Next Article in Journal
Market Price and Supply of Farmland as a Means of Supporting the Wider Development of Sustainable Agricultural Production in Czechia (a Case Study)
Previous Article in Journal
Maize Nitrogen Grading Estimation Method Based on UAV Images and an Improved Shufflenet Network
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 8
10.3390/agronomy13081977
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype

by
Jin-Kyung Cha
,
Hyeonjin Park
,
Youngho Kwon
,
So-Myeong Lee
,
Ki-Won Oh
and
Jong-Hee Lee
*
Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang 50424, Republic of Korea
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(8), 1977; https://doi.org/10.3390/agronomy13081977
Submission received: 20 June 2023 / Revised: 20 July 2023 / Accepted: 25 July 2023 / Published: 26 July 2023
(This article belongs to the Section Crop Breeding and Genetics)
Browse Figures
Review Reports Versions Notes

Abstract

:
Protein content is one of the main factors determining the end-use quality of wheat. NO APICAL MERISTEM-B1 (NAM-B1) is a major gene regulating wheat grain protein content. The present study aimed to identify new genetic resources using the wild-type NAM-B1 allele to breed high-protein-content wheat cultivars. We genotyped the HIGH GRAIN PROTEIN CONTENT-B1 (GPC-B1) locus and NAM-B1 allele in 165 wheat cultivars. A kompetitive allele-specific polymerase chain reaction (KASP) marker was designed for functional NAM-B1 allele screening. The results revealed that 41 out of 165 cultivars carried the GPC-B1 locus. Among the 41 GPC-B1-carrying cultivars, the wild-type NAM-B1 allele was identified in only 3 cultivars, none of which were Korean. The remaining 38 cultivars showed a 1-bp insertion in NAM-B1, resulting in a stop codon in the middle of the gene, rendering it nonfunctional. Overall, this study reveals that the utilization of the three selected cultivars possessing the wild-type NAM-B1 gene, in conjunction with the developed KASP assay, could increase the protein content in Korean wheat cultivars.

1. Introduction

Protein content is a crucial determinant for assessing the quality and applicability of wheat flour [1]. In wheat, NO APICAL MERISTERM-B1 (NAM-B1) is located on the short arm of chromosome 6B and plays a crucial role in regulating the protein content of the grains [2]. NAM-B1 was identified as a quantitative trait locus (QTL) in 1997 using recombinant inbred lines derived from a cross between wild emmer wheat (Triticum turgidum subsp. dicoccoides, AABB) and durum wheat (Triticum turgidum subsp. durum, AABB) [3]. Olmos et al. [4] identified it as HIGH GRAIN PROTEIN CONTENT-B1 (GPC-B1) and discovered that it follows Mendelian inheritance. Distelfeld et al. [5] and Uauy et al. [2] performed fine mapping and identified five genes within the GPC-B1 QTL region. Among these genes, NAM-B1 is associated with the increased protein content in wheat grains (Figure 1a). Moreover, NAM-B1 exhibits three haplotypes: the functional wild-type, NAM-B1, derived from wild emmer wheat; the mutated-type, NAM-B1, with a 1-bp insertion that introduces a stop codon in the middle of the gene, rendering it nonfunctional; and the gene deletion variant [2,4,6] (Figure 1b–d). Only the wild-type NAM-B1 allele retains normal gene function; it increases the grain protein content by accelerating leaf senescence and remobilizing nutrients from leaves to developing grains [7,8].
In common wheat (Triticum aestivum subsp. Aestivum, AABBDD), the effect of wild-type NAM-B1 on increasing the grain protein content is observed across various genotypes and environmental conditions [9]. Notably, a negative correlation exists between protein content and grain yield. However, these findings are based on correlation analyses between agronomic traits and grain protein content, without considering the genetic diversity of the evaluated cultivars [10,11,12]. Uauy et al. [2] confirmed the function of wild-type NAM-B1 by comparing transgenic lines that showed a difference of over 30% in grain protein content without a significant difference in thousand kernel weight. Moreover, the wheat protein content in near-isogenic lines (NIL) or backcrossed lines containing wild-type NAM-B1 was 2.1–72 g/kg of grain, higher than that in the recurrent parents lacking wild-type NAM-B1 [13,14,15,16,17,18]. The introduction of wild-type NAM-B1 does not result in significant differences in grain yield compared to that from recurrent parents [13,14,15,16,17,18]. In addition to the grain protein content, wild-type NAM-B1 increases the thousand-grain weight and grain yield, depending on the genotypes of the recurrent parents [19].
Agronomy 13 01977 g001 550
Figure 1. Three haplotypes of the NO APICAL MERISTEM-B1 (NAM-B1) in HIGH GRAIN PROTEIN CONTENT-B1 (GPC-B1) quantitative trait loci (QTL) region of the wheat chromosome 6BS. (a) NAM-B1 between the markers used for detecting the GPC-B1 QTL region on wheat chromosome 6B in Uauy et al. [2] and Yang et al. [20]. S and L indicate the short and long arms of the chromosome, respectively. The orientation of NAM-B1 is indicated by a black arrow. (b) Functional wild-type NAM-B1. (c) Nonfunctional 1-bp inserted type NAM-B1. (d) Gene deletion type.
Figure 1. Three haplotypes of the NO APICAL MERISTEM-B1 (NAM-B1) in HIGH GRAIN PROTEIN CONTENT-B1 (GPC-B1) quantitative trait loci (QTL) region of the wheat chromosome 6BS. (a) NAM-B1 between the markers used for detecting the GPC-B1 QTL region on wheat chromosome 6B in Uauy et al. [2] and Yang et al. [20]. S and L indicate the short and long arms of the chromosome, respectively. The orientation of NAM-B1 is indicated by a black arrow. (b) Functional wild-type NAM-B1. (c) Nonfunctional 1-bp inserted type NAM-B1. (d) Gene deletion type.
Agronomy 13 01977 g001
The effect of wild-type NAM-B1 on the development of high-protein-content wheat lines was evaluated against the hard red spring wheat cv. Glupro (PI 592759), the original source of the wild-type NAM-B1 allele, or against Glupro-derived inbred lines, which are the commonly-used donor parents in several studies [14,19,21,22,23]. In studies that developed and evaluated wild-type NAM-B1 NIL or backcrossed lines, marker-assisted selection (MAS) commonly used markers such as Xuhw89, Xucw87, and Xucw108, which are closely linked to NAM-B1 [2,5]. However, these markers can only assist in determining the presence or absence of the gene, making it difficult to confirm whether a new source possesses the functional wild-type NAM-B1 allele or the nonfunctional 1-bp inserted NAM-B1 allele. Therefore, it is challenging to discover and utilize new wild-type NAM-B1-allele-harboring genetic resources, which could reduce the genetic diversity of the wild-type NAM-B1-allele-harboring wheat cultivars.
The use of a limited number of wild-type NAM-B1-allele-harboring cultivars, such as cv. Glupro, in wheat breeding has resulted in a considerable decrease in the frequency of this allele during the development of high-yield and environmentally-stable cultivars [6,17,18]. Among the 367 global wheat accessions exhibiting genetic diversity, only five harbored the wild-type NAM-B1 allele [9]. Similarly, only two wild-type NAM-B1-allele-harboring cultivars were reported when 51 Australian wheat cultivars were investigated [20]. Furthermore, in 218 Chinese wheat cultivars, no cultivar harbored the wild-type NAM-B1, only 53 cultivars exhibited nonfunctional NAM-B1, and the remaining cultivars showed gene deletion [6]. Moreover, whole-gene sequencing analysis, encompassing 1544 bp, was conducted on these 53 cultivars, revealing eight regions showing genetic variation. However, the cDNA sequence analysis of these cultivars did not reveal any change in gene function.
The present study aimed to identify new genetic resources harboring the wild-type NAM-B1 allele to enable the breeding of new cultivars with a high protein content and increased genetic diversity. The GPC-B1 locus has been identified in Korean cultivars and genetic resources from other countries and wild-type NAM-B1-allele-harboring cultivars were identified through DNA sequencing. Moreover, the gene-specific kompetitive allele-specific polymerase chain reaction (KASP) marker was developed to enable rapid and efficient MAS for identifying the wild-type NAM-B1 allele for potential use in wheat breeding programs.

2. Materials and Methods

2.1. Wheat Materials

We analyzed a total of 165 wheat cultivars, including 63 Korean cultivars and 102 genetic resources from foreign countries. All genetic resources were obtained from the Gene Bank of the National Institute of Agricultural Sciences, Rural Development Administration, Republic of Korea.

2.2. Genotyping the GPC-B1 Locus and NAM-B1 Allele

For genotyping GPC-B1 and NAM-B1, DNA was extracted from the fresh seedling leaves of each cultivar using a MagMAX DNA Multi-Sample Kit (Applied Biosystems, Woburn, MA, USA) and Kingfisher DNA extraction machine (Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions. Polymerase chain reaction (PCR) was performed using Xucw108 and Xucw109 primers (Table 1) to confirm the presence of the GPC-B1 QTL region using the following thermal cycling conditions: initial denaturation at 95 °C for 5 min; followed by 40 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min, and extension at 72 °C for 40 s; and a final extension at 72 °C for 7 min. The PCR products were separated through electrophoresis on a 3% agarose gel at 200 V for 45 min.
Subsequently, the NAM-B1-specific pair two primers were used for the PCR amplification of NAM-B1 in GPC-B1-carrying cultivars. The PCR conditions were as follows: initial denaturation at 94 °C for 10 min; 40 cycles of denaturation at 94 °C for 45 s, annealing at 56 °C for 45 s, and extension at 72 °C for 1 min; and a final extension at 72 °C for 5 min. The PCR products corresponding to the 555-bp band were extracted from the agarose gel and subjected to Sanger sequencing using the reverse NAM-B1-specific pair two primers. Gel extraction and Sanger sequencing were performed using services provided by the Bioneer Corporation (Daejeon, Korea).

2.3. Development and Evaluation of a KASP Marker for Identifying the NAM-B1 Allele

A KASP marker was designed to genotype the NAM-B1 allele, using the reference NAM-B1 sequence (accession number MG587691) obtained from the National Center for Biotechnology Information. The KASP marker was designed using the KASP assay design service provided by LGC Genomics (LGC Ltd., Teddington, UK). The PCR conditions were as follows: denaturation at 95 °C for 15 min; 10 touchdown cycles at 95 °C for 20 s; annealing starting at 65 °C and decreasing by 1 °C per cycle for 25 s; additional 30 annealing cycles at 95 °C for 10 s and 57 °C for 1 min; and a final extension at 72 °C for 5 min. Fluorescence detection and data analysis were performed using a QuantStudio 3 real-time PCR instrument and the QuantStudio Design & Analysis Software v1.5.1 (Applied Biosystems, Carlsbad, CA, USA), respectively.

3. Results and Discussion

3.1. Selecting GPC-B1-Carrying Cultivars and Analysis of NAM-B1 Alleles

A total of 165 wheat cultivars were screened using Xucw108 and Xucw109 markers to identify the presence of the GPC-B1 QTL locus. Both markers exhibited polymorphism among the cultivars, and the presence or absence of the 217-bp band for Xucw108 and the 212-bp band for Xucw109 was consistent across the cultivars (Figure 2A,B). Among the 165 cultivars, 41 harbored GPC-B1 (Table 2 and Table S1). Among those 41 cultivars, only 9 Korean cultivars, cv. Ariheukchal, Arijinheuk, Joah, Olgeuru, Saekeumkang, Saeol, Joongmo2013, Jeonju410, and Jeonju416, harbored GPC-B1. The remaining 125 cultivars did not possess the GPC-B1 locus, indicating that >85% of the Korean cultivars and >75% of the 165 cultivars lacked this region.
Xucw108 and Xucw109 were positioned within the flanking region (approximately 7.4 kb) of NAM-B1. The gene reportedly loses its functionality even with a 1-bp insertion within the gene [2,24]. Therefore, NAM-B1 sequences from all 41 GPC-B1-containing cultivars were analyzed (Table S1) to identify the cultivars carrying the functional wild-type NAM-B1 allele. Sanger sequencing using the NAM-B1-specific pair two primers showed that three cultivars, cv. Benhur (IT15821), BETHLEHEM (IT176584), and PI 350731 (IT336105), possessed the functional wild-type NAM-B1 allele (Table 3 and Table S2). The results for PI350731 were consistent with those reported by Uauy et al. [2] and Lundström et al. [25]. The findings for BETHLEHEM were similar to those previously reported by Yang et al. [20]. Benhur was identified as a novel cultivar that possessed wild-type NAM-B1; this could contribute to increasing the genetic diversity of wheat cultivars during breeding programs.
The remaining 38 cultivars exhibited a genotype characterized by a 1-bp insertion at the 11th single nucleotide polymorphism (SNP) region from the start codon ATG, resulting in a loss of gene function. The cv. Chinese spring showed a 1-bp insertion, consistent with previous studies by Uauy et al. [2] and Lundström et al. [25]. Moreover, the identification of only three cultivars harboring the wild-type NAM-B1 allele among the 165 cultivars aligned with the results of previous studies suggesting the gene loss of wild-type NAM-B1, which was originally introduced from wild emmer wheat, during the breeding process [17].

3.2. Development of a NAM-B1-Specific KASP Marker for the Efficient Breeding of Wheat with High-Protein-Content

The Xucw108 and Xucw109 markers (Section 3.1) can only be used to determine the presence or absence of the GPC-B1 locus. Therefore, DNA sequencing was required to identify the functional wild-type NAM-B1 gene. We designed a KASP marker and evaluated it for the rapid and efficient selection of wild-type NAM-B1-carrying wheat lines in wheat breeding programs. The results showing wild-type NAM-B1-carrying cultivars are presented on the X-axis, whereas those with the 1-bp-inserted nonfunctional NAM-B1 genotype are presented on the Y-axis (Figure 3, Table S2). These findings were consistent with the DNA sequencing results (Table 3 and Table S2). Therefore, wild-type NAM-B1 and nonfunctional NAM-B1 were easily classifiable using the developed KASP marker. However, NAM-B1 gene deletion was also observed on the X-axis when evaluating cultivars derived from the cross between the wild-type NAM-B1-carrying and NAM-B1 deletion cultivars. Therefore, the use of the Xucw108 or Xucw109 markers can be more beneficial than the use of the developed KASP marker when determining the presence or absence of the GPC-B1 locus in new genetic resources.
Although some genetic resources harbor valuable genes such as NAM-B1, their introduction into leading cultivars is necessary to ensure the stability of the cultivation characteristics in specific environments. MAS facilitates the fixation of desirable genes in early generations during breeding programs [26]. Moreover, a recently established speed vernalization system, which is a wheat generation acceleration system, has been shown to reduce the breeding cycle period [27]. Therefore, integrating MAS using the novel KASP marker with the wheat generation acceleration system will accelerate the breeding of NAM-B1-harboring cultivars, rendering it more efficient.

4. Conclusions

NAM-B1 is a major factor affecting the protein content of wheat grains. In this study, the GPC-B1 QTL and NAM-B1 genes were evaluated in 165 wheat cultivars collected worldwide. Among the 165 wheat cultivars examined, 41 harbored the GPC-B1 QTL region and 124 exhibited the GPC-B1 deletion. Among the 41 GPC-B1-harboring cultivars, 3 cultivars (cv. Benhur, BETHLEHEM, and PI 350731) harbored the wild-type NAM-B1 allele, with cv. Benhur being a novel cultivar reported in this study. The remaining 38 cultivars harbored a 1-bp-inserted nonfunctional NAM-B1 allele. The KASP marker developed in this study enabled the distinction between wild-type and nonfunctional NAM-B1 alleles, allowing the identification of wild-type NAM-B1-harboring cultivars which can be used to introduce wild-type NAM-B1 into the wheat lines. These results have important implications for the rapid and efficient introduction of the wild-type NAM-B1 allele into new breeding lines and the development of high-protein-content wheat cultivars.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13081977/s1. Table S1: List of genetic resources evaluated for the presence of HIGH GRAIN PROTEIN CONTENT-B1. Table S2: Genotyping results of sequencing and kompetitive allele-specific polymerase chain reaction assay for NO APICAL MERISTEM-B1.

Author Contributions

Conceptualization, J.-H.L. and J.-K.C.; methodology, J.-K.C. and H.P.; software, H.P., S.-M.L. and J.-K.C.; validation, J.-H.L.; formal analysis, Y.K. and S.-M.L.; investigation, J.-K.C., Y.K. and H.P.; resources, H.P. and J.-K.C.; data curation, J.-K.C. and H.P.; writing-original draft preparation, J.-K.C.; writing-review and editing, J.-H.L. and J.-K.C.; visualization, Y.K. and J.-K.C.; supervision, J.-H.L. and K.-W.O.; project administration, J.-H.L.; and funding acquisition, J.-H.L. and K.-W.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research was carried out with the support of “Research Program for Agriculture Science & Technology Development (Project Number: PJ015055012023)” Rural Development Administration, Republic of Korea.

Data Availability Statement

The data presented in this study are available in the Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sharma, A.; Garg, S.; Sheikh, I.; Vyas, P.; Dhaliwal, H.S. Effect of wheat grain protein composition on end-use quality. J. Food Sci. Technol. 2020, 57, 2771–2785. [Google Scholar] [CrossRef]
  2. Uauy, C.; Distelfeld, A.; Fahima, T.; Blechl, A.; Dubcovsky, J. A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 2006, 314, 1298–1301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Joppa, L.R.; Du, C.; Hart, G.E.; Hareland, G.A. Mapping gene(s) for grain protein in tetraploid wheat (Triticum turgidum L.) using a population of recombinant inbred chromosome lines. Crop Sci. 1997, 37, 1586–1589. [Google Scholar] [CrossRef]
  4. Olmos, S.; Distelfeld, A.; Chicaiza, O.; Schlatter, A.R.; Fahima, T.; Echenique, V.; Dubcovsky, J. Precise mapping of a locus affecting grain protein content in durum wheat. Theor. Appl. Genet. 2003, 107, 1243–1251. [Google Scholar] [CrossRef] [Green Version]
  5. Distelfeld, A.; Uauy, C.; Fahima, T.; Dubcovsky, J. Physical map of the wheat high-grain protein content gene Gpc-B1 and development of a high-throughput molecular marker. New Phytol. 2006, 169, 753–763. [Google Scholar] [CrossRef] [Green Version]
  6. Chen, X.Y.; Song, G.Q.; Zhang, S.J.; Li, Y.L.; Gao, J.; Shahidul, I.; Ma, W.; Li, G.Y.; Ji, W.Q. The allelic distribution and variation analysis of the NAM-B1 gene in Chinese wheat cultivars. J. Integr. Agric. 2017, 16, 1294–1303. [Google Scholar] [CrossRef] [Green Version]
  7. Brevis, J.C.; Dubcovsky, J. Effects of the chromosome region including the Gpc-B1 locus on wheat grain and protein yield. Crop Sci. 2010, 50, 93–104. [Google Scholar] [CrossRef] [Green Version]
  8. Waters, B.M.; Uauy, C.; Dubcovsky, J.; Grusak, M.A. Wheat (Triticum aestivum) NAM proteins regulate the translocation of iron, zinc, and nitrogen compounds from vegetative tissues to grains. J. Exp. Bot. 2009, 60, 4263–4274. [Google Scholar] [CrossRef] [Green Version]
  9. Hagenblad, J.; Asplund, L.; Balfourier, F.; Ravel, C.; Leino, M.W. Strong presence of the high grain protein content allele of NAM-B1 in Fennoscandan wheat. Theor. Appl. Genet. 2012, 125, 1677–1686. [Google Scholar] [CrossRef]
  10. Aydin, N.; Sermet, C.; Mut, Z.; Bayramoglu, H.O.; Özcan, H. Path analyses of yield and some agronomic and quality traits of bread wheat (Triticum aestivum L.) in different environments. Afr. J. Biotechnol. 2010, 9, 5131–5134. [Google Scholar]
  11. Bogard, M.; Jourdan, M.; Allard, V.; Martre, P.; Perretant, M.R.; Ravel, C.; Heumez, E.; Orford, S.; Snape, J.; Griffiths, S.; et al. Anthesis date mainly explained correlations between post-anthesis leaf senescence, grain yield, and grain protein concentration in a winter wheat population segregating for flowering time QTLs. J. Exp. Bot. 2011, 62, 3621–3636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Bordes, J.; Branlard, G.; Oury, F.X.; Charmet, G.; Balfourier, F. Agronomic characteristics, grain quality and flour rheology of 372 bread wheats in a worldwide core collection. J. Cereal Sci. 2008, 48, 569–579. [Google Scholar] [CrossRef]
  13. Carter, A.H.; Santra, D.K.; Kidwell, K.K. Assessment of the effects of the Gpc-B1 allele on senescence rate, grain protein concentration and mineral content in hard red spring wheat (Triticum aestivum L.) from the Pacific Northwest Region of the USA. Plant Breed. 2012, 131, 62–68. [Google Scholar] [CrossRef]
  14. Kuhn, J.C.; Stubbs, T.L.; Carter, A.H. Effect of the Gpc-B1 allele in hard red winter wheat in the US Pacific Northwest. Crop Sci. 2016, 56, 1009–1017. [Google Scholar] [CrossRef]
  15. Kumar, J.; Jaiswal, V.; Kumar, A.; Kumar, N.; Mir, R.R.; Kumar, S.; Dhariwal, R.; Tyagi, S.; Khandelwal, M.; Prabhu, K.V.; et al. Introgression of a major gene for high grain protein content in some Indian bread wheat cultivars. Field Crops Res. 2011, 123, 226–233. [Google Scholar] [CrossRef]
  16. Maphosa, L.; Collins, N.C.; Taylor, J.; Mather, D.E. Post-anthesis heat and a Gpc-B1 introgression have similar but non-additive effects in bread wheat. Funct. Plant Biol. 2014, 41, 1002–1008. [Google Scholar] [CrossRef]
  17. Tabbita, F.; Pearce, S.; Barneix, A.J. Breeding for increased grain protein and micronutrient content in wheat: Ten years of the GPC-B1 gene. J. Cereal Sci. 2017, 73, 183–191. [Google Scholar] [CrossRef]
  18. Vishwakarma, M.K.; Mishra, V.K.; Gupta, P.K.; Yadav, P.S.; Kumar, H.; Joshi, A.K. Introgression of the high grain protein gene Gpc-B1 in an elite wheat variety of Indo-Gangetic Plains through marker assisted backcross breeding. Curr. Plant Biol. 2014, 1, 60–67. [Google Scholar] [CrossRef] [Green Version]
  19. Gupta, P.K.; Balyan, H.S.; Chhuneja, P.; Jaiswal, J.P.; Tamhankar, S.; Mishra, V.K.; Bains, N.S.; Chand, R.; Joshi, A.K.; Kaur, S.; et al. Pyramiding of genes for grain protein content, grain quality, and rust resistance in eleven Indian bread wheat cultivars: A multi-institutional effort. Mol. Breed. 2022, 42, 21. [Google Scholar] [CrossRef]
  20. Yang, R.; Juhasz, A.; Zhang, Y.; Chen, X.; Zhang, Y.; She, M.; Zhang, J.; Maddern, R.; Edwards, I.; Diepeveen, D.; et al. Molecular characterisation of the NAM-1 genes in bread wheat in Australia. Crop Pasture Sci. 2018, 69, 1173–1181. [Google Scholar] [CrossRef]
  21. Singh, C.; Srivastava, P.; Sharma, A.; Chhuneja, P.; Sohu, V.S.; Bains, N.S. Effect of Gpc-B1 gene on grain protein content and productivity traits in a set of high yielding wheat lines. Indian J. Genet. Plant Breed. 2018, 78, 211–216. [Google Scholar] [CrossRef]
  22. Velu, G.; Singh, R.P.; Cardenas, M.E.; Wu, B.; Guzman, C.; Ortiz-Monasterio, I. Characterization of grain protein content gene (GPC-B1) introgression lines and its potential use in breeding for enhanced grain zinc and iron concentration in spring wheat. Acta Physiol. Plant. 2017, 39, 212. [Google Scholar] [CrossRef]
  23. Vishwakarma, M.K.; Arun, B.; Mishra, V.K.; Yadav, P.S.; Kumar, H.; Joshi, A.K. Marker-assisted improvement of grain protein content and grain weight in Indian bread wheat. Euphytica 2016, 208, 313–321. [Google Scholar] [CrossRef]
  24. Asplund, L.; Hagenblad, J.; Leino, M.W. Re-evaluating the history of the wheat domestication gene NAM-B1 using historical plant material. J. Archaeol. Sci. 2010, 37, 2303–2307. [Google Scholar] [CrossRef]
  25. Lundström, M.; Leino, M.W.; Hagenblad, J. Evolutionary history of the NAM-B1 gene in wild and domesticated tetraploid wheat. BMC Genet. 2017, 18, 118. [Google Scholar] [CrossRef] [PubMed]
  26. Vagndorf, N.; Kristensen, P.S.; Andersen, J.R.; Jahoor, A.; Orabi, J. Marker-assisted breeding in wheat. Next Gener. Plant Breed. 2018, 1, 3–22. [Google Scholar]
  27. Cha, J.K.; O’Connor, K.; Alahmad, S.; Lee, J.H.; Dinglasan, E.; Park, H.; Lee, S.M.; Hirsz, D.; Kwon, S.W.; Kwon, Y.; et al. Speed vernalization to accelerate generation advance in winter cereal crops. Mol. Plant 2022, 15, 1300–1309. [Google Scholar] [CrossRef]
Agronomy 13 01977 g002 550
Figure 2. Evaluation of genetic resources with molecular markers (A) Xucw108 and (B) Xucw109 for detecting the HIGH GRAIN PROTEIN CONTENT-B1 locus.
Figure 2. Evaluation of genetic resources with molecular markers (A) Xucw108 and (B) Xucw109 for detecting the HIGH GRAIN PROTEIN CONTENT-B1 locus.
Agronomy 13 01977 g002
Agronomy 13 01977 g003 550
Figure 3. Evaluation of the kompetitive allele-specific polymerase chain reaction assay for identifying the NO APICAL MERISTEM-B1 (NAM-B1) genotype. Genotypes on the X-axis represent NAM-B1 deletion or functional wild-type. Genotypes on the Y-axis are nonfunctional types (T insertion). The black square indicates the No Template Control (NTC).
Figure 3. Evaluation of the kompetitive allele-specific polymerase chain reaction assay for identifying the NO APICAL MERISTEM-B1 (NAM-B1) genotype. Genotypes on the X-axis represent NAM-B1 deletion or functional wild-type. Genotypes on the Y-axis are nonfunctional types (T insertion). The black square indicates the No Template Control (NTC).
Agronomy 13 01977 g003
Table
Table 1. Primer sequences and PCR conditions for genotyping GPC-B1 and NAM-B1.
Table 1. Primer sequences and PCR conditions for genotyping GPC-B1 and NAM-B1.
LocusMarker TypePrimer NamePrimer Sequence (5′-3′)Product Size (bp)Annealing TemperatureReference
GPC-B1SSRXucw108AGCCAGGGATAGAGGAGGAA21758 °CUauy et al. [2]
AGCTGTGAGCTGGTGTCCTT
Xucw109ATCTGCAATTCCAGGCACAC21258 °C
CCAGCAGATCAAGGAGAATTG
NAM-B1SequencingNAM-B1-specific pair 2GGAAGAATATAAAAATACTACTTGTGC55556 °C
CTCCGTTCCTTCCTTCACAC
NAM-B1KASPFAMGAGCCGGAAGATGAGTCGGAG-65→55 °C
(−1 °C/cycle), 57 °C		This study
HEXGAGCCGGAAGATGAGTCGGAA
CommonGGGAAGAAGATCTGATGAGGTCCAT
GPC-B1, HIGH GRAIN PROTEIN CONTENT-B1; NAM-B1, NO APICAL MERISTEM-B1; KASP, kompetitive allele-specific polymerase chain reaction; SSR, simple sequence repeats; FAM, fluorescein amidite; HEX, hexachlorofluorescein; and bp, base pair.
Table
Table 2. The HIGH GRAIN PROTEIN CONTENT-B1 (GPC-B1) locus distribution among the 165 wheat cultivars evaluated in this study.
Table 2. The HIGH GRAIN PROTEIN CONTENT-B1 (GPC-B1) locus distribution among the 165 wheat cultivars evaluated in this study.
GPC-B1KoreanOthersTotal
Number of CultivarsFrequency (%)Number of CultivarsFrequency (%)Number of CultivarsFrequency (%)
Presence914.33231.14124.7
Absence5485.77168.912575.3
Table
Table 3. List of cultivars harboring the wild-type or 1-bp-inserted NAM-B1 verified using Sanger sequencing and KASP assay analysis. Detailed information is presented in Table S2.
Table 3. List of cultivars harboring the wild-type or 1-bp-inserted NAM-B1 verified using Sanger sequencing and KASP assay analysis. Detailed information is presented in Table S2.
NAM-B1SNP 1NumberCultivars
Wild-type-3Benhur, BETHLEHEM, PI 350731
1-bp insertionT38Chinese Spring, Ariheukchal, etc.
1 Located on the 11th SNP from the start codon “ATG” of NAM-B1. NAM-B1, NO APICAL MERISTEM-B1; SNP, single nucleotide polymorphism; and KASP, kompetitive allele-specific polymerase chain reaction.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cha, J.-K.; Park, H.; Kwon, Y.; Lee, S.-M.; Oh, K.-W.; Lee, J.-H. Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype. Agronomy 2023, 13, 1977. https://doi.org/10.3390/agronomy13081977

AMA Style

Cha J-K, Park H, Kwon Y, Lee S-M, Oh K-W, Lee J-H. Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype. Agronomy. 2023; 13(8):1977. https://doi.org/10.3390/agronomy13081977

Chicago/Turabian Style

Cha, Jin-Kyung, Hyeonjin Park, Youngho Kwon, So-Myeong Lee, Ki-Won Oh, and Jong-Hee Lee. 2023. "Genotyping the High Protein Content Gene NAM-B1 in Wheat (Triticum aestivum L.) and the Development of a KASP Marker to Identify a Functional Haplotype" Agronomy 13, no. 8: 1977. https://doi.org/10.3390/agronomy13081977

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop