individual (G3 × sld) F1 plant was backcrossed with the sld mutant (male parent) to obtain a ((G3 × sld) × sld) BC1F1 segregation population. In 2016, all experimental materials were arranged in order and planted with no repetition for genetic population phenotypic observation in the field of the Tobacco Test Station of Zhucheng (Weifang, Shandong, China), and the G3, sld, (G3 × sld) F2 segregation populations and ((G3 × sld) × sld) BC1F1 segregation population were used for gene mapping sampling. Three individual plant lines of F2, along with a plant line of BC1F1, were, each, planted with a population of about 500 plants. Moreover, in 2017, HD and the sld mutant were planted for investigation of their agronomic traits in the field of Tsingtao Experimental Base of the Tobacco Research Institute, Chinese Academy of Agricultural Sciences (Qingdao, Shandong, China), and the Tobacco Test Station of Zhucheng.

2.2. Phenotypic Investigation and Statistical Analysis

Phenotypic observation of all experimental materials was carried out at five different developmental stages: seedling emergence stage, seedling stage, rosette stage, vigorous growing stage, and flowering stage. The spiral-leaves growth phenotype of the sld mutant was very typical from the beginning of the rosette stage. The sld mutant-type phenotype and the HD/G3 wild-type phenotype of individual plants were recorded at the flowering stage. A chi-square goodness-of-fit test was used to confirm the fitness of observed separation ratio and the theoretical separation ratio of the segregation populations.

2.3. Investigation and Statistical Analysis of Agronomic Characteristics

The major agronomic characteristics of HD and the sld mutant represented by five plants from each of the two locations were measured at the flowering stage. All measured data were analyzed via an ANOVA using Microsoft Excel 2016. The homogeneity of variance was tested using a two-sample F-test for variance, and a two-sample Student’s t-test was carried out, assuming equal (and unequal) variances (homoscedastic/heteroscedastic).

2.4. Genomic DNA Extraction and SSR Analysis

Genomic DNA was extracted from young fresh leaves of ten individual plants from the G3-type and the sld mutant-type, all sld mutant-type phenotype plants of the (G3 × sld) F2 population, and all sld mutant-type and G3-type phenotype plants of the ((G3 × sld) × sld) BC1F1 population, using the CTAB method with slight modification [72,73]. A NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Beijing, China) was used for measurement of the DNA concentration, adjusted to final concentration of 50 ng/µL. The DNA purity was examined via agarose gel electrophoresis at 1% concentration.
Tobacco simple sequence repeat (SSR) markers released by Bindler et al. [73] were used to map the causal gene of the sld mutant phenotype. In light of genetic map [73], SSR primers were averagely selected in search of polymorphic markers between two parents, G3 and sld, ten of the sld mutant-type plants, and ten of the G3-type plants from each of the two populations (F2 and BC1F1), following the experimental procedures of Wu et al. [70] and Gao et al. [74].

2.5. Gene Linkage Map Construction and Genetic Distance Analysis

In order to seek all polymorphic SSR markers of the parents closely linked to the sld mutant gene, some typical clearly distinguishable polymorphic SSR marker primers between the parents were identified via PCR amplification and genotypic detection of ten random individual plants’ DNA, respectively, from the sld-type phenotype (recessive) individual plants of the (G3 × sld) F2 and ((G3 × sld) × sld) BC1F1 populations; others were surveyed in sequence. Subsequently, all polymorphic SSR markers on the flank of the sld mutant gene were moved across the remaining sld-type (recessive) individuals’ DNA from the F2 and BC1F1 populations, and the G3-type individuals’ DNA from the BC1F1 population.
A genetic linkage map was constructed using QTL Ici Mapping software V4.0, taking advantage of segregation data of the sld causal gene and SSR markers from the F2 or BC1F1 population. The odd (LOD) threshold of the map was set at 3.0 [75]. The percentage of recombinations was converted into genetic distances via Kosambi’s mapping function [76], and represented by Kosambi centiMorgans (cM).

3. Results

3.1. Phenotypic Characteristics of the sld Mutant

The sld mutant plants looked normal from seed germination to the euphylla cross of the seedling growth period (Figure 1d). After being temporality planted, the sld plants displayed a leaf tip distortion. When the sld mutant plants reached 3–5 leaves with one heart (Figure 1e), the leaves obviously showed a spiral growth model with the growth point as the central axis, as compared to the wild-type HD. Established seedlings of the sld mutant and the wild-type HD were transplanted to fields at once. The sld mutant plants gradually appeared to be shorter, and the height development of the sld plants lagged behind that of the wild-type HD plants. At the rosette stage, the sld mutant plants exhibited a significantly dwarfed stature with a phenotype of spiral, wrinkled leaves (Figure 1f and Figure 2a,b).

3.2. Main Agronomic Characteristics of the sld Mutant

At the full flowering stage, we investigated the main agronomic traits of the sld mutant and the wild-type HD, including the number of leaves, plant height, stem girth, pitch, maximum leaf length, and maximum leaf width, in two locations: Jimo (Qingdao, Shandong, China) and Zhucheng (Weifang, Shandong, China) (Figure 2b,c). At Jimo, the sld mutant plants had an average of 20.8 leaves, with an average height of 87.4 cm, stem girth of 10.6 cm, pitch of 4.14 cm, maximum leaf length of 40 cm, and maximum leaf width of 15.4 cm, being 95.4%, 61.6%, 98.1%, 52.1%, 56.7%, 45.3% of those of the wild-type HD, respectively (Figure 2d). Meanwhile, at Zhucheng, the sld mutant plants had an average of 22.4 leaves; the average results of the aforementioned height, stem girth, pitch, maximum leaf length, and maximum leaf width were, respectively, 95.2 cm, 10.6 cm, 3.98 cm, 38 cm and 16.6 cm, being 94.9%, 59.6%, 98.1%, 84.0%, 55.9%, 50.9% of that of the wild-type HD, respectively (Figure 2e). An ANOVA of major agronomic characteristics of the sld mutant compared with those of the wild-type HD indicated that at Jimo and Zhucheng, plant height, maximum leaf length, and maximum leaf width showed the most significant differences. Pitch showed a significant difference at Jimo, and an extreme significant difference at Zhucheng (Figure 2d,e). The results showed that the dwarf trait of the sld mutant was associated with shortened pitch, and its spiral wrinkle leaf phenotype was accompanied by a decreased maximum leaf length and width. Compared with the wild-type HD, the number of attached leaves and the stem girth of the sld mutant did not change significantly, and remained statistically stable.

3.3. Genetic Analysis of the sld Mutant

In order to analyze the inheritance of the sld mutant phenotype, F1 was made between HD (or G3) and the sld mutant. All individual plants of the two F1 manifested phenotypes of the corresponding female parents HD and G3. In the (HD × sld) F2 and (G3 × sld) F2 populations, based on the sld mutant phenotype, 167 plants and 503 plants were, respectively, divided into two groups: the sld mutant-type phenotype group (40 plants and 112 plants), and the wild-type phenotype group (HD 127 plants and G3 391 plants). The observed segregation ratios of the (HD × sld) F2 and (G3 × sld) F2 populations both fitted an expected Mendelian inheritance ratio of 1:3 (the sld mutant-type: the wild-type, χ2 < χ20.05 = 3.841) (Table 1), which indicated that the sld mutant phenotype was dominated by recessive nuclear monogene. A test cross population, ((G3 × sld) × sld) BC1F1, was used to verify the inheritance of F2 segregation population. There were 193 plants with the sld mutant-type phenotype and 199 plants with the wild-type G3 phenotype in the ((G3 × sld) × sld) BC1F1 population, which is consistent with a Mendelian inheritance segregation ratio of 1:1 (sld mutant-type: wild-type, χ2 < χ20.05 = 3.841) (Table 1).

3.4. Gene Mapping of the sld Mutant

A total of 1317 pairs of SSR markers averagely selected in the 24 tobacco linkage groups (LG) were screened for distinct polymorphisms between the wild-type G3 (maternal parents) and the sld mutant (paternal parents), and 324 (13.98%) markers displayed distinct polymorphisms. In light of the previous detection method [70,77], these distinct polymorphism markers were further used to detect the polymorphisms of the bulked DNA samples derived from the wild-type G3 phenotypes and the sld mutant-type phenotypes of segregated populations. Six markers (1.85%) (Table 2) on linkage group 5 were used to analyze DNA samples of 318 recessive sld mutant-type phenotype individuals from the F2 segregation population, which were derived from three F1 single plant lines, and of 199 dominant G3 wild-type phenotype and 193 recessive sld mutant-type phenotype plants from the BC1F1 population.
On the basis of the detection results from the sld-type individuals of the F2 population, a genetic linkage group between the sld locus and the six corresponding SSR markers was constructed on linkage group 5. The sld locus was located between the co-segregated markers PT51778, PT54913, and the marker PT61414, with both genetic distances being 0.16 cM. The other side of the co-segregated PT51778 and PT54913 markers, the markers PT40040 and PT60855, were arranged in order from near to far, while the other side of the marker PT61414 was adjacent to the marker PT60933 (Figure 3b).
Based on the number of the recessive sld mutant-type recombinant individuals detected by the above six markers in the BC1F1 population, a genetic linkage group was constructed on linkage group 5. The upstream adjacent markers PT51778, PT54913, and the downstream adjoining marker PT61414 of the sld locus were all co-segregated with the sld locus, which was located within the larger region between the markers PT40040 and PT60933, with genetic distances of 1.37 cM and 6.32 cM, respectively. At the other end of the marker PT40040 was the marker PT60855 (Figure 3d). The relative positions of the six markers and the sld locus were in accordance with the linkage group constructed using the F2 population. This result verified that the six polymorphic SSR markers were genetically linked to the sld site.

4. Discussion

4.1. Inheritance Patterns of Visible Mutation Phenotypes Such as Spiral Leaf and Plant Dwarfing in Tobacco

The spiral leaf and dwarf (sld) mutant is a stable leaf-spiraling and plant-dwarfing mutant resulting from self-crossed M5 generation of the cultivated variety of Nicotiana tabacum L., Honghuadajinyuan (HD), mutated by the chemical mutagen ethylmethane sulfonate (EMS), which comes from the Tobacco Mutant Library [71]. The sld mutant did not show the characteristic of leaves spiral mutation from germination to the euphylla cross of the seedling growth period (Figure 1d). Leaf tip distortion of the sld mutant seedlings gradually appeared during the development of seedlings. When the leaf number of the sld mutant grew to 3–5 leaves with one heart (Figure 1e), the leaves obviously showed a spiral growth model, with the growth point as the central axis. The sld mutant showed the typical phenotype of spiral, wrinkled leaves (Figure 1f), and the plant height was shorter from the rosette stage (Figure 2a,b). The reliable and stable spiral leaf and dwarf phenotype was observed for many years. The inheritance pattern of the sld mutant phenotype was manipulated by a recessive nuclear monogene (Table 1).
We also obtained the inheritance patterns of some individual plants with stable visible mutagenesis phenotypes from the Tobacco Mutant Library. Some 8 mutants of 18 homozygous mutant individual plant lines displayed the monogenic dominant patterns of inheritance; 5 mutants of 18 displayed monogenic recessive mutation patterns; while 2 mutants of 18 showed double-recessive patterns of inheritance; the other 3 of 18 were confirmed as monogenic semi-dominant patterns [71]. The leaf senescence phenotype of the yellow leaf 1 (yl1) mutant was also governed by a recessive monogene [74]. In one mutant plant, more than two abnormal phenotypes always occur simultaneously, pertaining to the form of the pleiotropy [71]. Thus, genetic analysis showed that the coexistence of the spiral leaf and dwarf phenotypes of the sld mutant was also caused by pleiotropism.

4.2. Inheritance Patterns of Dwarfing/Semi-Dwarfing and Leaf-Curling Mutations in Monocotyledons and Dicotyledons

The inheritance patterns of dwarf/semi-dwarf traits and leaf curl mutations have contributed to research progress made in the area of dicots and monocots. Dwarf/semi-dwarf traits are often accompanied by leaf variation and other traits, which are regulated by one gene and exhibit pleiotropy. With the same or similar phenotypic traits, different crops could have the same inheritance mechanisms/patterns, while the same crops might have different genetic mechanisms.
The dwarf phenotype of the pepper CaBRI1 gene [79]; the short internode length trait of the sesame Sidwf1 gene [80]; the rice dwarf and brittle culm (dbc1) mutant [81]; the rice dwarf-narrow leaf mutant 2 (dnl2) [82]; the barley excess-tillering semi-dwarf mutant htd [83]; the maize dwarf mutant m34 [84]; the (extreme) dwarf cucumber mutants of the compact (cp) [85]; the super compact-1 (scp-1) [63]; the super compact-2 (scp-2), with dark green and wrinkled leaves [64]; the compact plant architecture (cpa) mutant, with shortened internodes and petioles, and darkened and wrinkled leaves [65]; and the B. napus dwarf mutant bnaC.dwf and bnd2 [86,87] are all controlled by a single recessive gene. In some B. napus, the semi-dwarf mutant ds-1, with dark-green leaves [45]; the dwarf mutant ds-4, with shorter petioles, downward curving and crinkled leaves [88]; a semi-dwarf stature sca, with crinkled leaves, narrow branch angles, and upright siliques [89]; the extremely dwarf1 (ed1) mutant, with curled leaves [90]; and the dwarf mutant df59 [91] are governed by a single semi-dominant gene. In the other B. napus, the Bndwf/dcll mutant with a short-statured and wrinkled downward-curved leaf-type [92]; the G7 dwarfism phenotype, with downward-curved leaves [93]; the BnUC1 mutant, with up-curling leaves [94]; and the semi-dwarf mutant Bnuc2, with upward-curled leaves [95] are controlled by a dominant monogene. Meanwhile, the dwarf mutant NDF-1 of B. napus is regulated by a major gene (ndf1) with a mainly additive effect [96]; the dwarf mutation trait of 99CDAM [97] arose from three pairs of recessive dwarf genes. In light of the determined inheritance patterns, these dwarfism and leaf-curling mutants were used for identifying the corresponding functional genes through gene mapping, which were then applied in breeding research.

4.3. Research on Curled Leaves and Plant Height of Tobacco

The published research on the curled leaves and plant height of tobacco is limited. Alongside over-expression of the NTH1 gene of tobacco in transgenic Samsun with slightly wrinkled and curved leaves [1] (Masanori et al., 1999), transgenic tobacco plants harboring the NTH15 (Nicotiana tabacum homeobox 15) gene, which resembles the class 1 KNOTTED-type homeodomain, showed mildly or severely curled and shrunken leaves; this results from a drastic decline in GA1 and an increment in cytokinins [49]. Overexpression or induction of NTH15 gene strongly suppresses the abundant expression of the Ntc12 gene encoding GA 20-oxidase, thereby giving rise to decreased levels of bioactive GA, and varying the severity of curled-leaf phenotypes [50,51]. Tobacco plants that overexpress various class1 knotted1-type homeobox (kn1-type class1) genes have shown different degrees of curled and shrunken leaves, depending on differences in the conserved domains of the Nicotiana tabacum homeobox (NTH) gene family [98]. Transgenic tobacco plants of MdKN1 (apple class 1 KNOX genes) or the corn KNOX1 gene showed malformation, extensively curled and crinkled leaves, and delayed shoot growth via curbing internodes’ elongation [99]. The PttKN1 (Populus tremula × tremuloides KNOTTED1) gene in transgenic tobacco caused down-regulated expression of the GA 20-oxidase gene, increased cytokinin levels, and decreased gibberellin levels, resulting in the growth of two round stems with mildly, moderately, or severely wrinkled leaves [100]. Cheng et al. [101] identified quantitative trait loci (QTL) affecting plant height (PH) from the cross between NC82 (P1), a high-quality flue cured tobacco cultivar, and Kang88 (P2), a tobacco virus-resistant cultivar. When the soybean GmRAV gene was transferred into tobacco, a reduction in gibberellin (GA) biosynthesis and the dwarf phenotype were observed [102].

4.4. Construction and Application of Tobacco SSR Marker Linkage Map

Utilizing F2 or BC1F1 populations from mutants and wild-type phenotypes for gene mapping and constructing a genetic linkage map is an effective method used in forward genetics to search for the genes controlling mutant phenotypes or traits, and to study the function of controlling genes and molecular marker-assisted selection in breeding. Many advances have been made in mapping mutant genes, such as in rice [103,104], cucumber [105], and B. napus [86,106,107]. Tobacco (Nicotiana tabacum L.), which has enormous genome, is an allotetraploid (2n = 4x = 48) species, including the S-genome and T-genome, respectively, from the diploid Nicotiana sylvestris and the diploid Nicotiana tomentosiformis [108,109]. In polyploids and a low number of polymorphism species, simple sequence repeat (SSR) markers or microsatellites can be used to identify more and higher levels of polymorphisms than other markers [110]. Therefore, SSR markers are suitable for gene mapping allotetraploid tobacco EMS mutants.
Genetic linkage maps have been constructed using SSR markers in tobacco. The first microsatellite markers’ linkage map of tobacco (Nicotiana tabacum L.) was generated by Bindler et al. [78], which mapped 282 functional microsatellite markers at 293 loci, spanning 1920 cM. In 2011, a high-density genetic map of tobacco was produced by Bindler et al. [73], and comprised 2317 microsatellite markers and 2363 loci, with a coverage of 3270 cM; this was accomplished in light of an F2 mapping population of the intervarietal cross, Hicks Broadleaf × Red Russian. A flue-cured tobacco genetic map was constructed, which contained 611 SSR loci of 24 tentative linkage groups, with overall coverage of 1882.1 cM; this map was based on newly developed and published [73] SSR markers, and a population of 207 double-haploid lines derived from a cross between two flue-cured tobacco varieties, Honghuadajinyuan and Hicks Broad Leaf [111]. Subsequently, the flue-cured tobacco high-density genetic map was completed, including 626 SSR loci of 24 linkage groups, with an overall coverage of 1120.45 cM, based on a backcross (BC1) population of 213 individuals from an intra-type cross between two flue-cured tobacco varieties, Y3 and K326 [112]. The single recessive NtTPN1 (Nicotiana tabacum Tolerance to PVY-induced Necrosis1) gene and the tobacco black shank resistance single dominant Ph gene were, respectively, located at LG13 and the top of LG20, using the SSR marker [73,113,114]. Based on SSR markers [73,112], one recessive ws1a locus of the tobacco ethyl methanesulfonate (EMS)-induced white stem 1 (ws1) mutant was located between the markers PT54006 and PT51778, with a genetic distance of 8.04 and 3.96 cM, respectively. The other recessive ws1b locus was located between the markers PT53716 and TM11187, with both genetic distances being 8.56 cM [70]. The single recessive YL1 locus of the EMS-induced tobacco premature leaf senescence mutant yellow leaf 1 (yl1) was located between the markers PT53066 and PT60305, with a genetic distance of 1.08 and 3.51 cM, respectively [74].

4.5. Limitations and Prospects of SSR Marker Gene Mapping for the sld Mutant in Tobacco

In this study, we obtained six tobacco SSR markers [73,78] with obvious and easily distinguishable polymorphisms on linkage group 5 for the gene mapping of the sld mutant gene in F2 and BC1F1 populations. Using the F2 population, the sld mutant locus was located between co-segregated markers PT51778, PT54913, and the marker PT61414, with both genetic distances being 0.16 cM (Figure 3b). Taking advantage of the BC1F1 population, the markers PT51778, PT54913, the sld locus, and the marker PT61414 were shown to be co-separated and located between the marker PT40040 and the marker PT60933, at a distance of 1.37 cM and 6.32 cM, respectively (Figure 3d).
When we further tried to use the draft genomes of N. tabacum (https://solgenomics.net/organism/Nicotiana_tabacum/genome (accessed on 10 March 2017)), released by Sierro et al. [115,116], to find SSR markers for fine localization of the sld gene, we found that the codominant SSR markers of the preliminary mapping were located in two adjacent scaffolds on LG5, respectively. This required us to search for other markers for fine localization of the sld gene. The development of high-throughput sequencing technology means that genetic maps constructed using SNP markers have higher coverage and resolution, meaning they are also suitable for allotetraploid flue-cured tobacco, which has an enormous genome. SNP high-density genetic linkage maps of N. tabacum, which are more saturated and contain a greater number of markers, have been constructed [117,118,119,120]. The SNPs of the map were assigned to the corresponding 24 LGs published [73]. EMS can randomly induce more single-nucleotide point mutations in the whole genome [121,122], which provides a reliable guarantee for finding co-dominant SNP markers closer to the sld gene.
Recently, Zan et al. [123] presented the first complete assembly, embracing the genetic and phenotypic data of a whole Nicotiana tabacum GenBank, of the allotetraploid Nicotiana tabacum nuclear genome. We realigned and reanalyzed the sequences of the markers PT54913 and PT61414 using the latest version of the Nicotiana tabacum nuclear genome, and found that the sld gene was located between 58602372 bp bases and 44601846 bp bases on chromosome 5. This became the material basis for further utilizing KASP technology for fine localization of the sld gene and the identification of candidate genes. These research results will contribute to better interpretations of the mechanisms of abnormal leaf and plant height development, thereby laying the foundation for the molecular breeding of various types of tobacco plant.

Author Contributions

Conceptualization, G.L. and X.W.; investigation, S.W., X.W., D.W. and L.C.; supervision, G.L. and A.Y.; project administration, G.L. and Y.W.; funding acquisition, G.L., Y.G. and A.Y.; writing—original draft preparation, S.W.; writing—review and editing, Y.G. and L.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the China Tobacco “Uncover, Tender, and Take Command” Project Plan (Grant Nos. 110202103009 and 110202103015) and the Agricultural Science and Technology Innovation Program (Grant Nos. ASTIP-TRIC01 and ASTIPTRIC02).

Data Availability Statement

Data is contained within the article.

Acknowledgments

We wish to thank the members of the China Tobacco Genome Project [(110201101009 (JY-03), 110201201004 (JY-04), and 110201301005 (JY-05)] who created, collected, and characterized the mutant.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Masanori, T.; Nishimura, A.; Aida, M.; Tasaka, M.; Matsuoka, M. Transgenic tobacco over-expressing a homeobox gene shows a developmental interaction between leaf morphogenesis and phyllotaxy. Plant Cell Physiol. 1999, 40, 657–667. [Google Scholar] [CrossRef]
  2. Johnson, K.; Lenhard, M. Genetic control of plant organ growth. New Phytol. 2011, 191, 319–333. [Google Scholar] [CrossRef]
  3. Powell, A.E.; Lenhard, M. Control of organ size in plants. Curr. Biol. 2012, 22, R360–R367. [Google Scholar] [CrossRef]
  4. Lenhard, M. All’s well that ends well: Arresting cell proliferation in leaves. Dev. Cell. 2012, 22, 9–11. [Google Scholar] [CrossRef]
  5. Du, F.; Guan, C.M.; Jiao, Y.L. Molecular mechanisms of leaf morphogenesis. Mol. Plant 2018, 11, 1117–1134. [Google Scholar] [CrossRef]
  6. Conklin, P.A.; Strable, J.; Li, S.J.; Scanlon, M.J. On the mechanisms of development in monocot and eudicot leaves. New Phytol. 2019, 221, 706–724. [Google Scholar] [CrossRef]
  7. Hudson, A.; Waites, R. Early events in leaf development. Semin. Cell Dev. Biol. 1998, 9, 207–211. [Google Scholar] [CrossRef]
  8. Nelissen, H.; Gonzalez, N.; Inzé, D. Leaf growth in dicots and monocots: So different yet so alike. Curr. Opin. Plant Biol. 2016, 33, 72–76. [Google Scholar] [CrossRef]
  9. Tsukaya, H. Leaf shape diversity with an emphasis on leaf contour variation, developmental background, and adaptation. Semin. Cell Dev. Biol. 2017, 79, 48–57. [Google Scholar] [CrossRef]
  10. Dong, J.Q.; Huang, H. Auxin polar transport flanking incipient primordium initiates leaf adaxial-abaxial polarity patterning. J. Integr. Plant Biol. 2018, 60, 455–464. [Google Scholar] [CrossRef] [PubMed]
  11. Parnis, A.; Cohen, O.; Gutfinger, T.; Hareven, D.; Zamir, D.; Lifschitz, E. The dominant developmental mutants of tomato, Mouse-ear and Curl, are associated with distinct modes of abnormal transcriptional regulation of a Knotted gene. Plant Cell 1997, 9, 2143–2158. [Google Scholar] [CrossRef]
  12. Cho, S.H.; Lee, C.H.; Gi, E.; Yim, Y.; Koh, H.-J.; Kang, K.; Paek, N.C. The Rice Rolled Fine Striped (RFS) CHD3/Mi-2 chromatin remodeling factor epigenetically regulates genes involved in oxidative stress responses during leaf development. Front. Plant Sci. 2018, 9, 364. [Google Scholar] [CrossRef]
  13. Zhou, Y.B.; Wang, D.; Wu, T.; Yang, Y.Z.; Liu, C.; Yan, L.; Tang, D.Y.; Zhao, X.Y.; Zhu, Y.H.; Lin, J.Z.; et al. LRRK1, a receptor-like cytoplasmic kinase, regulates leaf rolling through modulating bulliform cell development in rice. Mol. Breed. 2018, 38, 48. [Google Scholar] [CrossRef]
  14. Gao, L.L.; Yang, G.H.; Li, Y.F.; Fan, N.N.; Li, H.J.; Zhang, M.; Xu, R.B.; Zhang, M.Y.; Zhao, A.J.; Ni, Z.F.; et al. Fine mapping and candidate gene analysis of a QTL associated with leaf rolling index on chromosome 4 of maize (Zea mays L.). Theor. Appl. Genet. 2019, 132, 3047–3062. [Google Scholar] [CrossRef] [PubMed]
  15. Xiang, J.J.; Zhang, G.H.; Qian, Q.; Xue, H.W. Semi-rolled leaf1 encodes a putative glycosylphosphatidylinositol-anchored protein and modulates rice leaf rolling by regulating the formation of bulliform cells. Plant Physiol. 2012, 159, 1488–1500. [Google Scholar] [CrossRef] [PubMed]
  16. Li, W.Q.; Zhang, M.J.; Gan, P.F.; Qiao, L.; Yang, S.Q.; Miao, H.; Wang, G.F.; Zhang, M.M.; Liu, W.T.; Li, H.F.; et al. CLD1/SRL1 modulates leaf rolling by affecting cell wall formation, epidermis integrity and water homeostasis in rice. Plant J. 2017, 92, 904–923. [Google Scholar] [CrossRef] [PubMed]
  17. Nath, U.; Crawford, B.C.W.; Carpenter, R.; Coen, E. Genetic control of surface curvature. Science 2003, 299, 1404–1407. [Google Scholar] [CrossRef]
  18. Zhang, G.F.; Zhao, H.T.; Zhang, C.G.; Li, X.Y.; Lyu, Y.Y.; Qi, D.M.; Cui, Y.W.; Hu, L.; Wang, Z.J.; Liang, Z.; et al. TCP7 functions redundantly with several Class I TCPs and regulates endoreplication in Arabidopsis. J. Integr. Plant Biol. 2019, 61, 1151–1170. [Google Scholar] [CrossRef]
  19. He, Z.M.; Zhou, X.M.; Chen, J.M.; Yin, L.T.; Zeng, Z.H.; Xiang, J.; Liu, S.C. Identification of a consensus DNA-binding site for the TCP domain transcription factor TCP2 and its important roles in the growth and development of Arabidopsis. Mol. Biol. Rep. 2021, 48, 2223–2233. [Google Scholar] [CrossRef]
  20. Zhang, G.H.; Xu, Q.; Zhu, X.D.; Qian, Q.; Xue, H.W. SHALLOT-LIKE1 is a KANADI transcription factor that modulates rice leaf rolling by regulating leaf abaxial cell development. Plant Cell 2009, 21, 719–735. [Google Scholar] [CrossRef]
  21. Rong, F.X.; Chen, F.F.; Huang, L.; Zhang, J.Y.; Zhang, C.W.; Hou, D.; Cheng, Z.H.; Weng, Y.Q.; Chen, P.; Li, Y.H. A mutation in class III homeodomain-leucine zipper (HD-ZIP III) transcription factor results in curly leaf (cul) in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2019, 132, 113–123. [Google Scholar] [CrossRef]
  22. Li, Y.Y.; Shen, A.; Xiong, W.; Sun, Q.L.; Luo, Q.; Song, T.; Li, Z.L.; Luan, W.J. Overexpression of OsHox32 results in pleiotropic effects on plant type architecture and leaf development in Rice. Rice 2016, 9, 46. [Google Scholar] [CrossRef] [PubMed]
  23. Juarez, M.T.; Kui, J.S.; Thomas, J.; Heller, B.A.; Timmermans, M.C.P. microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 2004, 428, 84–88. [Google Scholar] [CrossRef]
  24. Merelo, P.; Ram, H.; Caggiano, M.P.; Ohno, C.; Ott, F.; Straub, D.; Graeff, M.; Cho, S.K.; Yang, S.W.; Wenkel, S.; et al. Regulation of MIR165/166 by class II and class III homeodomain leucine zipper proteins establishes leaf polarity. Proc. Natl. Acad. Sci. USA 2016, 113, 11973–11978. [Google Scholar] [CrossRef] [PubMed]
  25. Mallory, A.C.; Vaucheret, H. Functions of microRNAs and related small RNAs in plants. Nat. Genet. 2006, 38, S31–S36. [Google Scholar] [CrossRef] [PubMed]
  26. Zou, L.P.; Sun, X.H.; Zhang, Z.G.; Liu, P.; Wu, J.X.; Tian, C.J.; Qiu, J.L.; Lu, T.G. Leaf rolling controlled by the homeodomain leucine zipper class IV gene Roc5 in rice. Plant Physiol. 2011, 156, 1589–1602. [Google Scholar] [CrossRef]
  27. Fang, J.J.; Guo, T.T.; Xie, Z.W.; Chun, Y.; Zhao, J.F.; Peng, L.X.; Zafar, S.A.; Yuan, S.J.; Xiao, L.T.; Li, X.Y. The URL1-ROC5-TPL2 transcriptional repressor complex represses the ACL1 gene to modulate leaf rolling in rice. Plant Physiol. 2021, 185, 1722–1744. [Google Scholar] [CrossRef]
  28. Cho, S.H.; Yoo, S.C.; Zhang, H.T.; Pandeya, D.; Koh, H.J.; Hwang, J.Y.; Kim, G.T.; Paek, N.C. The rice narrow leaf2 and narrow leaf3 loci encode WUSCHEL-related homeobox 3A (OsWOX3A) and function in leaf, spikelet, tiller and lateral root development. New Phytol. 2013, 198, 1071–1084. [Google Scholar] [CrossRef]
  29. Dai, M.Q.; Hu, Y.F.; Zhao, Y.; Liu, H.F.; Zhou, D.X. A WUSCHEL-LIKE HOMEOBOX gene represses a YABBY gene expression required for rice leaf development. Plant Physiol. 2007, 144, 380–390. [Google Scholar] [CrossRef]
  30. Iwakawa, H.; Ueno, Y.; Semiarti, E.; Onouchi, H.; Kojima, S.; Tsukaya, H.; Hasebe, M.; Soma, T.; Ikezaki, M.; Machida, C.; et al. The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana, required for formation of a symmetric flat leaf lamina, encodes a member of a novel family of proteins characterized by cysteine repeats and a leucine zipper. Plant Cell Physiol. 2002, 43, 467–478. [Google Scholar] [CrossRef]
  31. Shuai, B.; Reynaga-Peña, C.G.; Springer, P.S. The LATERAL ORGAN BOUNDARIES gene defines a novel, plant-specific gene family. Plant Physiol. 2002, 129, 747–761. [Google Scholar] [CrossRef] [PubMed]
  32. Nakazawa, M.; Ichikawa, T.; Ishikawa, A.; Kobayashi, H.; Tsuhara, Y.; Kawashima, M.; Suzuki, K.; Muto, S.; Matsui, M. Activation tagging, a novel tool to dissect the functions of a gene family. Plant J. 2003, 34, 741–750. [Google Scholar] [CrossRef] [PubMed]
  33. Chalfun-Junior, A.; Franken, J.; Mes, J.J.; Marsch-Martinez, N.; Pereira, A.; Angenent, G.C. ASYMMETRIC LEAVES2-LIKE1 gene, a member of the AS2/LOB family, controls proximaldistal patterning in Arabidopsis petals. Plant Mol. Biol. 2005, 57, 559–575. [Google Scholar] [CrossRef] [PubMed]
  34. Alabadí, D.; Blázquez, M.A.; Carbonell, J.; Ferrándiz, C.; Pérez-Amador, M.A. Instructive roles for hormones in plant development. Int. J. Dev. Biol. 2009, 53, 1597–1608. [Google Scholar] [CrossRef] [PubMed]
  35. Murray, J.A.H.; Jones, A.; Godin, C.; Traas, J. Systems analysis of shoot apical meristem growth and development: Integrating hormonal and mechanical signaling. Plant Cell 2012, 24, 3907–3919. [Google Scholar] [CrossRef]
  36. Liu, S.D.; Hu, Q.N.; Luo, S.; Li, Q.Q.; Yang, X.Y.; Wang, X.L.; Wang, S.C. Expression of wild-type PtrIAA14.1, a poplar Aux/IAA gene causes morphological changes in Arabidopsis. Front. Plant Sci. 2015, 6, 388. [Google Scholar] [CrossRef]
  37. Hou, Y.M.; Li, H.X.; Zhai, L.L.; Xie, X.; Li, X.Y.; Bian, S.M. Identification and functional characterization of the Aux/IAA gene VcIAA27 in blueberry. Plant Signal. Behav. 2020, 15, 1700327. [Google Scholar] [CrossRef]
  38. Pekker, I.; Alvarez, J.P.; Eshed, Y. Auxin response factors mediate Arabidopsis organ asymmetry via modulation of KANADI activity. Plant Cell 2005, 17, 2899–2910. [Google Scholar] [CrossRef]
  39. Cheng, M.L.; Lo, S.F.; Hsiao, A.S.; Hong, Y.F.; Yu, S.M.; Ho, T.H.D. Ectopic expression of WINDING 1 leads to asymmetrical distribution of auxin and a spiral phenotype in rice. Plant Cell Physiol. 2017, 58, 1494–1506. [Google Scholar] [CrossRef] [PubMed]
  40. Kim, J.I.; Sharkhuu, A.; Jin, J.B.; Li, P.; Jeong, J.C.; Baek, D.; Lee, S.Y.; Blakeslee, J.J.; Murphy, A.S.; Bohnert, H.J.; et al. yucca6, a dominant mutation in Arabidopsis, affects auxin accumulation and auxin-related phenotypes. Plant Physiol. 2007, 145, 722–735. [Google Scholar] [CrossRef]
  41. Cao, X.; Yang, H.L.; Shang, C.Q.; Ma, S.; Liu, L.; Cheng, J.L. The Roles of Auxin Biosynthesis YUCCA Gene Family in Plants. Int. J. Mol. Sci. 2019, 20, 6343. [Google Scholar] [CrossRef]
  42. Liu, F.; Wang, P.D.; Zhang, X.B.; Li, X.F.; Yan, X.H.; Fu, D.H.; Wu, G. The genetic and molecular basis of crop height based on a rice model. Planta 2018, 247, 1–26. [Google Scholar] [CrossRef]
  43. Kieffer, M.; Master, V.; Waites, R.; Davies, B. TCP14 and TCP15 affect internode length and leaf shape in Arabidopsis. Plant J. 2011, 68, 147–158. [Google Scholar] [CrossRef]
  44. Bae, K.D.; Um, T.Y.; Yang, W.T.; Park, T.H.; Hong, S.Y.; Kim, K.M.; Chung, Y.S.; Yun, D.J.; Kim, D.H. Characterization of dwarf and narrow leaf (dnl-4) mutant in rice. Plant Signal. Behav. 2020, 16, 1849490. [Google Scholar] [CrossRef]
  45. Liu, C.; Wang, J.L.; Huang, T.D.; Wang, F.; Yuan, F.; Cheng, X.M.; Zhang, Y.; Shi, S.W.; Wu, J.S.; Liu, K.D. A missense mutation in the VHYNP motif of a DELLA protein causes a semi-dwarf mutant phenotype in Brassica napus. Theor. Appl. Genet. 2010, 121, 249–258. [Google Scholar] [CrossRef]
  46. Wu, J.; Kong, X.Y.; Wan, J.M.; Liu, X.Y.; Zhang, X.; Guo, X.P.; Zhou, R.H.; Zhao, G.Y.; Jing, R.L.; Fu, X.D.; et al. Dominant and pleiotropic effects of a GAI gene in wheat results from a lack of interaction between DELLA and GID1. Plant Physiol. 2011, 157, 2120–2130. [Google Scholar] [CrossRef]
  47. Zhao, M.C.; Zhi, H.; Zhang, X.; Jia, G.Q.; Diao, X.M. Retrotransposon-mediated DELLA transcriptional reprogramming underlies semi-dominant dwarfism in foxtail millet. Crop J. 2019, 007, 458–468. [Google Scholar] [CrossRef]
  48. Fambrini, M.; Mariotti, L.; Parlanti, S.; Picciarelli, P.; Salvini, M.; Ceccarelli, N.; Pugliesi, C. The extreme dwarf phenotype of the GA-sensitive mutant of sunflower, dwarf2, is generated by a deletion in the ent-kaurenoic acid oxidase1 (HaKAO1) gene sequence. Plant Mol. Biol. 2011, 75, 431–450. [Google Scholar] [CrossRef]
  49. Tamaoki, M.; Kusaba, S.; Kano-Murakami, Y.; Matsuoka, M. Ectopic expression of a tobacco homeobox gene, NTH15, dramatically alters leaf morphology and hormone levels in transgenic tobacco. Plant Cell Physiol. 1997, 38, 917–927. [Google Scholar] [CrossRef]
  50. Tanaka-Ueguchi, M.; Itoh, H.; Oyama, N.; Koshioka, M.; Matsuoka, M. Over-expression of a tobacco homeobox gene, NTH15, decreases the expression of a gibberellin biosynthetic gene encoding GA 20-oxidase. Plant J. 1998, 15, 391–400. [Google Scholar] [CrossRef]
  51. Sakamoto, T.; Kamiya, N.; Ueguehi-Tanaka, M.; Iwahori, S.; Matsuoka, M. KNOX homeodomain protein directly suppresses the expression of a gibberellin biosynthetic gene in the tobacco shoot apical meristem. Genes Dev. 2001, 15, 581–590. [Google Scholar] [CrossRef] [PubMed]
  52. Mori, M.; Nomura, T.; Ooka, H.; Ishizaka, M.; Yokota, T.; Sugimoto, K.; Okabe, K.; Kajiwara, H.; Satoh, K.; Yamamoto, K.; et al. Isolation and characterization of a rice dwarf mutant with a defect in brassinosteroid biosynthesis. Plant Physiol. 2002, 130, 1152–1161. [Google Scholar] [CrossRef] [PubMed]
  53. Hong, Z.; Ueguchi-Tanaka, M.; Shimizu-Sato, S.; Inukai, Y.; Fujioka, S.; Shimada, Y.; Takatsuto, S.; Agetsuma, M.; Yoshida, S.; Watanabe, Y.; et al. Loss-of-function of a rice brassinosteroid biosynthetic enzyme, C-6 oxidase, prevents the organized arrangement and polar elongation of cells in the leaves and stem. Plant J. 2002, 32, 495–508. [Google Scholar] [CrossRef] [PubMed]
  54. Hong, Z.; Ueguchi-Tanaka, M.; Umemura, K.; Uozu, S.; Fujioka, S.; Takatsuto, S.; Yoshida, S.; Ashikari, M.; Kitano, H.; Matsuoka, M. A rice brassinosteroid-deficient mutant, ebisu dwarf (d2), is caused by a loss of function of a new member of cytochrome P450. Plant Cell 2003, 15, 2900–2910. [Google Scholar] [CrossRef]
  55. Hong, Z.; Ueguchi-Tanaka, M.; Fujioka, S.; Takatsuto, S.; Yoshida, S.; Hasegawa, Y.; Ashikari, M.; Kitano, H.; Matsuoka, M. The Rice brassinosteroid-deficient dwarf2 mutant, defective in the rice homolog of Arabidopsis DIMINUTO/DWARF1, is rescued by the endogenously accumulated alternative bioactive brassinosteroid, dolichosterone. Plant Cell 2005, 17, 2243–2254. [Google Scholar] [CrossRef]
  56. Tanabe, S.; Ashikari, M.; Fujioka, S.; Takatsuto, S.; Yoshida, S.; Yano, M.; Yoshimura, A.; Kitano, H.; Matsuoka, M.; Fujisawa, Y.; et al. A novel cytochrome P450 is implicated in brassinosteroid biosynthesis via the characterization of a rice dwarf mutant, dwarf11, with reduced seed length. Plant Cell 2005, 17, 776–790. [Google Scholar] [CrossRef]
  57. Sakamoto, T.; Morinaka, Y.; Ohnishi, T.; Sunohara, H.; Fujioka, S.; Ueguchi-Tanaka, M.; Mizutani, M.; Sakata, K.; Takatsuto, S.; Yoshida, S.; et al. Erect leaves caused by brassinosteroid deficiency increase biomass production and grain yield in rice. Nat. Biotechnol. 2006, 24, 105–109. [Google Scholar] [CrossRef]
  58. Yamamuro, C.; Ihara, Y.; Wu, X.; Noguchi, T.; Fujioka, S.; Takatsuto, S.; Ashikari, M.; Kitano, H.; Matsuoka, M. Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 2000, 12, 1591–1606. [Google Scholar] [CrossRef]
  59. Bai, M.Y.; Zhang, L.Y.; Gampala, S.S.; Zhu, S.W.; Song, W.Y.; Chong, K.; Wang, Z.Y. Functions of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. Proc. Natl. Acad. Sci. USA 2007, 104, 13839–13844. [Google Scholar] [CrossRef]
  60. Tong, H.N.; Jin, Y.; Liu, W.B.; Li, F.; Fang, J.; Yin, Y.H.; Qian, Q.; Zhu, L.H.; Chu, C.C. DWARF AND LOW-TILLERING, a new member of the GRAS family, plays positive roles in brassinosteroid signaling in rice. Plant J. 2009, 58, 803–816. [Google Scholar] [CrossRef]
  61. Hu, X.M.; Qian, Q.; Xu, T.; Zhang, Y.; Dong, G.J.; Gao, T.; Xie, Q.; Xue, Y.B. The U-box E3 ubiquitin ligase TUD1 functions with a heterotrimeric G α subunit to regulate Brassinosteroid-mediated growth in rice. PLoS Genet. 2013, 9, e1003391. [Google Scholar] [CrossRef]
  62. Sui, P.F.; Jin, J.; Ye, S.; Mu, C.; Gao, J.; Feng, H.Y.; Shen, W.H.; Yu, Y.; Dong, A.W. H3K36 methylation is critical for brassinosteroid-regulated plant growth and development in rice. Plant J. 2012, 70, 340–347. [Google Scholar] [CrossRef] [PubMed]
  63. Wang, H.; Li, W.Q.; Qin, Y.G.; Pan, Y.P.; Wang, X.F.; Weng, Y.Q.; Chen, P.; Li, Y.H. The cytochrome P450 gene CsCYP85A1 is a Putative Candidate for Super Compact-1 (Scp-1) plant architecture mutation in Cucumber (Cucumis sativus L.). Front. Plant Sci. 2017, 8, 266. [Google Scholar] [CrossRef]
  64. Hou, S.S.; Niu, H.H.; Tao, Q.Y.; Wang, S.H.; Gong, Z.H.; Li, S.; Weng, Y.Q.; Li, Z. A mutant in the CsDET2 gene leads to a systemic brassinosteriod deficiency and super compact phenotype in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2017, 130, 1693–1703. [Google Scholar] [CrossRef]
  65. Zhang, M.R.; Song, M.F.; Cheng, F.; Yang, Z.G.; Davoudi, M.; Chen, J.F.; Lou, Q.F. Identification of a putative candidate gene encoding 7-dehydrocholesterol reductase involved in brassinosteroids biosynthesis for compact plant architecture in Cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2021, 134, 2023–2034. [Google Scholar] [CrossRef]
  66. Lin, H.; Wang, R.X.; Qian, Q.; Yan, M.X.; Meng, X.B.; Fu, Z.M.; Yan, C.Y.; Jiang, B.; Su, Z.; Li, J.Y.; et al. DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 2009, 21, 1512–1525. [Google Scholar] [CrossRef]
  67. Jiang, L.; Liu, X.; Xiong, G.S.; Liu, H.H.; Chen, F.L.; Wang, L.; Meng, X.B.; Liu, G.F.; Yu, H.; Yuan, Y.D.; et al. DWARF 53 acts as a repressor of strigolactone signalling in rice. Nature 2013, 504, 401–405. [Google Scholar] [CrossRef]
  68. Zhou, H.; Yang, M.; Zhao, L.; Zhu, Z.F.; Liu, F.X.; Sun, H.Y.; Sun, C.Q.; Tan, L.B. HIGH-TILLERING AND DWARF 12 regulates photosynthesis and plant architecture by affecting carotenoid biosynthesis in rice. J. Exp. Bot. 2021, 72, 1212–1224. [Google Scholar] [CrossRef] [PubMed]
  69. Sazuka, T.; Kamiya, N.; Nishimura, T.; Ohmae, K.; Sato, Y.; Imamura, K.; Nagato, Y.; Koshiba, T.; Nagamura, Y.; Ashikari, M.; et al. A rice tryptophan deficient dwarf mutant, tdd1, contains a reduced level of indole acetic acid and develops abnormal flowers and organless embryos. Plant J. 2009, 60, 227–241. [Google Scholar] [CrossRef]
  70. Wu, Q.Z.; Wu, X.R.; Zhang, X.F.; Jiang, C.H.; Xiao, B.G.; Zhang, Y.Y.; Wang, Y.Y.; Liu, G.S. Mapping of two white stem genes in tetraploid common tobacco (Nicotiana tabacum L.). Mol. Breed. 2014, 34, 1065–1074. [Google Scholar] [CrossRef]
  71. Wang, D.W.; Wang, S.M.; Chao, J.T.; Wu, X.R.; Sun, Y.H.; Li, F.X.; Lv, J.; Gao, X.M.; Liu, G.S.; Wang, Y.Y. Morphological phenotyping and genetic analyses of a new chemical-mutagenized population of tobacco (Nicotiana tabacum L.). Planta 2017, 246, 149–163. [Google Scholar] [CrossRef]
  72. Rogers, S.O.; Bendich, A.J. Extraction of DNA from plant tissues. In Plant Molecular Biology Manual; Gelvin, S.B., Schilperoort, R.A., Verma, D.P.S., Eds.; Springer: Dordrecht, The Netherlands, 1989; Volume A6, pp. 1–10. [Google Scholar] [CrossRef]
  73. Bindler, G.; Plieske, J.; Bakaher, N.; Gunduz, I.; Ivanov, N.; Hoeven, R.V.D.; Ganal, M.; Donini, P. A high density genetic map of tobacco (Nicotiana tabacum L.) obtained from large scale microsatellite marker development. Theor. Appl. Genet. 2011, 123, 219–230. [Google Scholar] [CrossRef] [PubMed]
  74. Gao, X.M.; Wu, X.R.; Liu, G.S.; Zhang, Z.L.; Chao, J.T.; Li, Z.Y.; Guo, Y.F.; Sun, Y.G. Characterization and mapping of a novel Premature Leaf Senescence mutant in common Tobacco (Nicotiana tabacum L.). Plants 2019, 8, 415. [Google Scholar] [CrossRef]
  75. Li, H.H.; Ribaut, J.M.; Li, Z.L.; Wang, J.K. Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor. Appl. Genet. 2008, 116, 243–260. [Google Scholar] [CrossRef]
  76. Kosambi, D.D. The estimation of map distance from recombination values. Ann. Eugen. 1944, 12, 172–175. [Google Scholar] [CrossRef]
  77. Zhang, S.P.; Liu, S.L.; Miao, H.; Wang, M.; Liu, P.N.; Wehner, T.C.; Gu, X.F. Molecular mapping and candidate gene analysis for Numerous Spines on the Fruit of Cucumber. J. Hered. 2016, 107, 471–477. [Google Scholar] [CrossRef]
  78. Bindler, G.; Hoeven, R.V.D.; Gunduz, I.; Plieske, J.; Ganal, M.; Rossi, L.; Gadani, F.; Donini, P. A microsatellite marker based linkage map of tobacco. Theor. Appl. Genet. 2007, 114, 341–349. [Google Scholar] [CrossRef]
  79. Yang, B.Z.; Zhou, S.D.; Ou, L.J.; Liu, F.; Yang, L.Y.; Zheng, J.Y.; Chen, W.C.; Zhang, Z.Q.; Yang, S.; Ma, Y.Q.; et al. A novel single-base mutation in CaBRI1 confers dwarf phenotype and brassinosteroid accumulation in pepper. Mol. Genet. Genom. 2020, 295, 343–356. [Google Scholar] [CrossRef]
  80. Miao, H.M.; Li, C.; Duan, Y.H.; Wei, L.B.; Ju, M.; Zhang, H.Y. Identification of a Sidwf1 gene controlling short internode length trait in the sesame dwarf mutant dw607. Theor. Appl. Genet. 2020, 133, 73–86. [Google Scholar] [CrossRef]
  81. Sang, X.C.; Du, C.; Wang, X.W.; Yang, Z.L.; Ling, Y.H.; Zhao, F.M.; Li, Y.F.; He, G.H. Identification and gene mapping of dwarf and brittle culm mutant dbc1 in Oryza Sativa. Acta Agron. Sin. 2013, 39, 626–631. [Google Scholar] [CrossRef]
  82. Adedze, Y.M.N.; Wei, X.J.; Sheng, Z.H.; Jiao, G.A.; Tang, S.Q.; Hu, P.S. Characterization of a rice dwarf and narrow leaf 2 mutant. Biol. Plant 2017, 61, 85–94. [Google Scholar] [CrossRef]
  83. Hua, W.; Tan, C.; Xie, J.Z.; Zhu, J.H.; Shang, Y.; Yang, J.M.; Zhang, X.Q.; Wu, X.J.; Wang, J.M.; Li, C.D. Alternative splicing of a barley gene results in an excess-tillering and semi-dwarf mutant. Theor. Appl. Genet. 2020, 133, 163–177. [Google Scholar] [CrossRef] [PubMed]
  84. Li, J.P.; Soomro, A.A.; Xiao, G.; Chen, F.J.; Yuan, L.X.; Gu, R.L. Phenotypic characterization and genetic mapping of the dwarf mutant m34 in maize. J. Integr. Agric. 2019, 18, 14–23. [Google Scholar] [CrossRef]
  85. Li, Y.H.; Yang, L.M.; Pathak, M.; Li, D.W.; He, X.M.; Weng, Y.Q. Fine genetic mapping of cp: A recessive gene for compact (dwarf) plant architecture in cucumber, Cucumis sativus L. Theor. Appl. Genet. 2011, 123, 973–983. [Google Scholar] [CrossRef]
  86. Zeng, X.H.; Zhu, L.X.; Chen, Y.L.; Qi, L.P.; Pu, Y.Y.; Wen, J.; Yi, B.; Shen, J.X.; Ma, C.Z.; Tu, J.X.; et al. Identification, fine mapping and characterisation of a dwarf mutant (bnac.dwf) in Brassica napus. Theor. Appl. Genet. 2011, 122, 421–428. [Google Scholar] [CrossRef] [PubMed]
  87. Li, X.; Xiang, F.J.; Zhang, W.; Yan, J.D.; Li, X.M.; Zhong, M.; Yang, P.; Chen, C.Y.; Liu, X.M.; Mao, D.H.; et al. Characterization and fine mapping of a new dwarf mutant in Brassica napus. BMC Plant Biol. 2021, 21, 117. [Google Scholar] [CrossRef]
  88. Zhao, B.; Wang, B.; Li, Z.H.; Guo, T.; Zhao, J.W.; Guan, Z.L.; Liu, K.D. Identification and characterization of a new dwarf locus DS-4 encoding an aux/IAA7 protein in Brassica napus. Theor. Appl. Genet. 2019, 132, 1435–1449. [Google Scholar] [CrossRef]
  89. Li, H.T.; Li, J.J.; Song, J.R.; Zhao, B.; Guo, C.C.; Wang, B.; Zhang, Q.H.; Wang, J.; King, G.J.; Liu, K.D. An auxin signaling gene BnaA3.IAA7 contributes to improved plant architecture and yield heterosis in rapeseed. New Phytol. 2019, 222, 837–851. [Google Scholar] [CrossRef]
  90. Zheng, M.; Hu, M.L.; Yang, H.L.; Tang, M.; Zhang, L.; Liu, H.F.; Li, X.K.; Liu, J.L.; Sun, X.C.; Fan, S.H.; et al. Three BnaIAA7 homologs are involved in auxin/brassinosteroid-mediated plant morphogenesis in rapeseed (Brassica napus L.). Plant Cell Rep. 2019, 38, 883–897. [Google Scholar] [CrossRef]
  91. Wang, X.D.; Zheng, M.; Liu, H.F.; Zhang, L.; Chen, F.; Zhang, W.; Fan, S.H.; Peng, M.L.; Hu, M.L.; Wang, H.Z.; et al. Fine-mapping and transcriptome analysis of a candidate gene controlling plant height in Brassica napus L. Biotechnol Biofuels. 2020, 13, 42. [Google Scholar] [CrossRef]
  92. Wang, Y.K.; Chen, W.J.; Chu, P.; Wan, S.B.; Yang, M.; Wang, M.M.; Guan, R.Z. Mapping a major QTL responsible for dwarf architecture in Brassica napus using a single-nucleotide polymorphism marker approach. BMC Plant Biol. 2016, 16, 178. [Google Scholar] [CrossRef]
  93. Cheng, H.T.; Jin, F.W.; Zaman, Q.U.; Ding, B.L.; Hao, M.Y.; Wang, Y.; Huang, Y.; Wells, R.; Dong, Y.; Hu, Q. Identification of Bna.IAA7.C05 as allelic gene for dwarf mutant generated from tissue culture in oilseed rape. BMC Plant Biol. 2019, 19, 500. [Google Scholar] [CrossRef]
  94. Yang, M.; Huang, C.W.; Wang, M.M.; Fan, H.; Wan, S.B.; Wang, Y.M.; He, J.B.; Guan, R.Z. Fine mapping of an up-curling leaf locus (BnUC1) in Brassica napus. BMC Plant Biol. 2019, 19, 324. [Google Scholar] [CrossRef]
  95. Huang, C.W.; Yang, M.; Shao, D.L.; Wang, Y.M.; Wan, S.B.; He, J.B.; Meng, Z.Q.; Guan, R.Z. Fine mapping of the BnUC2 locus related to leaf up-curling and plant semi-dwarfing in Brassica napus. BMC Genom. 2020, 21, 530. [Google Scholar] [CrossRef]
  96. Wang, M.L.; Zhao, Y.; Chen, F.; Yin, X.C. Inheritance and potentials of a mutated dwarfing gene ndf1 in Brassica napus. Plant Breed. 2004, 123, 449–453. [Google Scholar] [CrossRef]
  97. Mei, D.S.; Wang, H.Z.; Li, Y.C.; Hu, Q.; Li, Y.D.; Xu, Y.S. The discovery and genetic analysis of dwarf mutation 99CDAM in Brassica napus L. Hereditas 2006, 28, 851–857. (In Chinese) [Google Scholar] [CrossRef]
  98. Nishimura, A.; Tamaoki, M.; Sakamoto, T.; Matsuoka, M. Over-expression of tobacco knotted1-type class1 homeobox genes alters various leaf morphology. Plant Cell Physiol. 2000, 41, 583–590. [Google Scholar] [CrossRef]
  99. Srinivasan, C.; Liu, Z.R.; Scorza, R. Ectopic expression of class 1 KNOX genes induce adventitious shoot regeneration and alter growth and development of tobacco (Nicotiana tabacum L.) and European plum (Prunus domestica L.). Plant Cell Rep. 2011, 30, 655–664. [Google Scholar] [CrossRef]
  100. Xu, Q.L.; Gao, N.; Ruan, M.Y.; Ding, W.Q.; Hu, X.; Wang, C.Y.; Wang, X.Y. Ectopic expression of the PttKN1 gene induced altered leaf morphology and hormonal levels in transgenic tobacco. J. Plant Biochem. Biotechnol. 2015, 24, 197–203. [Google Scholar] [CrossRef]
  101. Cheng, L.R.; Yang, A.G.; Jiang, C.H.; Ren, M.; Zhang, Y.; Feng, Q.F.; Wang, S.M.; Guan, Y.S.; Luo, C.G. Quantitative trait loci mapping for plant height in tobacco using linkage and association mapping methods. Crop Sci. 2015, 55, 641–664. [Google Scholar] [CrossRef]
  102. Zhao, L.; Yang, X.; Du, H.L.; Li, M.M.; Ding, F.Q.; Lv, Q.X.; Wang, C.; Wang, P.P.; Zhang, K.X.; Nie, T.K.; et al. Reduced GA biosynthesis in GmRAV-transgenic tobacco causes the dwarf phenotype. Russ. J. Plant Physiol. 2016, 63, 690–694. [Google Scholar] [CrossRef]
  103. Wang, N.; Sang, X.C.; Li, Y.F.; Yang, Z.L.; Zhao, F.M.; Ling, Y.H.; Zhang, Z.S.; He, G.H. Identification and gene mapping of a novel mutant supernumerary lodicules (snl) in rice. J. Integr. Plant Biol. 2010, 52, 265–272. [Google Scholar] [CrossRef] [PubMed]
  104. Zhang, W.W.; He, H.L.; Yuan, G.; Du, H.; Yuan, L.H.; Li, Z.; Yao, D.Q.; Pan, J.S.; Cai, R. Identification and mapping of molecular markers linked to the tuberculate fruit gene in the cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2010, 120, 645–654. [Google Scholar] [CrossRef]
  105. Miao, H.; Zhang, S.P.; Wang, X.W.; Zhang, Z.H.; Li, M.; Mu, S.Q.; Cheng, Z.C.; Zhang, R.W.; Huang, S.W.; Xie, B.Y.; et al. A linkage map of cultivated cucumber (Cucumis sativus L.) with 248 microsatellite marker loci and seven genes for horticulturally important traits. Euphytica 2011, 182, 167–176. [Google Scholar] [CrossRef]
  106. Piquemal, J.; Cinquin, E.; Couton, F.; Rondeau, C.; Seignoret, E.; Doucet, I.; Perret, D.; Villeger, M.J.; Vincourt, P.; Blanchard, P. Construction of an oilseed rape (Brassica napus L.) genetic map with SSR markers. Theor. Appl. Genet. 2005, 111, 1514–1523. [Google Scholar] [CrossRef] [PubMed]
  107. Cheng, X.M.; Xu, J.S.; Xia, S.; Gu, J.X.; Yang, Y.; Fu, J.; Qian, X.J.; Zhang, S.C.; Wu, J.S.; Liu, K.D. Development and genetic mapping of microsatellite markers from genome survey sequences in Brassica napus. Theor. Appl. Genet. 2009, 118, 1121–1131. [Google Scholar] [CrossRef]
  108. Kenton, A.; Parokonny, A.S.; Gleba, Y.Y.; Bennett, M.D. Characterization of the Nicotiana tabacum L. genome by molecular cytogenetics. Mol. Gen. Genet. 1993, 240, 159–169. [Google Scholar] [CrossRef]
  109. Lim, K.Y.; Matyasek, R.; Kovarik, A.; Leitch, A.R. Genome evolution in allotetraploid Nicotiana. Biol. J. Linn. Soc. 2004, 82, 599–606. [Google Scholar] [CrossRef]
  110. Röder, M.S.; Korzun, V.; Wendehake, K.; Plaschke, J.; Tixier, M.H.; Leroy, P.; Ganal, M.W. A microsatellite map of wheat. Genetics 1998, 149, 2007–2023. [Google Scholar] [CrossRef]
  111. Tong, Z.J.; Yang, Z.M.; Chen, X.J.; Jiao, F.C.; Li, X.Y.; Wu, X.F.; Gao, Y.L.; Xiao, B.G.; Wu, W.R. Large-scale development of microsatellite markers in Nicotiana tabacum and construction of a genetic map of flue-cured tobacco. Plant Breed. 2012, 131, 674–680. [Google Scholar] [CrossRef]
  112. Tong, Z.J.; Xiao, B.G.; Jiao, F.C.; Fang, D.H.; Zeng, J.M.; Wu, X.F.; Chen, X.J.; Yang, J.K.; Li, Y.P. Large-scale development of SSR markers in tobacco and construction of a linkage map in flue-cured tobacco. Breed. Sci. 2016, 66, 381–390. [Google Scholar] [CrossRef]
  113. Michel, V.; Julio, E.; Candresse, T.; Cotucheau, J.; Decorps, C.; Volpatti, R.; Moury, B.; Glais, L.; Dorlhac de Borne, F.; Decroocq, V.; et al. NtTPN1: A RPP8-like R gene required for Potato virus Y-induced veinal necrosis in tobacco. Plant J. 2018, 95, 700–714. [Google Scholar] [CrossRef]
  114. Bao, Y.G.; Ding, N.; Qin, Q.L.; Wu, X.; Martinez, N.; Miller, R.; Zaitlin, D.; Li, D.D.; Yang, S.M. Genetic mapping of the Ph gene conferring disease resistance to black shank in tobacco. Mol. Breed. 2019, 39, 122–131. [Google Scholar] [CrossRef]
  115. Sierro, N.; Battey, J.N.D.; Ouadi, S.; Bovet, L.; Goepfert, S.; Bakaher, N.; Peitsch, M.C.; Ivanov, N.V. Reference genomes and transcriptomes of Nicotiana sylvestris and Nicotiana tomentosiformis. Genome. Biol. 2013, 14, R60. [Google Scholar] [CrossRef] [PubMed]
  116. Sierro, N.; Battey, J.N.D.; Ouadi, S.; Bakaher, N.; Bovet, L.; Willig, A.; Goepfert, S.; Peitsch, M.C.; Ivanov, N.V. The tobacco genome sequence and its comparison with those of tomato and potato. Nat. Commun. 2014, 5, 3833. [Google Scholar] [CrossRef] [PubMed]
  117. Xiao, B.G.; Tan, Y.T.; Long, N.; Chen, X.J.; Tong, Z.J.; Dong, Y.; Li, Y.P. SNP-based genetic linkage map of tobacco (Nicotiana tabacum L.) using next-generation RAD sequencing. J. Biol. Res. 2015, 22, 11. [Google Scholar] [CrossRef] [PubMed]
  118. Gong, D.P.; Huang, L.; Xu, X.H.; Wang, C.Y.; Ren, M.; Wang, C.K.; Chen, M.L. Construction of a high-density SNP genetic map in flue-cured tobacco based on SLAF-seq. Mol. Breed. 2016, 36, 100. [Google Scholar] [CrossRef]
  119. Thimmegowda, G.C.; Ramadoss, S.K.; Kaikala, V.; Rathinavelu, R.; Thamalampudi, V.R.; Dhavala, V.N.C.; Saiprasad, G.V.S. Whole genome resequencing of tobacco (Nicotiana tabacum L.) genotypes and high-throughput SNP discovery. Mol. Breed. 2018, 38, 121. [Google Scholar] [CrossRef]
  120. Cheng, L.R.; Chen, X.C.; Jiang, C.H.; Ma, B.; Ren, M.; Cheng, Y.Z.; Liu, D.; Geng, R.M.; Yang, A.G. High-density SNP genetic linkage map construction and quantitative trait locus mapping for resistance to cucumber mosaic virus in tobacco (Nicotiana tabacum L.). Crop J. 2019, 7, 539–547. [Google Scholar] [CrossRef]
  121. Greene, E.A.; Codomo, C.A.; Taylor, N.E.; Henikoff, J.G.; Till, B.J.; Reynolds, S.H.; Enns, L.C.; Burtner, C.; Johnson, J.E.; Odden, A.R.; et al. Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics 2003, 164, 731–740. [Google Scholar] [CrossRef]
  122. Henikoff, S.; Comai, L. Single-nucleotide mutations for plant functional genomics. Annu. Rev. Plant Biol. 2003, 54, 375–401. [Google Scholar] [CrossRef] [PubMed]
  123. Zan, Y.J.; Chen, S.; Ren, M.; Liu, G.X.; Liu, Y.T.; Si, H.; Liu, Z.W.; Liu, D.; Zhang, X.W.; Tong, Y.; et al. GenBank genomics highlight the genomic features, genetic diversity and regulation of morphological, metabolic and disease-resistance traits in Nicotiana tabacum. bioRxiv 2023, 529366. [Google Scholar] [CrossRef]
Agronomy 13 02354 g001
Figure 1. Comparison of leaf phenotypes between the wild-type HD and the sld mutant. Leaf phenotypes of the wild-type HD at the euphylla cross of the seedling growth period. (a) Leaf phenotypes of the wild-type HD seedlings at the 3–5 leaves with one heart stage. (b) Leaf phenotypic vertical view of the wild-type HD at the rosette stage. (c) Leaf phenotypes of the sld mutant at the euphylla cross of the seedling growth period. (d) Leaf phenotypes of the sld mutant seedlings at the 3–5 leaves with one heart stage. (e) Leaf phenotypic vertical view of the sld mutant at the rosette stage. (f) Top view from the shoot apex of an individual plant (b,c,e,f).
Figure 1. Comparison of leaf phenotypes between the wild-type HD and the sld mutant. Leaf phenotypes of the wild-type HD at the euphylla cross of the seedling growth period. (a) Leaf phenotypes of the wild-type HD seedlings at the 3–5 leaves with one heart stage. (b) Leaf phenotypic vertical view of the wild-type HD at the rosette stage. (c) Leaf phenotypes of the sld mutant at the euphylla cross of the seedling growth period. (d) Leaf phenotypes of the sld mutant seedlings at the 3–5 leaves with one heart stage. (e) Leaf phenotypic vertical view of the sld mutant at the rosette stage. (f) Top view from the shoot apex of an individual plant (b,c,e,f).
Agronomy 13 02354 g001
Agronomy 13 02354 g002
Figure 2. Comparison of plant morphology and ANOVA of major agronomic characteristics. Wild-type HD and the sld mutant plants at the rosette stage, scale bar 1:10 cm (a). Wild-type HD and the sld mutant plants at the full flowering stage, scale bar 1:17 cm (b). The upper (U), middle (M) and lower (L) leaves of wild-type HD and the sld mutant at the flowering stage, scale bar 1:10 cm (c). Main agronomic characteristics of wild-type HD and the sld mutant at the flowering stage in Jimo. The data of each characteristic are the average value ± SD (standard derivation) of five individuals. *** indicates statistically significant difference, determined by Student’s t test at p < 0.001, between wild-type HD and the sld mutant (d). Main agronomic characteristics of wild-type HD and the sld mutant at the flowering stage in Zhucheng. The data of each characteristic are the average value ± SD (standard derivation) of five individuals. ** and *** indicate statistically significant difference, determined by Student’s t-test at 0.001 < p < 0.05 and p < 0.001, between wild-type HD and the sld mutant (e).
Figure 2. Comparison of plant morphology and ANOVA of major agronomic characteristics. Wild-type HD and the sld mutant plants at the rosette stage, scale bar 1:10 cm (a). Wild-type HD and the sld mutant plants at the full flowering stage, scale bar 1:17 cm (b). The upper (U), middle (M) and lower (L) leaves of wild-type HD and the sld mutant at the flowering stage, scale bar 1:10 cm (c). Main agronomic characteristics of wild-type HD and the sld mutant at the flowering stage in Jimo. The data of each characteristic are the average value ± SD (standard derivation) of five individuals. *** indicates statistically significant difference, determined by Student’s t test at p < 0.001, between wild-type HD and the sld mutant (d). Main agronomic characteristics of wild-type HD and the sld mutant at the flowering stage in Zhucheng. The data of each characteristic are the average value ± SD (standard derivation) of five individuals. ** and *** indicate statistically significant difference, determined by Student’s t-test at 0.001 < p < 0.05 and p < 0.001, between wild-type HD and the sld mutant (e).
Agronomy 13 02354 g002
Agronomy 13 02354 g003
Figure 3. Genetic linkage map between the sld locus and tobacco SSR markers using F2 and BC1F1 mapping populations. The gel map showed that the sld locus from one recombinant plant of dwarf spiral individuals in the F2 population was linked to tobacco SSR marker PT60855. (a) Genetic linkage map of the sld locus linked to six tobacco SSR markers on linkage group 5, obtained using the F2 mapping population. The black bar means that the sld locus is located in the minimum interval of the linkage group. The marks above the linkage group bar represent the sld loci and the corresponding SSR markers, which are linked to the sld locus. The sld locus is labeled red. The numbers immediately below the linkage bar represent the genetic distance between two markers (between the marker and loci). The bottom numbers represent the amount of recombinant plants detected by each SSR marker. (b) The gel map showed that one recombinant plant of dwarf spiral individuals was detected in the BC1F1 population. Tobacco SSR marker PT51778 was linked to the sld locus. (c) Genetic linkage map of the sld locus and six tobacco SSR markers, whose relative positions were the same as those of the F2 mapping population, on linkage group 5, was obtained from the BC1F1 population. This validates that the tobacco SSR primers are linked, and that their corresponding linkage group is in the F2 mapping population. (d) M, DNA marker; *, recombinant individual; LG, linkage group; n, number of the recessive sld individuals in the mapping population; cM, centiMorgan.
Figure 3. Genetic linkage map between the sld locus and tobacco SSR markers using F2 and BC1F1 mapping populations. The gel map showed that the sld locus from one recombinant plant of dwarf spiral individuals in the F2 population was linked to tobacco SSR marker PT60855. (a) Genetic linkage map of the sld locus linked to six tobacco SSR markers on linkage group 5, obtained using the F2 mapping population. The black bar means that the sld locus is located in the minimum interval of the linkage group. The marks above the linkage group bar represent the sld loci and the corresponding SSR markers, which are linked to the sld locus. The sld locus is labeled red. The numbers immediately below the linkage bar represent the genetic distance between two markers (between the marker and loci). The bottom numbers represent the amount of recombinant plants detected by each SSR marker. (b) The gel map showed that one recombinant plant of dwarf spiral individuals was detected in the BC1F1 population. Tobacco SSR marker PT51778 was linked to the sld locus. (c) Genetic linkage map of the sld locus and six tobacco SSR markers, whose relative positions were the same as those of the F2 mapping population, on linkage group 5, was obtained from the BC1F1 population. This validates that the tobacco SSR primers are linked, and that their corresponding linkage group is in the F2 mapping population. (d) M, DNA marker; *, recombinant individual; LG, linkage group; n, number of the recessive sld individuals in the mapping population; cM, centiMorgan.
Agronomy 13 02354 g003
Table 1. Genetic analysis of the spiral leaf and dwarf (sld) mutant based on HD × sld and G3 × sld crosses.
Table 1. Genetic analysis of the spiral leaf and dwarf (sld) mutant based on HD × sld and G3 × sld crosses.
Parents and PopulationsNo. of PlantsNo. of sld Mutant PhenotypesNo. of Wild-Type PhenotypesObserved Separation RatioExpected Ratioχ2 < χ20.05 = 3.841
HD15015---
G315015---
sld15150---
(HD × sld) F115015---
(HD × sld) F2167401271:3.181:30.098
(G3 × sld) F115015---
(G3 × sld) F25031123911:3.491:32.005
((G3 × sld) × sld) BC1F13921931991:1.031:10.092
HD: Honghuadajinyuan tobacco variety; G3: Gexinsanhao tobacco variety.
Table 2. Polymorphic SSR primer sequences for the genetic linkage map of the sld mutant gene.
Table 2. Polymorphic SSR primer sequences for the genetic linkage map of the sld mutant gene.
Marker NameForward Primer (5′→3′)Reverse Primer (5′→3′)Repeat MotifRepeat
Number		Number of
Detected Loci		Genome
PT60855TTCCTATCTTTCAATCTTAGATGTGTTTCCCTCTCATCGTCGCTATCGA331B
PT40040CGCCGTCTCTCTCTACTCCATGGAAACTCTTTCCGTTTGATA 1
PT51778AATGATCCAACAGAGCCCAGCACTTGCTGTCCATCTTCCACA121S
PT54913TACCGACCAAACATTCATCGGAACAAATCCAGAAGTTGGGATA91S
PT61414AAAGAAAGGAGGCATGCAAACAATGACTAATAGAATCGGTTACAGGGA111S
PT60933AACGCATGTTAATTATGAGTTCAATCGGAAGATTGAAATACGCCTA171B
Note: PT40040 is from Bindler et al. [78], and the others are from Bindler et al. [73].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, S.; Wu, X.; Guo, Y.; Wang, D.; Cheng, L.; Wang, Y.; Yang, A.; Liu, G. Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.). Agronomy 2023, 13, 2354. https://doi.org/10.3390/agronomy13092354

AMA Style

Wang S, Wu X, Guo Y, Wang D, Cheng L, Wang Y, Yang A, Liu G. Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.). Agronomy. 2023; 13(9):2354. https://doi.org/10.3390/agronomy13092354

Chicago/Turabian Style

Wang, Shaomei, Xinru Wu, Yongfeng Guo, Dawei Wang, Lirui Cheng, Yuanying Wang, Aiguo Yang, and Guanshan Liu. 2023. "Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.)" Agronomy 13, no. 9: 2354. https://doi.org/10.3390/agronomy13092354

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop