Next Article in Journal
Susceptibility of Selected Crops to Simulated Imazethapyr Carryover: A Morpho-Anatomical Analysis
Next Article in Special Issue
Evaluation of Tulasnella and Ceratobasidium as Biocontrol Agents of Fusarium Wilt on Vanilla planifolia
Previous Article in Journal
Assessment of the Rhizosphere Bacterial Community under Maize Growth Using Various Agricultural Technologies with Biomodified Mineral Fertilizers
Previous Article in Special Issue
Secondary Metabolites of Pathogenic Fungi in Triticum durum Grain Protected with Debaryomyces hansenii in Two Different Locations in Poland
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 7
10.3390/agronomy13071856
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Pseudomonas fluorescens SP007S Formulations in Controlling Soft Rot Disease and Promoting Growth in Kale

by
Aphisit Nilmat
1,
Wannaporn Thepbandit
1,
Wilawan Chuaboon
1,2 and
Dusit Athinuwat
1,2,*
1
Faculty of Science and Technology, Thammasat University, Khlong Nueng 12121, Pathumtani, Thailand
2
Center of Excellence in Agriculture Innovation Center through Supply Chain and Value Chain, Thammasat University, Khlong Nueng 12121, Pathumtani, Thailand
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(7), 1856; https://doi.org/10.3390/agronomy13071856
Submission received: 13 June 2023 / Revised: 27 June 2023 / Accepted: 3 July 2023 / Published: 13 July 2023
(This article belongs to the Special Issue Biological Control as a Crucial Tool to Sustainable Food Production)
Browse Figures
Versions Notes

Abstract

:
Kale has gained popularity as a healthy food choice due to its rich nutrient profile. However, kale production systems are also affected by various pests and diseases, especially plant pathogenic bacteria, such as Pectobacterium carotovorum. The purpose of this research was to investigate the biocontrol activity of the Pseudomonas fluorescens strain SP007s and develop a formulation that provides stability, long shelf life, and disease control, as well as promoting growth in kale; we expect this formulation to have further commercial applications in the cultivation of kale. The results indicated that a unique mixture of paper sludge, sugar sludge, and glycerol at 40% relative humidity promoted SP007 survival for 6 months at room temperature (30 °C) with measures of 5.92 × 106 CFU/g. This treatment maintained the control efficacy of P. carotovorum in infected soil within 28 days of soil drenching. We evaluated the SP007s formula for controlling soft rot disease in greenhouse conditions, and our results revealed that it can reduce the disease in kale by 65.2% and promotes growth in terms of canopy width, shoot height, number of leaves per plant, fresh weight, and dry weight, which were superior to the control. In addition, the formula can induce the accumulation of endogenous salicylic acid and phenolic compounds, as well as a systemic acquired resistance pathway in the plant defense system. Therefore, the formula of SP007s can be a promising novel biocontrol formula for use in kale production, as it promotes plant growth and acts against P. carotovorum causal soft rot disease.

1. Introduction

Kale (Brassica oleracea var. acephala) is a nutritious food rich in antioxidants, vitamin C, vitamin K, and beta-carotene [1]. This cultivar contains minerals that can contribute to heart health, weight loss, eye health, and other conditions [2]. However, the production of kale still faces problems related to diseases, especially the soft rot disease caused by P. carotovorum in tropical and sub-tropical areas [3]. Biocontrol involves the use of beneficial micro-organisms or natural products to prevent or control plant diseases that have been characterized based on their antagonitic effects against agricultural pathogens [4]. Moreover, such micro-organisms have been exploited as eco-friendly substitutes for pesticides, as they produce antimicrobial compounds that can activate plant immunity to combat a broad range of plant pathogens. Previous studies revealed the general approaches and potential of biocontrol agents that have been explored as a means of controlling soft rot diseases in vegetables, including the use of Trichoderma spp., Bacillus spp., and Pseudomonas spp. [5,6]. The utilization of beneficial microbes or their metabolites is a crucial strategy for preventing and controlling soil-borne diseases. Azaiez et al. [7] reported that the use of Bacillus amyloliquefaciens strain Ar10 suppresses the growth of the soft rot bacterium P. carotovorum by producing glycolipid-like compounds and biofilm, which can act as a physical barrier against the entry and colonization of P. carotovorum. Likewise, the report by Cui et al. [8] stated that B. amyloliquefaciens KC-1 effectively reduced the symptoms of bacterial soft rot in Chinese cabbage.
In modern agriculture, Pseudomonas species have been thoroughly investigated in regard to their ability to promote plant development and the biocontrol of plant diseases. They have a wide range of beneficial effects, including the solubilization of nutrients, the stimulation of plant growth, the production of antibiotics, the destruction of some organic and inorganic contaminants, and the bioremediation of heavy metals and pesticides. Pseudomonas strains will be essential for sustaining agricultural output and soil health in the coming decades, since there is increasing global concern about environmental contamination and the cultivation of pesticide-free organic crops. Abdelraouf et al. [9] demonstrated that the endophytic Pseudomonas fluorescens MACC 8904 significantly reduces the severity of Fusarium oxysporum infections, which are the cause of wilt disease in tomato plants. In the same line, the report by Zhong et al. [10] determined that P. fluorescens can be a viable alternative to traditional bactericides for the management of gray mold disease caused by Botrytis cinerea in grapes by producing volatile organic compounds. In addition, volatile organic compounds produced by P. fluorescens can induce host–defense mechanisms against pathogens and trigger plant defense responses throughout an entire plant [11,12]. Prathuangwong et al. [13] reported that the P. fluorescens strain SP007s increased the accumulation of plant defense enzymes, including β-1,3-glucanase, phenylalanineammonia-lyase (PAL), peroxidase (POX), and superoxide dismutase (SOD), that can promote plant immune systems and plant health. In addition, SP007s can produce indole-3-acetic acid (IAA) and gibberellins (GA3), which function as plant-growth regulators [14]. However, the ability of P. fluorescens to survive and thrive depends on various environmental conditions, such as the type of soil, humidity, temperature, plant host, and nutrient availability. The growth curve of P. fluorescens typically consists of four main phases—lag phase, exponential (log) phase, stationary phase, and death phase—all of which take 5 to 10 days to complete [15]. The P. fluorescens stationary phase is frequently used to determine biocontrol formulations. This phase represents a critical stage in which the bacterium reaches a stable population size and exhibits beneficial characteristics for biocontrol purposes. Biocontrol formulations typically require a certain shelf life, which refers to the period during which the product remains effective. Stationary phase cells are generally more robust and can better withstand storage conditions, allowing them to maintain their biocontrol efficacy for an extended period. Thus, understanding the proper formulation that favors the survival of P. fluorescens can be valuable in agricultural applications. In the present study, we assessed the potential of the P.  fluorescens strain SP007s to control soft rot disease caused by P. carotovorum and developed a new formulation to enhance the survival and effectiveness of the bacterium at the target sites, ensuring its efficacy in the biocontrol of pathogens and promoting growth for use in kale production systems.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

The P. fluorescens strain SP007s was obtained from the Department of Plant Pathology, Kasetsart University, Thailand, and isolated from Cauliflower rhizoshere [16], which was grown in Luria Bertani (LB) broth at 28 ± 1 °C, followed by continuous shaking at 180 RPM for 48 h.
A virulent strain of P. carotovorum was provided by the Plant Pathology Section of Thammasat University. P. carotovorum was grown using nutrient broth (NB) kept at 25 ± 2 °C for 48 h.

2.2. Evaluation of Antagonistic Activity of P. fluorescens SP007s

The antagonistic activity was tested using the agar-well diffusion method. Briefly, 10 mL of the P. carotovorum suspension (108 CFU/mL) was added to 100 mL of nutrient agar (NA) at 40 °C in the liquid phase, then poured on each Petri dish. After solidification, the wells were made using a 5 mm cork borer. Then, 10 μL of SP007s suspension (108 CFU/mL) was dropped in the well and its evolution was compared against a negative control (sterilized water) and the positive controls. Two types of positive control, including amoxicillin (200 g/mL) as an antibiotic and copper hydroxide (77%) as a chemical control, were used in this experiment separately. The Petri dishes were incubated at 28 °C for 72 h. The calculation of the antagonistic activity was determined by observing a distinct area of inhibition after 72 hours.

2.3. Preparation of P. fluorescens SP007s Formulations

The SP007s cell suspension was formulated into six different formulations (final concentration as 1010 CFU/mL), as shown in Table 1. The inert carriers, enrichment, and additive materials were mixed and sterilized by autoclaving at 121 °C, 15 min, twice. The SP007s cells were added to each formulation and mixed well under aseptic conditions; then, the mixtures were air-dried in a laminar flow chamber for 48 h. After drying, a 1 g sample was removed to proceed with the initial population counts. Aliquots of 1 mL from serial dilutions (10−10) of the homogenates were spread on a King’s B medium. The colonies were picked up and grown in the King’s B medium and validated through polymerase chain reaction (PCR) amplification of their 16S rDNA gene. The genomic DNA was extracted using the CTAB DNA extraction method [17]. The bacterial 16S rDNA primer Ps-for (5′GGTCTGAGAGGATGATCAGT3′) and Ps-rev (5′TTAGCTCCACCTCGCGGG3′) were used to amplify the 16S rDNA gene region [18]. The PCR was performed using a DNA Engine DYAD™ Peltier Thermal Cycler. Thermal cycling was performed by applying an initial denaturation at 94 °C for 5 min, followed by 30 cycles at 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1.5 min, and a final extension at 72 °C for 8 min. The obtained fragments were analyzed via gel electrophoresis (24 × 12 cm) with 2% agarose, and configured at 80 V for 2 h. The resulting PCR products were taken for sequencing, which was performed using the BLAST analysis program.

2.4. Effect of P. fluorescens SP007s Formulation on Bacterium Survival

The shelf life of the SP007s formulations stored at room temperature was determined for 6-month storage. The viable cells in each formulation were evaluated by counting cfu using the standard dilution plating method on the King’s B medium.

2.5. Effect of P. fluorescens SP007s Formulation on Inhibiting P. carotovorum in Soil

The soil was inoculated with P. carotovorum by mixing 100 mL of the bacterial suspension into 1 kg of sterile soil, adjusted to 108 CFU/g, and then subjected to air-drying for 20 min. The infested soil was treated with the SP007s formulation (1 × 1010 CFU/g) to be compared with the SP007s cell suspension (1 × 1010 CFU/mL), the copper hydroxide 77%, and the water-mock. Subsequently, 10 g of the SP007s formulation was added to each soil pot that contained 500 g of infected soil; then, it was mixed well under aseptic conditions (approximately 108 CFU/g), and kept at room temperature. The soil samples were collected from each treatment to evaluate the P. carotovorum population every 7, 14, 21, and 28 days after the treatment application using the serial dilution method [19]. Then, 2 g of soil was mixed into 2 mL of sterile phosphate-buffered saline (PBS). Afterwards, the tubes were centrifuged for 5 min at 5000× g, and 1 mL of supernatant was mixed with 9 mL of PBS, yielding a 1:10 dilution. The spread plate technique was used to count the number of P. carotovorum bacterial colonies evenly distributed on the pectobacterium selective agar (PSA) medium. Then, DNA sequencing and BLAST analysis were performed to validate the strain.

2.6. Effect of SP007s Formulation on Controlling Soft Rot Disease

The experiment was conducted in a completely randomized design (CRD) with four replications. The selected formulation was evaluated for its ability to control soft rot disease. Kale seedlings were sown in 30 cm pots which contained 500 kg of sterilized soil. The SP007s formulation at a dose of 10 g was mixed in the pot twice at 15 and 30 days post-planting. For positive controls, 10 mL doses of SP007s cell suspension and copper hydroxide were utilized, whereas sterilized water was used as the negative control. The disease incidents of soft rot were recorded using the following equation: p = D/T, where “D” is the total number of infected plants, and “T” is the total number of plants.

2.7. Effect of P. fluorescens SP007s Formulation on Simulation of Plant Defense

2.7.1. Endogenous Salicylic Acid (SA) Contents

The experiment was conducted in CRD with four replications. Kale leaf samples (0.5 g) were obtained from each treatment 45 days after planting to evaluate the endogenous SA contents. The leaf samples were homogenized with 1 mL of a buffer solution composed of 90% methanol, 9% glacial acetic acid, and 1% water after being immersed in liquid nitrogen (LN2). The ground samples were centrifuged at 14,000× g for 10 min at 4 °C. The supernatant was transferred into an Eppendorf tube containing 0.5 mL of 0.02 M ferric ammonium sulfate and incubated for 5 min at 30 °C. Then, using a Bio-Tek microplate reader, the absorbance at 530 nm was measured in 200 μL of each sample on a 96-well plate (Winooski, VT, USA). The endogenous SA was calculated through comparison with the standard references.

2.7.2. Total Phenolic Compounds

A slightly modified Folin–Ciocalteu assay [20] was used to analyze the phenolic compound accumulation. Leaf samples (0.5 g) were soaked in LN2 and then ground with 2.5 mL of 80% methanol. The finely ground samples were centrifuged at 14,000× g for 10 min at 4 °C. Next, 0.2 mL of the supernatant was transferred to an Eppendorf tube containing 0.2 mL of Folin–Ciocalteu reagent and mixed using a vortex mixer. Then, 2 mL of 2% sodium carbonate was added prior to incubation for 20 min at 30 °C under total darkness. Subsequently, 200 µL of each sample was transferred to a 96-well plate, and the absorbance was measured at 760 nm using a Bio-Tek microplate reader (Winooski, VT, USA). Gallic acid was used as the calibration standard, and the total phenolic content was expressed as milligrams of Gallic acid equivalent on a fresh weight basis (mg GAE g−1 FW).

2.8. Effect of P. fluorescens SP007s Formulation on Plant Growth

Plant growth parameters, including canopy width, plant height, root length, number of leaves per plant, fresh weight, and dry weight, were recorded 45 days after planting for all treatments.

2.9. Statistical Analysis

The experiments were performed under laboratory and greenhouse conditions based on the application of a completely randomized design (CRD) with four replications, and repeated three times. The obtained experimental data were analyzed using one-way ANOVA with SPSS 20 (SPSS Inc., Chicago, IL, USA). Significant differences in means among groups were analyzed using Duncan’s multiple range test at p ≤ 0.05.

3. Results

3.1. Antagonistic Activity of P. fluorescens SP007s to Inhibit P. carotovorum

The antagonist testing experiment showed that SP007s produced a strong inhibitory effect on P. carotovorum growth during the co-culture assays on NA (Figure 1). The diameters of the inhibition areas of the different treatments were measured. The SP007s treatment produced a measured inhibition area of 3.45 ± 0.10 mm in diameter, followed by the amoxicillin treatment with 3.26 ± 0.05 mm and the copper hydroxide treatment with 1.20 ± 00.00 mm (Table 2).

3.2. P. fluorescens SP007s Formulations and Evaluation of the Survival Bacterial Populations

The experiment was based on the development of six microbial formulations in the form of bio-fertilizers for comparing the material efficiency under humidity at 20%, 30%, 40%, and 50%. The six resulting microbial formulations were characterized by a fine texture and crumbly appearance (Figure S1). The population of the SP007s in each formulation was examined after being kept at room temperature after mixing and then stored for 6 months with varying moisture levels (Table 3 and Table 4). The results showed that the moisture content and formula factors influenced the SP007s population. The treatment that included paper sludge, sugar sludge, and 1% glycerol (w/v) at a moisture content of 30% showed the largest SP007s population with 5.92 × 106 CFU/g followed by 40%, 50%, and 20% moisture content, with 5.60 × 106, 5.36 × 106, and 4.98 × 106 CFU/g, respectively.

3.3. Effect of P. fluorescens SP007s Formulation on Inhibiting P. carotovorum in Infested Soil

The application of the SP007s formulation at 10 g per 500 g of infected soil showed the highest reduction in P. carotovorum population, followed by the SP007s cell suspension and the copper hydroxide; whereas the water-mock did not inhibit the pathogen (Figure 2).

3.4. Effect of P. fluorescens SP007s Formulation on Controlling soft Rot Disease

The use of the SP007s formulation twice at 10 g per pot decreased the incidence of soft rot disease at 45 days after sowing. Soft rot disease reductions observed in the kale plants that were treated with the SP007s formulation, SP007s cell suspension, copper hydroxide, and the untreated control were 65.2%, 60.0%, 91.3%, and 0.0%, respectively. Nevertheless, the protective efficacy of the SP007s formulation and the SP007s cell suspension indicated a non-significant disease incidence of the soft rot disease when comparing among these treatments (Table 5, Figure 3).

3.5. Effect of P. fluorescens SP007s Formulation on the Simulation of Plant Defense

The effect of the SP007s formulation on endogenous SA content in kale was evaluated. The results showed that the chemical-fertilizer-treated sample revealed the highest content of endogenous SA at 45 days after sowing. This is considered a non-significant difference when compared with the SP007s formulation, the SP007s cell suspension, and the organic fertilizer treatment. Overall, the endogenous SA content of the water-mock sample showed a significantly lower value when compared with all evaluated treatments (Table 6).
The total phenolic compound contents of the kale plants for each treatment are shown in Table 7. In general, the use of the chemical fertilizer showed the highest total phenolic compound content of 121 mg GAE g−1 FW, followed by the SP007s formulation (120 mg GAE g−1 FW), organic fertilizer (119 mg GAE g−1 FW), SP007s cell suspension (117 mg GAE g−1 FW), and untreated (113 mg GAE g−1 FW). The samples treated with organic fertilizer and with the SP007s cell suspension were significantly lower than the chemical fertilizer treated samples. The samples treated with the SP007s formulation were non-significantly different when compared with the chemical fertilizer.

3.6. Effect of P. fluorescens SP007s Formulation on the Growth Parameter

The plant growth parameters, including plant width, plant height, root length, fresh weight, and dry weight, were significantly increased by the chemical fertilizer treatment followed by the organic fertilizer treatment, the SP007s cell suspension treatment, and the SP007s formulation treatment, as shown in Table 8 and Figure 4. The data showed that the kale plant samples treated with the SP007s formulation had significantly higher values in plant height and dry weight: 7.6 cm and 0.73 g, respectively, compared with the untreated samples, 5.40 cm and 0.55 g, respectively.

4. Discussion

Pseudomonas sp. has emerged as a potential biocontrol agent in various studies. In our experiments, we investigated the effectiveness of the integrated control agent Pseudomonas fluorescens SP007s in different formulations that were combined with sugar sludge, paper sludge, and glycerol. The survival of inoculated Pseudomonas sp. in the soil and plant rhizosphere is dependent on many factors, such as the inoculate formulation, soil conditions, and the physiological status of the plant. In our study, the results showed that the formulation based on sugar sludge at 49.5%, paper sludge at 49.5%, and glycerol at 1% (w/v) had larger SP007s populations than the other proposed formulations after being kept at room temperature for 6 months. Paper sludge is a potential source of organic matter and rich in nutrients, as well as a carbon source with cellulose [21,22]. Mohammadi et al. [23] reported that the application of paper mill sludge to pots increased the dry matter yield and the potassium, phosphorus, and micronutrient uptake for sorghum, with a rate of 2% being more effective. In addition, micro-organisms can survive in paper sludge and produce a specific enzyme that is partially dependent on the type and structure of the sludge composition [24]. P. fluorescens is a species of bacteria known to produce ligninolytic enzymes that play a crucial role in the breakdown and recycling of lignin in nature, such as paper mill sludge [25]. The key ligninolytic enzymes include laccases, peroxidases, dyP-type peroxidases, and auxiliary enzymes [26]. These provide bacteria with access to lignocellulosic biomass as a carbon and energy source, contributing to their survival [27]. Sugar sludge is the carbon source for microbial cell culture that a micro-organism uses to build biomass. Micro-organisms utilize the sugars present in the sugar sludge for growth and fermentation by converting the sugars into various products of interest, such as organic acids, alcohols, enzymes, and biofuels [28,29]. This suggestion is consistent with Liu et al. [30], who state that the addition of molasses combined with microbial inoculants can improve the structure of the bacteria community. This can provide a favorable carbon source for the microbial inoculants, helping them to establish and thrive in silage or other systems. Glycerol can serve as a carbon and energy source for bacteria, preventing damage to the cell membranes and contributing to keep the cells alive.
The SP007s formulation exhibited potent antagonistic activity against P. carotovorum (>60%), as our results determined, based on the soil application technique twice every 15 days. The SP007s formulation can effectively suppress P. carotovorum populations in infected soil, which reduces the pathogen population by producing pyoluteorin, 2,4-diacetylphloroglucinol (DAPG), and phenazine as antimicrobial properties that are important in disease suppression [31]. These findings are consistent with Suresh et al. [32], who reported that P. fluorescens VSMKU3054 produced 2,4-DAPG to control Ral-stonia solanacearum, the cause of tomato bacterial wilt, and promoted the growth of tomato seedlings. DAPG belongs to a large group of phenolic antimicrobial substances which possess a well-documented role in triggering systemic acquired resistance (SAR) and induced systemic resistance (ISR) in plants such as arabidopsis, maize, tomato, and pea [33,34,35].
P. fluorescens strains have the potential to produce antimicrobial compounds such as lipase and protease [36,37]. These compounds are known to be associated with the degradation of the fungal cell wall or cell membrane to protect the plants against soil borne and foliar pathogens [38]. Similarly, Chauhan et al. [39] reported that P. fluorescens can produce lipopeptides such as viscosinamide, pseudofactin II tensin, and others as antibacterial agents. Furthermore, lipopeptides are a general intermediate for stimulating the plant immune system [40,41]. Thus, the SP007s formulation in plant immune interactions was further investigated. Our results showed that the observed plant defense parameters were increased, including the endogenous SA and the phenolic compound contents (p < 0.05) when compared with the control.
The SA pathway is the dominant signaling cascade under pathogen attacks due to the presence of communication channels that can promote the generation of energy and the synthesis of potential intermediates and enzymes to inhibit pathogens [42]. According to the scientific literature on the defense mechanisms of various plant species, such as rice, soybeans, and tobacco, it has been observed that immune plants enhance the accumulation of salicylic acid in response to pathogen infection [41,43,44]. Likewise, in their report, Lakkis et al. [45] state that Pseudomonas sp. can be an inducer of ISR in grapevine, which activates both the immune response and the priming phenomenon under Botrytis cinerea invasion. This event is related to the constitutively enhanced expression of SA-related genes and to the increase in the total phenolic content [45]. Phenolic compounds have been noted as the most influential secondary products in the determination of plant-disease resistance [46]. These compounds are involved in the activities of polyphenol oxidase (PPO), POX, catalase (CAT), and IAA oxidase (IAAO) that play important roles in various physiological processes and provide protection against multiple biotic stressors [47]. In addition, we found that the use of the SP007s formulation can promote the growth of kale plants. In our previous experiments, P. fluorescens SP007S was studied on PGP traits using high-performance liquid chromatography (HPLC). The results revealed that SP007s secreted high levels of IAA and GA3 in nutrient glucose broth: 47.5 and 54.7 g mL−1, respectively [14]. These results are consistent with numerous reports indicating that P. fluorescens has been recognized as a beneficial agent for promoting plant growth [48,49,50]. They produce different substrates such as phytohormones and solubilizing minerals in soil that positively influence plant growth [51]. Furthermore, P. fluorescens are known for their ability to mediate nutritional and for their growth promotion effects in plants by enhancing nutrient availability, including phosphate solubilization and nitrogen fixation [52,53]. Therefore, the SP007s formulation can be used as an environmentally friendly alternative to combat P. carotovorum and emerge as a promising strategy to assist crops to reduce pathogen populations.

5. Conclusions

The formulation of Pseudomonas fluorescens SP007s reduced plant disease by up to 65% and enhanced the plant growth of kale. The concentration of the endogenous salicylic acid and phenolic compounds of the harvested kale remained affected by the use of SP007s, regardless of the soil application technique. More specifically, the results showed that the SP007s had positive effects, with statistically significant differences, on the plant height and dry weight when compared with the untreated samples. The canopy width, plant height, plant length, fresh weight, and dry weight parameters were significantly increased by the chemical and the organic fertilizer treatments on soil application. On the other hand, the number of leaves per plant of kale plants was not significantly increased in all the treated samples when compared with the untreated samples. The results from our experiments show that the evaluated SP007s formulation can be used as a bio-stimulant in order to enhance kale production.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13071856/s1. Figure S1: Pseudomonas fluorescens SP007s formulations (A) sugar sludge 100%, (B) sugar sludge 99% + glycerol 1% (w/v), (C) paper sludge 100%, (D) paper sludge 99%+ glycerol 1% (w/v), (E) sugar sludge 50% + paper sludge 50%, and (F) sugar sludge 49.5%+ paper sludge 49.5%+ glycerol 1% (w/v).

Author Contributions

A.N., W.C. and D.A., conceptualization and design. A.N., implementation, investigation, and analyzed the data. A.N., W.T. and D.A., arranged the results, discussion, and wrote the original draft. W.T. and D.A., revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Thammasat University Center of Excellence in Agriculture Innovation Center through Supply Chain and Value Chain, and the Thailand Science Research and Innovation Fundamental Fund (FF 2565).

Data Availability Statement

Data is contained within the article or Supplementary Material.

Acknowledgments

The authors would like to thank the Thammasat University Center of Excellence in Agriculture Innovation Center through Supply Chain and Value Chain, and the Thailand Science Research and Innovation Fundamental Fund.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Satheesh, N.; Workneh Fanta, S. Kale: Review on nutritional composition, bio-active compounds, anti-nutritional factors, health beneficial properties and value-added products. Cogent Food Agric. 2020, 6, 1811048. [Google Scholar] [CrossRef]
  2. Emebu, P.K.; Anyika, J.U. Proximate and Mineral Composition of Kale (Brassica oleracea) Grown in Delta State, Nigeria. Pak. J. Nutr. 2011, 10, 190–194. [Google Scholar] [CrossRef] [Green Version]
  3. Silva, K.; Correa, E.; Abidon, E.; Pereira, W.; Silva, J.C.P.; Medeiros, F. Urban production of kale (Brassica oleracea var. acephala) in Brazil: Survey of diseases and factors that contribute to their outbreak. Summa Phytopathol. 2022, 48, 17–24. [Google Scholar] [CrossRef]
  4. Koskey, G.; Mburu, S.W.; Awino, R.; Njeru, E.M.; Maingi, J.M. Potential Use of Beneficial Microorganisms for Soil Amelioration, Phytopathogen Biocontrol, and Sustainable Crop Production in Smallholder Agroecosystems. Front. Sustain. Food Syst. 2021, 5, 130. [Google Scholar] [CrossRef]
  5. Abd-El-Khair, H.; Abdel-Gaied, T.G.; Mikhail, M.S.; Abdel-Alim, A.I.; El-Nasr, H.I.S. Biological control of Pectobacterium carotovorum subsp. carotovorum, the causal agent of bacterial soft rot in vegetables, in vitro and in vivo tests. . Bull. Natl. Res. Cent. 2021, 45, 37. [Google Scholar] [CrossRef]
  6. Davidsson, P.; Kariola, T.; Niemi, O.; Palva, T. Pathogenicity of and plant immunity to soft rot pectobacteria. Front. Plant Sci. 2013, 4, 191. [Google Scholar] [CrossRef] [Green Version]
  7. Azaiez, S.; Ben Slimene, I.; Karkouch, I.; Essid, R.; Jallouli, S.; Djebali, N.; Elkahoui, S.; Limam, F.; Tabbene, O. Biological control of the soft rot bacterium Pectobacterium carotovorum by Bacillus amyloliquefaciens strain Ar10 producing glycolipid-like compounds. Microbiol. Res. 2018, 217, 23–33. [Google Scholar] [CrossRef]
  8. Cui, W.; He, P.; Munir, S.; He, P.; He, Y.; Li, X.; Yang, L.; Wang, B.; Wu, Y.; He, P. Biocontrol of Soft Rot of Chinese Cabbage Using an Endophytic Bacterial Strain. Front. Microbiol. 2019, 10, 1471. [Google Scholar] [CrossRef] [Green Version]
  9. Abdelraouf, A.M.N.; Hussain, A.A.; Naguib, D.M. Nano-chitosan encapsulated Pseudomonas fluorescens greatly reduces Fusarium wilt infection in tomato. Rhizosphere 2023, 25, 100676. [Google Scholar] [CrossRef]
  10. Zhong, T.; Wang, Z.; Zhang, M.; Wei, X.; Kan, J.; Zalán, Z.; Wang, K.; Du, M. Volatile organic compounds produced by Pseudomonas fluorescens ZX as potential biological fumigants against gray mold on postharvest grapes. Biol. Control 2021, 163, 104754. [Google Scholar] [CrossRef]
  11. Rani, A.; Rana, A.; Dhaka, R.K.; Singh, A.P.; Chahar, M.; Singh, S.; Nain, L.; Singh, K.P.; Minz, D. Bacterial volatile organic compounds as biopesticides, growth promoters and plant-defense elicitors: Current understanding and future scope. Biotechnol. Adv. 2023, 63, 108078. [Google Scholar] [CrossRef] [PubMed]
  12. Alzandi, A.A.; Naguib, D.M. Pseudomonas fluorescens metabolites as biopriming agent for systemic resistance induction in tomato against Fusarium wilt. Rhizosphere 2019, 11, 100168. [Google Scholar] [CrossRef]
  13. Sutruedee, P.; Athinuwat, D.; Wilawan, C.; Tiyakhon, C.; Natthiya, B. Bioformulation Pseudomonas fluorescens SP007s against dirty panicle disease of rice. Afr. J. Microbiol. Res. 2013, 7, 5274–5283. [Google Scholar] [CrossRef] [Green Version]
  14. Chuaboon, W.; Athinuwat, D. Plant hormone produced from Pseudomonas fluorescens SP007s to promote organic kale growth. Thai J. Sci. Technol. 2014, 3, 196–205. [Google Scholar] [CrossRef]
  15. Gonçalves, L.D.d.A.; Piccoli, R.H.; Peres, A.d.P.; Saúde, A.V. Predictive modeling of Pseudomonas fluorescens growth under different temperature and pH values. Braz. J. Microbiol. 2017, 48, 352–358. [Google Scholar] [CrossRef]
  16. Prathuangwong, S.C.W.; Kasem, S.; Athinuwat, D.; Suyama, K.; Negishi, H. Potential for application time of Pseudomonas fluorescens SP007s and biofertilizer for Alternaria leaf spotmanagement of Chinese kale. In Proceedings of the the ISSAAS International Conference, Bangkok, Thailand, 23–27 February 2009; p. 81. [Google Scholar]
  17. Wilson, K. Preparation of Genomic DNA from Bacteria. Curr. Protoc. Mol. Biol. 2001, 56, 241–245. [Google Scholar] [CrossRef]
  18. Alsohim, A.S. Influence of Pseudomonas fluorescens mutants produced by transposon mutagenesis on in vitro and in vivo biocontrol and plant growth promotion. Egypt. J. Biol. Pest Control. 2020, 30, 19. [Google Scholar] [CrossRef]
  19. Sumathy, J. A Comparative study on the toluene degrading bacteria isolated from polluted environments. World J. Pharm. Res. 2017, 1025–1045. [Google Scholar] [CrossRef] [Green Version]
  20. Lamuela-Raventós, R.M. Folin–Ciocalteu method for the measurement of total phenolic content and antioxidant capacity. In Measurement of Antioxidant Activity & Capacity; Apak, R., Capanoglu, E., Shahidi, F., Eds.; John Wiley & Sons Ltd.: New York, NY, USA, 2018; pp. 107–115. [Google Scholar]
  21. Heinz, K.G.H.; Zanoni, P.R.S.; Oliveira, R.R.; Medina-Silva, R.; Simão, T.L.L.; Trindade, F.J.; Pereira, L.M.; Tavares, L.B.B.; Giongo, A. Recycled Paper Sludge Microbial Community as a Potential Source of Cellulase and Xylanase Enzymes. Waste Biomass Valorization 2017, 8, 1907–1917. [Google Scholar] [CrossRef]
  22. Turner, T.; Wheeler, R.; Oliver, I.W. Evaluating land application of pulp and paper mill sludge: A review. J. Environ. Manag. 2022, 317, 115439. [Google Scholar] [CrossRef] [PubMed]
  23. Mohammadi Torkashvand, A.; Haghighat, N.; Shadparvar, V. Effect of paper mill lime sludge as an acid soil amendment. Sci. Res. Essays 2010, 5, 1302–1306. [Google Scholar]
  24. Ghribi, M.; Meddeb-Mouelhi, F.; Beauregard, M. Microbial diversity in various types of paper mill sludge: Identification of enzyme activities with potential industrial applications. Springerplus 2016, 5, 1492. [Google Scholar] [CrossRef] [Green Version]
  25. Grgas, D.; Rukavina, M.; Bešlo, D.; Štefanac, T.; Crnek, V.; Šikić, T.; Habuda-Stanić, M.; Landeka Dragičević, T. The Bacterial Degradation of Lignin & mdash; A Review. Water 2023, 15, 1272. [Google Scholar]
  26. Kumar, A.; Chandra, R. Ligninolytic enzymes and its mechanisms for degradation of lignocellulosic waste in environment. Heliyon 2020, 6, e03170. [Google Scholar] [CrossRef]
  27. Chukwuma, O.B.; Rafatullah, M.; Tajarudin, H.A.; Ismail, N. A Review on Bacterial Contribution to Lignocellulose Breakdown into Useful Bio-Products. Int. J. Environ. Res. Public Health 2021, 18, 6001. [Google Scholar] [CrossRef] [PubMed]
  28. Gayathiri, G.; Kiruthiga, P.; Karthikeyan, R.; Vijaya Anand, A.; Sivamurugan, V.; Saradhadevi, K.M. Chapter 3—Enzymatic production of organic acids via microbial fermentative processes. In Biomass, Biofuels, Biochemicals; Li, H., Saravanamurugan, S., Pandey, A., Elumalai, S., Eds.; Elsevier: Amsterdam, The Netherlands, 2022; pp. 37–54. [Google Scholar]
  29. Sharma, R.; Garg, P.; Kumar, P.; Bhatia, S.K.; Kulshrestha, S. Microbial Fermentation and Its Role in Quality Improvement of Fermented Foods. Fermentation 2020, 6, 106. [Google Scholar] [CrossRef]
  30. Liu, B.; Yang, Z.; Huan, H.; Gu, H.; Xu, N.; Ding, C. Impact of molasses and microbial inoculants on fermentation quality, aerobic stability, and bacterial and fungal microbiomes of barley silage. Sci. Rep. 2020, 10, 5342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Kladsuwan, L.; Chuaboon, W.; Prathuangwong, S. Identification of Pseudomonas fluorescens SP007s genes involved in antibiotic synthesis against Xanthomonas axonopodis pv. Glycines. In Proceedings of the 51st Kasetsart University Annual Conference: Plants, Bangkok, Thailand, 5–7 February 2013; pp. 127–136. [Google Scholar]
  32. Suresh, P.; Rekha, M.; Gomathinayagam, S.; Ramamoorthy, V.; Sharma, M.P.; Sakthivel, P.; Sekar, K.; Valan Arasu, M.; Shanmugaiah, V. Characterization and Assessment of 2,4-Diacetylphloroglucinol (DAPG)-Producing Pseudomonas fluorescens VSMKU3054 for the Management of Tomato Bacterial Wilt Caused by Ralstonia solanacearum. Microorganisms 2022, 10, 1508. [Google Scholar] [CrossRef]
  33. Weller, D.M.; Landa, B.B.; Mavrodi, O.V.; Schroeder, K.L.; De La Fuente, L.; Blouin Bankhead, S.; Allende Molar, R.; Bonsall, R.F.; Mavrodi, D.V.; Thomashow, L.S. Role of 2,4-diacetylphloroglucinol-producing fluorescent Pseudomonas spp. in the defense of plant roots. Plant Biol. 2007, 9, 4–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Chae, D.H.; Kim, D.R.; Cheong, M.S.; Lee, Y.B.; Kwak, Y.S. Investigating the induced systemic resistance mechanism of 2,4-Diacetylphloroglucinol (DAPG) using DAPG Hydrolase-Transgenic Arabidopsis. Plant Pathol. J. 2020, 36, 255–266. [Google Scholar] [CrossRef]
  35. Fang, R.; Lin, J.; Yao, S.; Wang, Y.; Wang, J.; Zhou, C.; Wang, H.; Xiao, M. Promotion of plant growth, biological control and induced systemic resistance in maize by Pseudomonas aurantiaca JD37. Ann. Microbiol. 2013, 63, 1177–1185. [Google Scholar] [CrossRef]
  36. Wang, Z.; Zhong, T.; Chen, K.; Du, M.; Chen, G.; Chen, X.; Wang, K.; Zalán, Z.; Takács, K.; Kan, J. Antifungal activity of volatile organic compounds produced by Pseudomonas fluorescens ZX and potential biocontrol of blue mold decay on postharvest citrus. Food Control. 2021, 120, 107499. [Google Scholar] [CrossRef]
  37. Sahebani, N.; Gholamrezaee, N. The biocontrol potential of Pseudomonas fluorescens CHA0 against root knot nematode (Meloidogyne javanica) is dependent on the plant species. Biol. Control. 2021, 152, 104445. [Google Scholar] [CrossRef]
  38. Mohamad, O.A.A.; Li, L.; Ma, J.-B.; Hatab, S.; Xu, L.; Guo, J.-W.; Rasulov, B.A.; Liu, Y.-H.; Hedlund, B.P.; Li, W.-J. Evaluation of the Antimicrobial Activity of Endophytic Bacterial populations from chinese traditional medicinal plant licorice and characterization of the bioactive secondary metabolites produced by Bacillus atrophaeus Against Verticillium dahliae. Front. Microbiol. 2018, 9, 924. [Google Scholar] [CrossRef] [Green Version]
  39. Chauhan, V.; Mazumdar, S.; Pandey, A.; Kanwar, S.S. Pseudomonas lipopeptide: An excellent biomedical agent. MedComm Biomater. Appl. 2023, 2, e27. [Google Scholar] [CrossRef]
  40. Lee, H.-J.; Park, O.K. Lipases associated with plant defense against pathogens. Plant Sci. 2019, 279, 51–58. [Google Scholar] [CrossRef]
  41. Thepbandit, W.; Srisuwan, A.; Siriwong, S.; Nawong, S.; Athinuwat, D. Bacillus vallismortis TU-Orga21 blocks rice blast through both direct effect and stimulation of plant defense. Front. Plant Sci. 2023, 14, 1103487. [Google Scholar] [CrossRef]
  42. Thepbandit, W.; Papathoti, N.K.; Daddam, J.R.; Hoang, N.H.; Le Thanh, T.; Saengchan, C.; Buensanteai, K. In Vitro and in silico studies of salicylic acid on systemic induced resistance against bacterial leaf blight disease and enhancement of crop yield. J. Integr. Agric. 2023, 22, 170–184. [Google Scholar] [CrossRef]
  43. Radojičić, A.; Li, X.; Zhang, Y. Salicylic Acid: A double-edged sword for programed cell death in plants. Front. Plant Sci. 2018, 9, 1133. [Google Scholar] [CrossRef] [Green Version]
  44. Kim, T.-J.; Lim, G.-H. Salicylic acid and mobile regulators of systemic immunity in plants: Transport and metabolism. Plants 2023, 12, 1013. [Google Scholar] [CrossRef] [PubMed]
  45. Lakkis, S.; Trotel-Aziz, P.; Rabenoelina, F.; Schwarzenberg, A.; Nguema-Ona, E.; Clément, C.; Aziz, A. Strengthening Grapevine Resistance by Pseudomonas fluorescens PTA-CT2 Relies on distinct defense pathways in susceptible and partially resistant genotypes to downy mildew and gray mold diseases. Front. Plant Sci. 2019, 10, 1112. [Google Scholar] [CrossRef] [PubMed]
  46. Friend, J. Phenolic Substances and Plant Disease. In Biochemistry of Plant Phenolics; Swain, T., Harbone, J.B., Van Sumere, C.F., Eds.; Springer: Boston, MA, USA, 1979; pp. 557–588. [Google Scholar]
  47. Jiang, S.; Han, S.; He, D.; Cao, G.; Fang, K.; Xiao, X.; Yi, J.; Wan, X. The accumulation of phenolic compounds and increased activities of related enzymes contribute to early defense against walnut blight. Physiol. Mol. Plant Pathol. 2019, 108, 101433. [Google Scholar] [CrossRef]
  48. Chandra, H.; Kumari, P.; Bisht, R.; Prasad, R.; Yadav, S. Plant growth promoting Pseudomonas aeruginosa from Valeriana wallichii displays antagonistic potential against three phytopathogenic fungi. Mol. Biol. Rep. 2020, 47, 6015–6026. [Google Scholar] [CrossRef] [PubMed]
  49. Chopra, A.; Bobate, S.; Rahi, P.; Banpurkar, A.; Mazumder, P.B.; Satpute, S. Pseudomonas aeruginosa RTE4: A Tea Rhizobacterium With Potential for Plant Growth Promotion and Biosurfactant Production. Front. Bioeng. Biotechnol. 2020, 8, 861. [Google Scholar] [CrossRef]
  50. Hassen, W.; Neifar, M.; Cherif, H.; Najjari, A.; Chouchane, H.; Driouich, R.C.; Salah, A.; Naili, F.; Mosbah, A.; Souissi, Y.; et al. Pseudomonas rhizophila S211, a New Plant Growth-Promoting Rhizobacterium with Potential in Pesticide-Bioremediation. Front. Microbiol. 2018, 9, 34. [Google Scholar] [CrossRef] [Green Version]
  51. Preston, G.M. Plant perceptions of plant growth-promoting Pseudomonas. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2004, 359, 907–918. [Google Scholar] [CrossRef] [Green Version]
  52. Blanco-Vargas, A.; Rodríguez-Gacha, L.M.; Sánchez-Castro, N.; Garzón-Jaramillo, R.; Pedroza-Camacho, L.D.; Poutou-Piñales, R.A.; Rivera-Hoyos, C.M.; Díaz-Ariza, L.A.; Pedroza-Rodríguez, A.M. Phosphate-solubilizing Pseudomonas sp., and Serratia sp., co-culture for Allium cepa L. growth promotion. Heliyon 2020, 6, e05218. [Google Scholar] [CrossRef]
  53. Chin, J.M.; Lim, Y.Y.; Ting, A.S.Y. Biopriming Pseudomonas fluorescens to vegetable seeds with biopolymers to promote coating efficacy, seed germination and disease suppression. J. Saudi Soc. Agric. Sci. 2022, 21, 493–505. [Google Scholar] [CrossRef]
Agronomy 13 01856 g001 550
Figure 1. In vitro antagonist testing between Pseudomonas fluorescens SP007s and Pectobacterium carotovorum. The hollow zones display the inhibition of pathogen growth by (A) SP007s, (B) amoxicillin, (C) copper hydroxide, and (D) sterilized water.
Figure 1. In vitro antagonist testing between Pseudomonas fluorescens SP007s and Pectobacterium carotovorum. The hollow zones display the inhibition of pathogen growth by (A) SP007s, (B) amoxicillin, (C) copper hydroxide, and (D) sterilized water.
Agronomy 13 01856 g001
Agronomy 13 01856 g002 550
Figure 2. Pectobacterium carotovorum population density in soil after being treated with the T1 Pseudomonas fluorescens SP007s formulation, T2 SP007s cell suspension, T3 copper hydroxide, and T4 water-mock. Means in the column followed by different letters (a, b, c, and d) are significantly different according to DMRT at p = 0.05.
Figure 2. Pectobacterium carotovorum population density in soil after being treated with the T1 Pseudomonas fluorescens SP007s formulation, T2 SP007s cell suspension, T3 copper hydroxide, and T4 water-mock. Means in the column followed by different letters (a, b, c, and d) are significantly different according to DMRT at p = 0.05.
Agronomy 13 01856 g002
Agronomy 13 01856 g003 550
Figure 3. Effectiveness of controlling kale soft rot disease through treatment with: (A) Pseudomonas fluorescens SP007s formulation; (B) SP007s cell suspension; (C) copper hydroxide; and (D) water-mock. The infection of the soft rot symptom was indicated by the arrows.
Figure 3. Effectiveness of controlling kale soft rot disease through treatment with: (A) Pseudomonas fluorescens SP007s formulation; (B) SP007s cell suspension; (C) copper hydroxide; and (D) water-mock. The infection of the soft rot symptom was indicated by the arrows.
Agronomy 13 01856 g003
Agronomy 13 01856 g004 550
Figure 4. The growth of kale plants at 45 days post-sowing treated with: (A) Pseudomonas fluorescens SP007s formulation; (B) SP007s cell suspension; (C) organic fertilizer; (D) chemical fertilizer; and (E) water-mock.
Figure 4. The growth of kale plants at 45 days post-sowing treated with: (A) Pseudomonas fluorescens SP007s formulation; (B) SP007s cell suspension; (C) organic fertilizer; (D) chemical fertilizer; and (E) water-mock.
Agronomy 13 01856 g004
Table
Table 1. The formula and material ratio for supporting Pseudomonas fluorescens SP007s.
Table 1. The formula and material ratio for supporting Pseudomonas fluorescens SP007s.
Formulations Material Ratio
1Sugar sludge 100%
2Sugar sludge 99% + glycerol 1% (w/v)
3Paper sludge 100%
4Paper sludge 99% + glycerol 1% (w/v)
5Sugar sludge 50% + paper sludge 50%
6Sugar sludge 49.5%+ paper sludge 49.5% + glycerol 1% (w/v)
Table
Table 2. Antagonistic activity of Pseudomonas fluorescens SP007s inhibits Pectobacterium carotovorum causes of soft rot disease, as assessed using the agar diffusion method.
Table 2. Antagonistic activity of Pseudomonas fluorescens SP007s inhibits Pectobacterium carotovorum causes of soft rot disease, as assessed using the agar diffusion method.
TreatmentsInhibit Zone (cm) 1/
SP007s3.45 ± 0.10 a
Copper hydroxide 1.20 ± 0.00 c
Amoxicillin 3.26 ± 0.05 b
Sterilize water 0.00 d
F-test*
1/ Each value represents the mean of four replicates. Means in the column followed by different letters (a, b, c, and d) are significantly different according to DMRT at p = 0.05. * = significantly different according to DMRT at p = 0.05.
Table
Table 3. The initial cell density of Pseudomonas fluorescens SP007s in formulations after mixing (0 h) on each moisture content at room temperature.
Table 3. The initial cell density of Pseudomonas fluorescens SP007s in formulations after mixing (0 h) on each moisture content at room temperature.
TreatmentsSP007s Population Density (CFU/g) 1/
Moisture Content (%)
20304050Average
Sugar sludge 100%2.88 ± 0.29 × 10102.40 ± 0.25 × 10102.80 ± 0.11 × 10102.56 ± 0.28 × 10102.42 × 1010
Sugar sludge 99% + glycerol 1% (w/v)2.56 ± 0.10 × 10102.56 ± 0.32 × 10102.69 ± 0.14 × 10102.40 ± 0.18 × 10102.70 × 1010
Paper sludge 100%3.17 ± 0.21 × 10102.56 ± 0.29 × 10102.69 ± 0.40 × 10102.84 ± 0.11 × 10102.32 × 1010
Paper sludge 99%+ glycerol 1% (w/v)2.18 ± 0.36 × 10103.25 ± 0.21 × 10102.88 ± 0.15 × 10102.58 ± 0.05 × 10102.85 × 1010
Sugar sludge 50% + paper sludge 50%2.69 ± 0.12 × 10102.29 ± 0.12 × 10103.46 ± 0.27 × 10102.50 ± 0.19 × 10102.66 × 1010
Sugar sludge 49.5%+ paper sludge 49.5% + glycerol 1% (w/v)2.40 ± 0.24 × 10102.80 ± 0.22 × 10103.49 ± 0.30 × 10102.28 ± 0.35 × 10102.99 × 1010
Average2.72 ± 0.16 × 10102.75 ± 0.12 × 10102.44 ± 0.34 × 10102.71 ± 0.17 × 1010
F-test ns
Moisturens
Treatment × Moisturens
1/ Each value represents the mean of four replicates. ns = non-significant.
Table
Table 4. Survival of Pseudomonas fluorescens SP007s in formulations during 6 months of storage on each moisture content at room temperature.
Table 4. Survival of Pseudomonas fluorescens SP007s in formulations during 6 months of storage on each moisture content at room temperature.
TreatmentsSP007s Population Density (CFU/g) 1/
Moisture Content (%)
20304050Average
Sugar sludge 100%1.28 ± 0.10 × 105 d1.73 ± 0.22 × 105 d1.65 ± 0.33 × 105 d1.60 ± 0.31 × 105 d1.56 × 105 d
Sugar sludge 99% + glycerol 1% (w/v)1.81 ± 0.15 × 105 d2.00 ± 0.15 × 105 d1.81 ± 0.14 × 105 d1.60 ± 0.12 × 105 d1.80 × 105 d
Paper sludge 100%1.78 ± 0.21 × 105 d1.94 ± 0.21 × 105 d1.83 ± 0.31 × 105 d1.92 ± 0.25 × 105 d1.88 × 105 d
Paper sludge 99%+ glycerol 1% (w/v)4.36 ± 0.18 × 106 cd4.96 ± 0.18 × 106 bc4.80 ± 0.23 × 106 bc4.56 ± 0.28 × 106 bc4.94 × 106 b
Sugar sludge 50% + paper sludge 50%2.32 ± 0.20 × 105 d2.53 ± 0.11 × 105 d2.45 ± 0.29 × 105 d2.24 ± 0.24 × 105 d2.38 × 105 c
Sugar sludge 49.5%+ paper sludge 49.5% + glycerol 1% (w/v)4.98 ± 0.22 × 106 bc5.92 ± 0.31 × 106 a5.60 ± 0.19 × 106 ab5.36 ± 0.18 × 106 ab5.46 × 106 a
Average3.07 ± 0.18 × 106 b3.26 ± 0.24 × 106 a3.12 ± 0.31 × 106 b2.95 ± 0.23 × 106 c
F-test*
Moisture*
Treatment × Moisture*
1/ Each value represents the mean of four replicates. Means in the column followed by different letters (a, b, c, and d) are significantly different according to DMRT at p = 0.05. * = significantly different according to DMRT at p = 0.05.
Table
Table 5. The effect of Pseudomonas fluorescens SP007s formulation on controlling soft rot disease incidence in greenhouse condition.
Table 5. The effect of Pseudomonas fluorescens SP007s formulation on controlling soft rot disease incidence in greenhouse condition.
TreatmentsDisease Incidence 2/
(%)		Disease Reduction 3/
(%)
SP007s Formulation26.6 ± 0.64 b 1/65.2
SP007s Cell suspension 30.0 ± 0.86 b60.0
Copper hydroxide 6.6 ± 0.32 c91.3
Mock-water76.6 ± 0.39 a0.0
F-test **
CV (%)18.22
1/ Each value represents the mean of four replicates. Means in the column followed by different letters (a, b, and c) are significantly different according to DMRT at p = 0.01. 2/ Disease incidence = (number of infected plants/total number of plants) × 100. 3/ Disease reduction = (Negative control − Treatment/Negative control) × 100. ** = significantly different according to DMRT at p = 0.01.
Table
Table 6. Endogenous salicylic acid content in kale at 45 days post-sawing.
Table 6. Endogenous salicylic acid content in kale at 45 days post-sawing.
TreatmentsEndogenous Salicylic Acid Content
(mg/g Fresh Weigh) 1/
SP007s Formulation0.90 ± 0.04 ab
SP007s Cell suspension0.89 ± 0.05 b
Organic fertilizer0.87 ± 0.02 b
Chemical fertilizer0.92 ± 0.09 a
Untreated0.57 ± 0.06 c
F-test*
CV (%)12.56
1/ Each value represents the mean of four replicates. Means in the column followed by different letters (a, b, and c) are significantly different according to DMRT at p = 0.05. * = significantly different according to DMRT at p = 0.05.
Table
Table 7. Total phenolic compound content in kale at 45 days post-sawing.
Table 7. Total phenolic compound content in kale at 45 days post-sawing.
TreatmentsTotal Phenolic Compound Content
(mg GAE g−1 FW) 1/
SP007s Formulation120 ± 0.98 ab
SP007s Cell suspension117 ± 0.71 b
Organic fertilizer119 ± 0.03 b
Chemical fertilizer121 ± 0.54 a
Untreated113 ± 0.61 c
F-test*
1/ Each value represents the mean of four replicates. Means in the column followed by different letters (a, b, and c) are significantly different according to DMRT at p = 0.05. * = significantly different according to DMRT at p = 0.05.
Table
Table 8. Effect of SP007s formulation on kale plant growth under greenhouse conditions.
Table 8. Effect of SP007s formulation on kale plant growth under greenhouse conditions.
TreatmentsPlant Growth Parameter at 45 Days 1/
Canopy WidthPlant HeightRoot Length (cm)Leaves per PlantWeight (g)
(cm)(cm)FreshDry
SP007s Formulation21.45 ± 2.22 c7.60 ± 0.54 b12.18 ± 1.06 c7.6 ± 0.5410.55 ± 1.77 bc0.73 ± 0.15 b
SP007s Cell suspension 20.09 ± 1.51 cd7.60 ± 0.54 b13.36 ± 1.91 c7.8 ± 0.4411.90 ± 1.47 bc0.84 ± 0.0 b
Organic fertilizer24.30 ± 1.51 b8.40 ± 1.14 ab15.44 ± 2.49 ab7.8 ± 0.8313.64 ± 0.80 ab1.13 ± 0.30 b
Chemical fertilizer27.50 ± 0.70 a9.40 ± 0.89 a16.42 ± 1.71 a7.8 ± 0.8315.91 ± 2.70 a1.60 ± 0.70 a
Untreated19.30 ± 1.03 cd5.40 ± 0.54 c11.76 ± 0.45 c7.4 ± 0.5411.14 ± 3.00 bc0.55 ± 0.94 c
F-test ***ns**
CV (%)7.2810.127.2511.249.658.32
1/ Each value represents the mean of four replicates. Means in the column followed by different letters (a, b, c, and d) are significantly different according to DMRT at p = 0.05. * = significantly different according to DMRT at p = 0.05. ns = non-significant.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Nilmat, A.; Thepbandit, W.; Chuaboon, W.; Athinuwat, D. Pseudomonas fluorescens SP007S Formulations in Controlling Soft Rot Disease and Promoting Growth in Kale. Agronomy 2023, 13, 1856. https://doi.org/10.3390/agronomy13071856

AMA Style

Nilmat A, Thepbandit W, Chuaboon W, Athinuwat D. Pseudomonas fluorescens SP007S Formulations in Controlling Soft Rot Disease and Promoting Growth in Kale. Agronomy. 2023; 13(7):1856. https://doi.org/10.3390/agronomy13071856

Chicago/Turabian Style

Nilmat, Aphisit, Wannaporn Thepbandit, Wilawan Chuaboon, and Dusit Athinuwat. 2023. "Pseudomonas fluorescens SP007S Formulations in Controlling Soft Rot Disease and Promoting Growth in Kale" Agronomy 13, no. 7: 1856. https://doi.org/10.3390/agronomy13071856

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop