Next Article in Journal
Effects of Carbon-Based Fertilizer on Soil Physical and Chemical Properties, Soil Enzyme Activity and Soil Microorganism of Maize in Northeast China
Next Article in Special Issue
GmPBS1, a Hub Gene Interacting with Rhizobial Type-III Effectors NopT and NopP, Regulates Soybean Nodulation
Previous Article in Journal
Available PAR, Growth and Yield of a Super High-Density Almond Orchard Are Influenced by Different Row Orientations
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 3
10.3390/agronomy13030876
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Rhizobium tropici and Riboflavin Amendment Condition Arbuscular Mycorrhiza Colonization in Phaseolus vulgaris L.

by
Jacob Banuelos
1,
Esperanza Martínez-Romero
2,†,
Noé Manuel Montaño
3 and
Sara Lucía Camargo-Ricalde
3,*,†
1
Doctorado en Ciencias Biológicas y de la Salud, Universidad Autónoma Metropolitana, Av. Ferrocarill San Rafael Atlixco 186, Mexico City 09310, Mexico
2
Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Av. Universidad 2001, Cuernavaca 62210, Mexico
3
Departamento de Biología, División de Ciencias Biológicas y de la Salud, Universidad Autónoma Metropolitana, Unidad Iztapalapa, Av. Ferrocarill san Rafael Atlixco 186, Mexico City 09310, Mexico
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2023, 13(3), 876; https://doi.org/10.3390/agronomy13030876
Submission received: 16 January 2023 / Revised: 4 March 2023 / Accepted: 5 March 2023 / Published: 16 March 2023
(This article belongs to the Special Issue Legume-Rhizobia Symbiosis: From Early Signaling to Nodule Functioning)
Browse Figures
Review Reports Versions Notes

Abstract

:
Phaseolus vulgaris L. (Fabaceae) forms symbioses with arbuscular mycorrhizal fungi (AMF) and nitrogen-fixing rhizobia (NFB). The tripartite relationship uses molecular singals to establish intracellular symbioses in roots. The goal of this study was to determine if Rhizobium tropici CIAT 899 and exogenous riboflavin (vitamin B2) have an effect on AMF species selection and root colonization of P. vulgaris. Using SSU rRNA fragment amplification of DNA extracted from P. vulgaris roots, we found that the presence of R. tropici altered the relative distribution of AMF species. Dominikia bernensis (Ohel) was the most abundant AMF species in P. vulgaris roots but when R. tropici was co-inoculated, Glomus species dominated. Rhizobacteria such as R. tropici, secrete riboflavin and could affect AMF symbiosis. Addition of 50 μM riboflavin to P. vulgaris, increased plant growth (28%), dry nodule weight (18%), AMF colonization (248%) and mycorrhizal vesicle frequency (56%) in bean roots. 3.12 and 12.5 µM riboflavin favored the presence of Glomus macrocarpum in P. vulgaris roots. This work provides the basis to further study of rhizobial and mycorrhizal co-inoculation of Phaseolus vulgaris bean.

1. Introduction

Phaseolus vulgaris L. (Fabaceae) is a widely used legume for human nutrition and can form symbiotic associations with arbuscular mycorrhizal fungi (AMF) and nitrogen-fixing rhizobacteria (NFR) [1]. Among the bacterial species that form root nodules in P. vulgaris, Rhizobium etli, Rhizobium phaseoli and Rhizobium tropici have been extensively studied [2,3]. R. tropici has outstanding stress resistance [4] and has been successfully used as a P. vulgaris inoculant in South America [5]. Diverse AMFs have been used as inoculants in agriculture [6] to promote nutrient mobilization [7,8], mineral uptake [9] and general plant growth [10]. To some extent, AMF-inoculated plants had enhanced photosynthesis, and upregulate osmoprotectans [11]. Among arbuscular mycorrhizal fungi, the model species Rhizophagus irregularis and Funneliformis mosseae are among the most widely used species [11] that significantly increase yields in globally important crops [12,13], including P. vulgaris [14]. In five different legumes inoculated with Funneliformis mosseae, the highest spore number, nodule weight and percentage of AMF colonization were found in Vigna radiata L. (Wilczek), compared to other host plant such as Glycine max L. [15]. In different Coffea arabica cultivars, the combination of three selected AMF species was more efficient than inoculation with a single species, although the effect depended on the C. arabica cultivar [16]. Hosts may find their most suitable symbiont by selecting it from a mycorrhizal mixture. Native AMF communities have been shown to interact positively with the plant host under stress conditions, in contrast to introduced AMF [17].
Inoculation with rhizobia has been practiced for more than a hundred years, while the coinoculation of rhizobia and mycorrhiza is more recent and leads to higher yields in compatible crops [18]. Coinoculation generally leads to increased AMF colonization, but depends on the AMF species [19]. In clover, dual inoculation of Rhizophagus intraradices and Rhizobium trifolii showed that the latter stimulated mycorrhizal colonization, and both had an additive effect on nitrogen (N) metabolites and N assimilation [20]. However, the presence of mycorrhizal and rhizobial symbionts in legume roots was not always beneficial for the plant [21]. The increased N assimilation could allow the plant to host other beneficial organisms, especially under unfavorable conditions [22]. The interaction between mycorrhizal fungi and rhizobial symbionts with the host could affect the efficiency or evolution of each symbiosis, and the challenge in a tripartite symbiosis is to understand how the taxonomic diversity of AMF interacts with symbiotic nitrogen-fixing bacteria and how it affects the host. It has been shown that AMF colonization in cowpea (Vigna unguiculata (L.) Walp.) AMF species composition in roots was altered when Sinorhizobium meliloti (Dangeard) was present [19].
To achieve the highest efficiency of AMF and NFR, the selection of appropriate AMF species compatible with NFR is essential [23]. Since there are more than 400 AMF species, the use of inocula with multiple strains could increase the interaction with the NFR to select the AMF species that is functional in the tripartite interaction. The response of AMF can be related to the rhizobial strains that are specifically associated with the plant. Nitrogen-fixing bacteria may stimulate and enhance mycorrhizal colonization even before nodule formation [24]. It is necessary to develop a soundstrategy to increase the efficiency in the use of multispecies inoculants.
Mycorrhizal symbiosis is evolutionarily older than rhizobial symbiosis and it is considered the “mother of plant symbioses” [25,26]. Both rhizobia and mycorrhiza make use of a common genetic symbiotic pathway in legume plants [27]. This shared signaling pathway affects both symbionts; for example, AMF colonization may not occur in some non-nodulating legume mutants [28], as AMF may rely on the same signals as rhizobia to facilitate infection. Both mutualistic associations are present in the rhizosphere, and despite their apparent differences, several molecular signals are recruited by the plant cell for both symbioses [29]. Moreover, the Myc factor of mycorrhiza and the Nod factors of rhizobia have similar chemical structures [30] and the application of external Nod factors increases the mycorrhizal colonization [31].
Riboflavin (vitamin B2) is the precursor of the electron-carrying coenzymes flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN). These coenzymes are involved in metabolic processes including energy production and act as antioxidants. Riboflavin and lumichrome can increase shoot growth and CO2 availability in roots [32]. Riboflavin is produced by some rhizobacteria [33] that require exogenous CO2 for nodule growth [34]. Riboflavin overproducing S. meliloti strains exhibited 55% higher root colonization efficiency [35] and nanomolar amounts of riboflavin can stimulate alfalfa colonization by S. meliloti [36]. Riboflavin from rhizobia could potentially benefit not only plants, but also other symbionts such as AMF because riboflavin promotes hyphal growth in AMF [37] and stimulates rhizobial nodulation [38]. The extent to which riboflavin may affect AMF development during coinoculation with NFR has not yet been determined. The aim of this research was to explore if Rhizobium tropici CIAT 899 and exogenous riboflavin supplied to plants have an effect on the selection of AMF species (from a fungal mixture) by Phaseolus vulgaris.

2. Materials and Methods

2.1. Experimental Design

Two experiments were conducted under greenhouse conditions. In the first, a completely randomized experiment, with four treatments and four replicates was conducted. P. vulgaris seedlings were inoculated with an AMF mixture and were irrigated weekly for 35 days with four concentrations of riboflavin (50, 25, 12.5 and 3.12 μM).
In the second experiment, a fixed three-factorial design was established: mycorrhized plants, R. tropici CIAT 899 and with or without riboflavin with eight replicates. Based on the results of the first experiment, a riboflavin concentration was selected that had a significant effect on AMF. Treatments without AMF or riboflavin were controls. Both experiments were conducted under greenhouse conditions (relative humidity average 78%, average temperature 20 °C) at the Faculty of Agricultural Sciences, Universidad Veracruzana (N 19′ 30″ 54–W 96′ 55″ 05).

2.2. Soil

The soil used in the pots had the following characteristics: P 63.5 (%); available phosphorus (P), 40.52 mg kg−1 (Olsen); ammonium (NH4-N), 34.28 mg kg−1 (salicylate method); nitrates (NO3-N), 36.28 mg kg−1; pyrophosphate-extractable iron (Fe) (PeF), 1016 mg kg−1; organic matter (OM), 7.13% (Walkley-Black); organic carbon (OC), 4.14% (Walkley-Black); sodium (Na), 0.029 mol kg−1 (atomic absorption spectrometry); calcium (Ca) 0.0173 mol kg−1 (atomic absorption spectrometry) and magnesium (Mg) 0.0327 mol kg−1 (atomic absorption spectrometry). The pH was of 6.7 and was obtained in a suspension of soil:deionized water (1:2 w/v). Soil analysis was performed by the Soil Analysis Laboratory of INECOL, Xalapa, Mexico. The soil used was sterilized by autoclaving to prevent competition from native microbes [11]. The soil was purchased from “Viversos El Olmo”, a plant store located in Xalapa, Veracruz, Mexico.

2.3. Plant Material

Phaseolus vulgaris L. cv Negro Jamapa is a bean variety released in Veracruz, Mexico, sixty years ago [39]. Negro Jamapa bean seeds were surface-disinfected [40] by treating them with 70% ethanol for 1 min, followed by 1.2% sodium hypochlorite for 15 min, rinsing four times with sterilized water, once with 2% sodium thiosulfate and a final rinsing with water. Seeds were germinated in sterilized quartz sand at total water-holding capacity (42.7%) before being planted in1 L pots (13 cm diameter) with autoclaved soil (120 °C for 40 min).

2.4. Riboflavin (Vitamin B2) Concentrations

A stock solution of 50 µM riboflavin from Sigma-Aldrich (BioReagent for cell culture) was prepared in deionized sterile water by stirring for 10 min in the dark and stored at 4 °C before to use. Dilutions of the stock solution were made with deionized sterile water to obtain 50, 25, 12.5 and 3.12 µM. 50 mL of riboflavin was added to the plant 2 cm from the stem at night to prevent riboflavin degradation. Five days after mycorrhizal inoculation and every five days until harvest. The control treatments were irrigated with sterile deionized water. Initially, these four riboflavin concentrations were tested and then only 50 µM was used in the presence of both symbionts.

2.5. Arbuscular Mycorrhizal Fungi

The AMF mixture was provided by the Laboratory of Beneficial Organisms, Faculty of Agricultural Sciences of Universidad Veracruzana, Mexico. The inoculant used has been tested as highly effective in pineapple [41], cover crops [42], avocado [43], and it is commercially available as Rhizofermic. The inoculant had only been identified morphologically and here, we identified its content for the first time by SSU rRNA sequence analysis and 14 species were identified; only the Acaulospora species could not be determined (Table 1).
The inoculum was reproduced in Brachiaria decumbens Stapf (Poaceae) trap plants for 90 days, in quartz sand autoclaved and irrigated with sterile deionized water. Irrigation was suspended for 30 days to induce sporulation. The roots were analyzed for the percentage of AMF colonization obtaining 80% [45,46]. The sand contained 4658 spores per 100 g−1 and they were isolated by wet sieving and decantation followed by centrifugation in 40% sucrose solution [47]. Plants were inoculated with AMF five days after seed germination and before transplanting. We used a mixture of 10 g of roots and quartz sand with spores (1:9) for a total of 419 spores per germinated seed. For non-AMF-inoculated treatments, the inoculum was prepared as follows: 500 g of the inoculum was autoclaved for 45 min at 120 °C and 1.05 kg cm−2.

2.6. Bacterial Strain and Preparation of Inoculum

Rhizobium tropici strain CIAT 899 [48] was obtained from the culture collection of the Center for Genomic Sciences, Universidad Nacional Autónoma de Mexico, Cuernavaca, Morelos, Mexico. The strain was cultured in sterilized PY broth (5 g peptone, 3 g yeast extract and 0.6 g CaCl2 per liter) for 24 h at 30 °C with constant shaking (250 rpm). Cultures were centrifuged for 3 min at 4000× g and the pellets were washed with MgSO4 10 mM [49]. The final concentration of bacteria was adjusted to 108 cells mL−1 and 2 mL was inoculated to each germinated seed in each pot. A second inoculation was performed after one week.

2.7. Plant Analysis

All plants were harvested 35 days after inoculation. The soil was washed off from the roots and they were placed between 4 paper towels to remove the excess of water. The plants were weighted separately by roots and shoots. Subsamples of roots (200 mg) were collected for microscopic examination of AMF structures, and the remaining roots and shoots were separated and frozen at −20 °C for DNA extraction. A trypan blue solution was used to visualize the fungal structures in the root subsamples [46], and the percentage of AMF root colonization was determined [50].

2.8. Arbuscular Mycorrhizal Fungi (AMF) DNA Extraction and Amplification

Three random subsamples per root system were pooled by treatment, frozen at −80 °C with liquid N2 and ground to a fine powder using a sterile mortar and pestle before DNA extraction [51,52]. DNA was extracted from the root samples using the Qiagen PowerSoil DNA extraction kit (Hilden, Germany), following the manufacturer’s instructions, obtaining 50 μL of elution buffer containing total gDNA. The quantity and quality of the DNA extracts were assessed on 1.5% agarose gel before further processing.
PCR, cloning and sequencing were performed by MACROGEN, Korea. PCR amplifications were performed individually from the DNA extracted from roots using primer pairs NS1 (GTAAGTCATATGCTTGTCTC) and NS41 (CCCGTGTTGAGTCAAATTA) to amplify a 1.2 kb fragment [53]. The PCR products were used as templates in a subsequent nested PCR. The primer set for the second round used AM1 (ATCACTTTCGATGGTAGGATAGA) and AM2 (GAACCCAAACACTTTGGTTTCC) primers [54], yielding a product of 800 bp targeting the variable regions of the nuclear 18S rRNA gene (SSU). Amplicon libraries were then prepared using the Nextera XT DNA library preparation kit and sequenced as single end reads using Ilumina platform [55]. For the first round of PCR, the conditions were as follows: 94 °C for 3 min; 25 cycles of 94 °C, 3 min; 60 °C, 1 min; 72 °C, 1 min; final extension at 72 °C for 7 min. For the second round, the conditions were 94 °C for 3 min; 32 cycles of 94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min and final extension at 72 °C for 10 min. Raw data were uploaded to SRA database.

2.9. Bioinformatic Analysis

The quality of the raw sequences was checked using FASTQC v0.11.8 [56] and raw demultiplexed raw sequences were processed using QIIME2 package version 2021.8 [57]. Sequences were denoised, dereplicated and filtered for chimeras using the DADA2 plugin [58]. Sequences were trimmed to include only bases with quality values > 20. The first 21–24 nucleotides were trimmed. ASVs with frequency less than 0.1% were removed. For taxa comparisons, we used the QIIME2 q2-feature-classifier plugin and the naive Bayes classifier trained on the MaarjAM database for QIIME 2 [59] and for ambiguous sequences a BLAST was performed with close sequences from GenBank and UNITE.

2.10. Statistical Analysis

One-way ANOVA and t-test comparing treatments were performed for growth variables. Results were expressed as means, ± standard deviation. Significant differences betweentreatment means, were analyzed using Tukey post hoc analysis (HSD p ≤ 0.05) or Student’s t-test. Normality and homogeneity of variances were tested using Shapiro–Wilk’s and Levene’s test. Analysis was performed in Minitab 21.1.0.

3. Results

3.1. Riboflavin Stimulates Plant Growth

The addition of riboflavin to P. vulgaris increased plant weight (ANOVA p ≤ 0.000; F(2.17) = 6.63; HSD p ≤ 0.05) (Figure 1). Riboflavin treatments increased root and shoot weight (Figure 1). Riboflavin together with R. tropici and the AMF mixture further increased plant growth (Figure 1).

3.2. Riboflavin Stimulates Arbuscular Mycorrhizal Fungi (AMF) Colonization

Riboflavin increased AMF colonization significantly at 12.5 µM (HSD p ≤ 0.05). Riboflavin at 25 µM had the highest AMF root colonization, but there were no significant differences among the various riboflavin concentrations (Figure 2a). Notably the distribution of the structures changed with the addition of riboflavin, as vesicles increased and arbuscules and hyphae were reduced. The different riboflavin concentrations had a differential effect on root colonization, with a higher increase of vesicles at 25 µM (Figure 2b).

3.3. Effect of the Co-Inoculation of R. tropici and Riboflavin

The co-inoculation with R. tropici CIAT 899 increased the AMF colonization by 31.4% compared to only mycorrhized plants, but there was no difference when riboflavin was added to co-inoculated bean plants (Figure 3a). The proportion of vesicles increased by the addition of riboflavin, whereas arbuscules and hyphae were reduced as compared with only mycorrhized plants, as in the first experiment (Figure 2b). A similar effect was observed in the co-inoculated bean roots (Figure 3b). R. tropici and riboflavin affected the root length and AMF colonization.

3.4. Inoculation with R. tropici Shifts the AMF Species Profile Colonizing P. vulgaris

The original inoculum was analyzed to determine the relative species composition which showed that R. irregularis was the predominant species (Figure 4). When the inoculum was used on P. vulgaris, D. bernensis became the dominant species, followed by R. irregularis and C. pellucida in smaller proportions. The main family that colonized the roots of P. vulgaris was the Glomeraceae.
Riboflavin had a small effect on the relative proportion of AMF species in the treatments inoculated with R. tropici (Figure 4), when inoculated with mycorrhiza only, the proportion of G. macrocarpum increased when riboflavin was added at low concentrations (Figure 4 right). Riboflavin altered the proportions of species recovered from P. vulgaris roots, by decreasing the dominance of D. bernensis in favor of G. macrocarpum. In the plant assays performed here, nodule dry weight in P. vulgaris was similar with or without riboflavin. Plants with riboflavin, mycorrhizal fungi and R. tropici had a significantly higher nodule dry weights than plants inoculated with both biological inoculants but without added riboflavin (Figure 1). The proportion of AMF species depended on coinoculation with R. tropici and host identity.

4. Discussion

Numerous studies have reported the beneficial effects of mycorrhiza in P. vulgaris plants using fungal monocultures, especially R. irregularis [14,60]. R. irregularis is widely used because it can be cultivated in vitro [61] and is considered a model species [62]. In contrast, here we used here an inoculum composed of multiple species. AMF species diversity is usually associated with higher plant biomass production and nutrient uptake [21]. The use of a multispecies inoculum may increase the possibilities of achieving beneficial effects [33,44].

4.1. Changes on Arbuscular Mycorrhizal Fungi (AMF) Community Structure by the Plant

Host plants are important determinants of AMF community composition [63], but soil and environmental conditions may also have an influence. The effect of mycorrhizal and rhizobial coinoculation can be influenced by the host, rhizobia and AMF species. At the same time, plants can direct carbohydrate supply to the fungi that is best suited for the specific conditions [39,40]. Here, we obtained evidence of mycorrhizal selection by P. vulgaris that results in only a few species from an AMF mixture colonizing the roots. P. vulgaris selected D. bernensis from the other species present in the (Figure 4). In B. decumbens (the original host ofthe AMF mixture) a different species distribution was observed (Figure 4), where R. irregularis was most abundant in the plant roots. R. irregularis can be more competitive than other AMF species when co-inoculated [19,64], but in our results, the host and NFR influenced the abundance of each AMF species. Competing interactions between AMF species or other symbionts [65] are another important factor in the structure of the intraradical AMF community.

4.2. R. Tropici Effect and the Possible Mechanisms Influencing Arbuscular Mycorrhizal Fungi (AMF)

According to our results, R. tropici could be affecting the mycorrhizal composition in bean roots, favoring Glomus sp. as the dominant species and reducing the prevalence of D. bernensis. The direct mechanisms for this shift could be different, but some antifungals that are produced by Rhizobium might have an impact on the prevalence of the AMF species [66]. Breil et al. [67] reported that Rhizobium spp. produces trifolitoxin, which has antimicrobial activity that affects soilborne fungal pathogens [68]. Other mechanisms could be nutrient competition [69] since R. tropici can reach a large cell number on roots that would be a carbon sink. Otherwise, R. tropici could trigger plant defense responses [70] or have a signaling effect that conditions the colonization by different mycorrhizal species, favoring some species and inhibiting others. Inoculation with rhizobia may reduce colonization of AMF hyphae in roots, but this depends on the identity of the symbiont and nutrient availability [71]. AMF communities are influenced by available nutrients (nitrogen and phosphorus) [72], host interaction by other symbionts at the rhizosphere [73] or changes in plant innate immune responses [74]. We observed an increase in AMF root length colonization when R. tropici was coinoculated with the AMF mixture. Depending on the AMF species, root colonization may be positively, negatively or not significantly affected by the presence of NFB [75]. Tsikou et al. [75] found that Mesorhizobium loti favored root colonization of C. etunicatum, while it did not affect F. mosseae. In our study, R. tropici favored Glomus sp1 over D. bernensis, so in this system, the effect on colonization might dependt on the mycorrhizal species.
In addition, R. tropici produces vitamins such as riboflavin [38] and plant hormones such as auxins [76] which may alter plant defense responses or plant metabolite production but could also be assimilated by fungi to alter the competitive ability of different mycorrhizal species. Therefore, we investigated the effects of exogenous riboflavin on mycorrhizal colonization in P. vulgaris.

4.3. Effect of Riboflavin in the Mycorrhizal Fungi in Phaseolus vulgaris

Riboflavin increased mycorrhizal colonization and the presence of vesicles in AMF-colonized roots. The vesicles are the primary lipid and P storage structures of AMF and larger amounts can serve as an important resource sink to provide for the colonized plants [77]. Riboflavin produced by R. tropici may be responsible for the switch in species dominance in the roots. Previous studies showed that riboflavin increased CO2 content in Medicago sativa roots [33] up to 100% [78]. Becard et al. [37] reported that an increase in CO2 content could favor AMF root colonization. It is likely that AMF benefit from an increase in CO2 promoted by riboflavin produced by rhizobia in the roots. It has been reported that elevated CO2 significantly stimulates root biomass and AMF gene abundance [79]. In addition, arbuscular mycorrhizal fungi enhance nutrient accumulation in wheat when exposed to elevated CO2 [80]. It has been suggested that elevated atmospheric CO2 may shift carbon flux from roots to associated microbial communities, particularly arbuscular mycorrhizal fungi, as they are key players in carbon transfer actors between plants and the soil [81]. Although the promotion of a symbiotic association between AMF and host has been documented, elevated CO2 in Pisum sativum L. [82] roots has no effect on mycorrhizal development of some AMF strains [82]; implying that there may be some interspecific fungal differences considered [83]. Lumichrome, a riboflavin derived falvin, applied to Lotus japonicus and Solanum lycopersicum promoted nodulation of Mesorhizobium loti (in L. japonicus) and hyphal formation of Glomus intraradices (R. intraradices) and Glomus mosseae (F. mosseae), delaying the maturation of the arbuscule [84]. Our results support the suggestion that increased respiration in roots, caused by exogenous riboflavin administration, also alters and promotes AMF symbiosis [37].
The Glomeraceae family produces a large amount of intraradical biomass [85], while Gigasporaceae produce more extraradical hyphae [85,86]. In our molecular analysis, we found higher abundance of Glomeraceae in most treatments (Dominikia and Glomus). The initial inoculum had a large relative abundance of R. irregularis, which is usually the first species to colonize the plants (within two weeks) compared to species such as Glomus aggregatum (four weeks) [64]. R. irregularis has the advantage of colonizing a larger portion of the root and reproducing when conditions are appropriate [64].
The pattern of root colonization is of special interest. When co-inoculated with Bradyrhizobium CB1015, the proportion of F. mosseae vesicles increased in mung bean (Vigna radiata (L.) R. Wilczek) [87]. Mycorrhizal colonization increased not only with R. tropici, but also with riboflavin, which also increased vesicle percentage as compared to the control (Figure 2b). In general, an increase in arbuscular fungi corresponds to an increase in phosphorus content in the root. [88]. When plants grow in stressful environment, the colonization of AMF roots is stimulated, affecting the amount of vesicles and arbuscules [89].
The development of an AMF inoculum for legumes should consider both AMF species identity and effects on plant performance and yield. This study provides the basis for future studies to further explore the interaction of AMF inoculum with efficient rhizobia, and how riboflavin, a vitamin produced by rhizobia can increase AMF colonization on a concentration basis.

5. Conclusions

Riboflavin can increase AMF root colonization in P. vulgaris plants, depending on the concentration. To our knowledge, this is the first work reporting riboflavin-induced changes in colonization by arbuscular mycorrhizal fungi. Coinoculation of AMF with R. tropici CIAT899 also increases AMF root colonization but is not further increased by the addition of 50 µM riboflavin.
We found that the AMF composition changed from the AMF mixture originally used as inoculum. P. vulgaris may have a preference for D. bernensis from a diverse AMF mixture, while riboflavin may exert a selection pressure on AMF species at a certain concentration.
Coinoculation of AMF with R. tropici CIAT899 at a concentration of 50 µM had little to no effect on AMF species composition. Our data suggest that secondary metabolites and the presence of other symbionts such as R. tropici may influence AMF species composition in mycorrhizal roots.

Author Contributions

Conceptualization, J.B., S.L.C.-R., N.M.M. and E.M.-R.; methodology, S.L.C.-R. and E.M.-R.; formal analysis, J.B.; investigation, J.B.; resources, E.M.-R., S.L.C.-R. and N.M.M.; data curation, J.B.; writing—original draft preparation, J.B.; writing—review and editing, E.M.-R., S.L.C.-R.; supervision, E.M.-R. and S.L.C.-R.; funding acquisition, S.L.C.-R., N.M.M. and E.M.-R. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

Authors would like to thank M. Dunn and M. Rosenblueth for reading and commenting on the manuscript.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Razakatiana, A.T.E.; Trap, J.; Baohanta, R.H.; Raherimandimby, M.; Le Roux, C.; Duponnois, R.; Ramanankierana, H.; Becquer, T. Benefits of Dual Inoculation with Arbuscular Mycorrhizal Fungi and Rhizobia on Phaseolus vulgaris Planted in a Low-Fertility Tropical Soil. Pedobiologia 2020, 83, 150685. [Google Scholar] [CrossRef]
  2. Shamseldin, A.; Velázquez, E. The Promiscuity of Phaseolus vulgaris L. (Common Bean) for Nodulation with Rhizobia: A veview. World J. Microbiol. Biotechnol. 2020, 36, 63. [Google Scholar] [CrossRef]
  3. Montes-Grajales, D.; Esturau-Escofet, N.; Esquivel, B.; Martinez-Romero, E. Exo-Metabolites of Phaseolus vulgaris-Nodulating Rhizobial Strains. Metabolites 2019, 9, 105. [Google Scholar] [CrossRef] [Green Version]
  4. Santos, M.S.; Nogueira, M.A.; Hungria, M. Microbial Inoculants: Reviewing the Past, Discussing the Present and Previewing an Outstanding Future for the Use of Beneficial Bacteria in Agriculture. AMB Express 2019, 9, 205. [Google Scholar] [CrossRef]
  5. Ormeño-Orrillo, E.; Menna, P.; Almeida, L.G.P.; Ollero, F.J.; Nicolás, M.F.; Pains Rodrigues, E.; Shigueyoshi Nakatani, A.; Silva Batista, J.S.; Oliveira Chueire, L.M.; Souza, R.C.; et al. Genomic Basis of Broad Host Range and Environmental Adaptability of Rhizobium tropici CIAT 899 and Rhizobium Sp. PRF 81 Which Are Used in Inoculants for Common Bean (Phaseolus vulgaris L.). BMC Genom. 2012, 13, 735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Igiehon, O.N.; Babalola, O.O. Rhizobium and Mycorrhizal Fungal Species Improved Soybean Yield under Drought Stress Conditions. Curr. Microbiol. 2021, 78, 1615–1627. [Google Scholar] [CrossRef]
  7. Sidorova, I.; Voronina, E. Microbiome-Driven Nutrient Fortification in Plants. In The Plant Microbiome in Sustainable Agriculture; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2020; pp. 211–230. ISBN 978-1-119-50545-7. [Google Scholar]
  8. de Souza Buzo, F.; Satin Mortinho, E.; Lobo Santana, T.L.; Militão Garcia, I.; de Carvalho, C.L.M.; Filho, M.C.M.T. Bean Nutrition and Development in the Function of Reduced Phosphorus Doses and Inoculation with Arbuscular Mycorrhizal Fungus. J. Plant Nutr. 2022, 45, 1942–1952. [Google Scholar] [CrossRef]
  9. Tao, Q.; Zhao, J.; Li, J.; Liu, Y.; Luo, J.; Yuan, S.; Li, B.; Li, Q.; Xu, Q.; Yu, X.; et al. Unique Root Exudate Tartaric Acid Enhanced Cadmium Mobilization and Uptake in Cd-Hyperaccumulator Sedum alfredii. J. Hazard. Mater. 2020, 383, 121177. [Google Scholar] [CrossRef] [PubMed]
  10. Diagne, N.; Ngom, M.; Djighaly, P.I.; Fall, D.; Hocher, V.; Svistoonoff, S. Roles of Arbuscular Mycorrhizal Fungi on Plant Growth and Performance: Importance in Biotic and Abiotic Stressed Regulation. Diversity 2020, 12, 370. [Google Scholar] [CrossRef]
  11. Sheteiwy, M.S.; El-Sawah, A.M.; Korany, S.M.; Alsherif, E.A.; Mowafy, A.M.; Chen, J.; Jośko, I.; Selim, S.; AbdElgawad, H. Arbuscular Mycorrhizal Fungus “Rhizophagus irregularis” Impacts on Physiological and Biochemical Responses of Ryegrass and Chickpea Plants under Beryllium Stress. Environ. Pollut. 2022, 315, 120356. [Google Scholar] [CrossRef]
  12. Ceballos, I.; Ruiz, M.; Fernández, C.; Peña, R.; Rodríguez, A.; Sanders, I.R. The In Vitro Mass-Produced Model Mycorrhizal Fungus, Rhizophagus irregularis, Significantly Increases Yields of the Globally Important Food Security Crop Cassava. PLoS ONE 2013, 8, e70633. [Google Scholar] [CrossRef] [PubMed]
  13. Sheteiwy, M.S.; Ali, D.F.I.; Xiong, Y.-C.; Brestic, M.; Skalicky, M.; Hamoud, Y.A.; Ulhassan, Z.; Shaghaleh, H.; AbdElgawad, H.; Farooq, M.; et al. Physiological and Biochemical Responses of Soybean Plants Inoculated with Arbuscular Mycorrhizal Fungi and Bradyrhizobium under Drought Stress. BMC Plant Biol. 2021, 21, 195. [Google Scholar] [CrossRef] [PubMed]
  14. Hidalgo Rodríguez, J.E.M.; Ramos Otiniano, C.C.; Lezama Asencio, P.B.; Chuna Mogollón, P.; Chaman Medina, M.E. Coinoculación de Rhizophagus irregularis y Rhizobium Sp. En Phaseolus vulgaris L. var. Canario (Fabaceae) frijol Canario. Arnaldoa 2019, 26, 991–1006. [Google Scholar] [CrossRef]
  15. Tahat, M.M.; Sijam, K.; Alananbeh, K. Exploring the Use of Legumes as Host Plant Species in Glomus mosseae Sporulation. Legume Res. 2018, 4, 913–918. [Google Scholar] [CrossRef] [Green Version]
  16. Hernandez-Acosta, E.; Trejo Aguilar, D.; Ferrera Cerrato, R.; Rivera-Fernández, A.; Gonzalez-Chavez, C. Hongos micorrízicos arbusculares en el crecimiento de café (Coffea arabica L.) variedades garnica, catimor, caturra y catuaí. Agro. Product. 2018, 11, 61–67. [Google Scholar]
  17. Omirou, M.; Ioannides, I.M.; Ehaliotis, C. Mycorrhizal Inoculation Affects Arbuscular Mycorrhizal Diversity in Watermelon Roots, but Leads to Improved Colonization and Plant Response under Water Stress Only. Appl. Soil Ecol. 2013, 63, 112–119. [Google Scholar] [CrossRef]
  18. Sammauria, R.; Kumawat, S.; Kumawat, P.; Singh, J.; Jatwa, T.K. Microbial Inoculants: Potential Tool for Sustainability of Agricultural Production Systems. Arch. Microbiol. 2020, 202, 677–693. [Google Scholar] [CrossRef]
  19. Kavadia, A.; Omirou, M.; Fasoula, D.A.; Louka, F.; Ehaliotis, C.; Ioannides, I.M. Co-Inoculations with Rhizobia and Arbuscular Mycorrhizal Fungi Alters Mycorrhizal Composition and Lead to Synergistic Growth Effects in Cowpea That Are Fungal Combination-Dependent. Appl. Soil Ecol. 2021, 167, 104013. [Google Scholar] [CrossRef]
  20. Xie, M.-M.; Chen, S.-M.; Zou, Y.-N.; Srivastava, A.K.; Rahman, M.M.; Wu, Q.-S.; Kuča, K. Effects of Rhizophagus intraradices and Rhizobium trifolii on Growth and N Assimilation of White Clover. Plant Growth Regul. 2021, 93, 311–318. [Google Scholar] [CrossRef]
  21. Omirou, M.; Fasoula, D.A.; Ioannides, I.M. Bradyrhizobium Inoculation Alters Indigenous AMF Community Assemblages and Interacts Positively with AMF Inoculum to Improve Cowpea Performance. Appl. Soil Ecol. 2016, 108, 381–389. [Google Scholar] [CrossRef]
  22. Musyoka, D.M.; Njeru, E.M.; Nyamwange, M.M.; Maingi, J.M. Arbuscular Mycorrhizal Fungi and Bradyrhizobium Co-Inoculation Enhances Nitrogen Fixation and Growth of Green Grams (Vigna radiata L.) under Water Stress. J. Plant Nutr. 2020, 43, 1036–1047. [Google Scholar] [CrossRef]
  23. Hart, M.M.; Antunes, P.M.; Chaudhary, V.B.; Abbott, L.K. Fungal Inoculants in the Field: Is the Reward Greater than the Risk? Funct. Ecol. 2018, 32, 126–135. [Google Scholar] [CrossRef] [Green Version]
  24. Genre, A.; Russo, G. Does a Common Pathway Transduce Symbiotic Signals in Plant–Microbe Interactions? Front. Plant Sci. 2016, 7, 96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Remy, W.; Taylor, T.N.; Hass, H.; Kerp, H. Four Hundred-Million-Year-Old Vesicular Arbuscular Mycorrhizae. Proc. Natl. Acad. Sci. USA 1994, 91, 11841–11843. [Google Scholar] [CrossRef] [Green Version]
  26. Parniske, M. Arbuscular Mycorrhiza: The Mother of Plant Root Endosymbioses. Nat. Rev. Microbiol. 2008, 6, 763–775. [Google Scholar] [CrossRef] [PubMed]
  27. Martin, F.M.; Uroz, S.; Barker, D.G. Ancestral Alliances: Plant Mutualistic Symbioses with Fungi and Bacteria. Science 2017, 356, eaad4501. [Google Scholar] [CrossRef]
  28. Balaji, B.; Ba, A.M.; LaRue, T.A.; Tepfer, D.; Piché, Y. Pisum Sativum Mutants Insensitive to Nodulation Are Also Insensitive to Invasion in vitro by the Mycorrhizal Fungus. Gigaspora Margarita Plant Sci. 1994, 102, 195–203. [Google Scholar] [CrossRef]
  29. Fonseca-García, C.; Zayas, A.E.; Montiel, J.; Nava, N.; Sánchez, F.; Quinto, C. Transcriptome Analysis of the Differential Effect of the NADPH Oxidase Gene RbohB in Phaseolus vulgaris Roots Following Rhizobium tropici and Rhizophagus irregularis Inoculation. BMC Genom. 2019, 20, 800. [Google Scholar] [CrossRef] [Green Version]
  30. Oláh, B.; Brière, C.; Bécard, G.; Dénarié, J.; Gough, C. Nod Factors and a Diffusible Factor from Arbuscular Mycorrhizal Fungi Stimulate Lateral Root Formation in Medicago truncatula via the DMI1/DMI2 Signalling Pathway. Plant J. 2005, 44, 195–207. [Google Scholar] [CrossRef]
  31. Xie, Z.P.; Staehelin, C.; Vierheilig, H.; Wiemken, A.; Jabbouri, S.; Broughton, W.J.; Vogeli-Lange, R.; Boller, T. Rhizobial Nodulation Factors Stimulate Mycorrhizal Colonization of Nodulating and Nonnodulating Soybeans. Plant Physiol. 1995, 108, 1519–1525. [Google Scholar] [CrossRef] [Green Version]
  32. Coker, G.T.; Schubert, K.R. Carbon Dioxide Fixation in Soybean Roots and Nodules: I. Characterization and Comparison with n 2 Fixation and Composition of Xylem Exudate during Early Nodule Development. Plant Physiol. 1981, 67, 691–696. [Google Scholar] [CrossRef] [Green Version]
  33. Phillips, D.A.; Joseph, C.M.; Yang, G.-P.; Martínez-Romero, E.; Sanborn, J.R.; Volpin, H. Identification of Lumichrome as a Sinorhizobium Enhancer of Alfalfa Root Respiration and Shoot Growth. Proc. Natl. Acad. Sci. USA 1999, 96, 12275–12280. [Google Scholar] [CrossRef] [Green Version]
  34. Lowe, R.H.; Evans, H.J. Carbon Dioxide Requirements for Growth of Legume Nodule Bacteria. Soil Sci. 1962, 94, 351. [Google Scholar] [CrossRef]
  35. Yang, G.; Bhuvaneswari, T.V.; Joseph, C.M.; King, M.D.; Phillips, D.A. Roles for Riboflavin in the Sinorhizobium -Alfalfa Association. Mol. Plant. Microbe Interact. 2002, 15, 456–462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Streit, W.R.; Joseph, C.M.; Phillips, D.A. Biotin and Other Water-Soluble Vitamins Are Key Growth Factors for Alfalfa Root Colonization by Rhizobium meliloti 1021. Mol. Plant-Microbe Interact. MPMI 1996, 9, 330–338. [Google Scholar] [CrossRef]
  37. Bécard, G.; Piché, Y. Fungal Growth Stimulation by CO2 and Root Exudates in Vesicular-Arbuscular Mycorrhizal Symbiosis. Appl. Environ. Microbiol. 1989, 55, 2320–2325. [Google Scholar] [CrossRef] [Green Version]
  38. Dakora, F.D.; Matiru, V.N.; Kanu, A.S. Rhizosphere Ecology of Lumichrome and Riboflavin, Two Bacterial Signal Molecules Eliciting Developmental Changes in Plants. Front. Plant Sci. 2015, 6, 700. [Google Scholar] [CrossRef] [Green Version]
  39. Voysest, O. Variedades de Frijol En América Latina y Su Origen; Agronomía Programa de Frijol; Centro International de Agricultura Tropical (CIAT): Cali, Colombia, 1983; ISBN 84-89206-26-0. [Google Scholar]
  40. Rosenblueth, M.; Martínez-Romero, E. Rhizobium etli Maize Populations and Their Competitiveness for Root Colonization. Arch. Microbiol. 2004, 181, 337–344. [Google Scholar] [CrossRef] [PubMed]
  41. Trejo, D.; Sangabriel-Conde, W.; Gavito-Pardo, M.E.; Banuelos, J. Mycorrhizal Inoculation and Chemical Fertilizer Interactions in Pineapple under Field Conditions. Agriculture 2021, 11, 934. [Google Scholar] [CrossRef]
  42. Trejo, D.; Hernández-Acosta, E.; Baeza-Guzmán, Y.; Pérez-Toledo, G.; Morgado-Viveros, E.; Bañuelos, J.; Trejo, D.; Hernández-Acosta, E.; Baeza-Guzmán, Y.; Pérez-Toledo, G.; et al. Effectivity of introduced and native arbuscular mycorrhizal fungi in six crop legumes. Sci. Fungorum 2021, 51, e1320. [Google Scholar] [CrossRef]
  43. Banuelos, J.; Sangabriel, W.; Gavito, M.E.; Trejo Aguilar, D.; Camara, S.; Medel Ortiz, R.; Carreón Abud, Y. Effect of Different Phosphorus Levels on Avocado Inoculated with Arbuscular Mycorrhizal Fungi. Rev. Mex. Cienc. Agríc. 2017, 8, 1509–1520. [Google Scholar]
  44. Błaszkowski, J.; Sanchez-García, M.; Niezgoda, P.; Zubek, S.; Fernández, F.; Vila, A.; Al-Yahya´ei, M.N.; Symanczik, S.; Milczarski, P.; Malionowski, R.; et al. A new order, Entrophosporales, and three new Entrophospora species in Glomeromycota. Front. microbiol. 2022, 13, 4615. [Google Scholar] [CrossRef]
  45. Pistelli, L.; Ulivieri, V.; Giovanelli, S.; Avio, L.; Giovannetti, M.; Pistelli, L. Arbuscular Mycorrhizal Fungi Alter the Content and Composition of Secondary Metabolites in Bituminaria bituminosa L. Plant Biol. Stuttg. Ger. 2017, 19, 926–933. [Google Scholar] [CrossRef] [PubMed]
  46. Phillips, J.M.; Hayman, D.S. Improved Procedures for Clearing Roots and Staining Parasitic and Vesicular-Arbuscular Mycorrhizal Fungi for Rapid Assessment of Infection. Trans. Br. Mycol. Soc. 1970, 55, 158–161. [Google Scholar] [CrossRef]
  47. Sieverding, E. Manual de Métodos Para La Investigación de La Micorriza Vesículo-Arbuscular En El Laboratorio; CIAT: Cali, Colombia, 1983. [Google Scholar]
  48. Martínez-Romero, E.; Segovia, L.; Martins-Mercante, F.; Franco, A.A.; Graham, P.; Pardo, M.A. 1991 Rhizobium tropici, a Novel Species Nodulating Phaseolus vulgaris L. Beans and Leucaena sp. Trees. Int. J. Syst. Evol. Microbiol. 1991, 41, 417–426. [Google Scholar] [CrossRef] [Green Version]
  49. Aguirre-Noyola, J.L.; Rosenblueth, M.; Santiago-Martínez, M.G.; Martínez-Romero, E. Transcriptomic Responses of Rhizobium phaseoli to Root Exudates Reflect Its Capacity to Colonize Maize and Common Bean in an Intercropping System. Front. Microbiol. 2021, 12, 740818. [Google Scholar] [CrossRef]
  50. Giovannetti, M.; Mosse, B. An Evaluation Techniques for Measuring Vesicular Arbuscular Mycorrhizal Infection in Roots. New Phytol. 1979, 84, 489–500. [Google Scholar] [CrossRef]
  51. Lekberg, Y.; Vasar, M.; Bullington, L.S.; Sepp, S.-K.; Antunes, P.M.; Bunn, R.; Larkin, B.G.; Öpik, M. More Bang for the Buck? Can Arbuscular Mycorrhizal Fungal Communities Be Characterized Adequately alongside Other Fungi Using General Fungal Primers? New Phytol. 2018, 220, 971–976. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Stefani, F.; Bencherif, K.; Sabourin, S.; Hadj-Sahraoui, A.L.; Banchini, C.; Séguin, S.; Dalpé, Y. Taxonomic Assignment of Arbuscular Mycorrhizal Fungi in an 18S Metagenomic Dataset: A Case Study with Saltcedar (Tamarix aphylla). Mycorrhiza 2020, 30, 243–255. [Google Scholar] [CrossRef] [PubMed]
  53. White, T.; Bruns, T.; Lee, S.; Taylor, J.; Innis, M.; Gelfand, D.; Sninsky, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In Pcr Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; Volume 31, pp. 315–322. [Google Scholar]
  54. Lee, J.; Lee, S.; Young, J.P.W. Improved PCR Primers for the Detection and Identification of Arbuscular Mycorrhizal Fungi. FEMS Microbiol. Ecol. 2008, 65, 339–349. [Google Scholar] [CrossRef] [Green Version]
  55. Hassan, S.E.D.; Boon, E.; St-Arnaud, M.; Hijri, M. Molecular Biodiversity of Arbuscular Mycorrhizal Fungi in Trace Metal-Polluted Soils. Mol. Ecol. 2011, 20, 3469–3483. [Google Scholar] [CrossRef]
  56. Andrews, S. FastQC A Quality Control Tool for High Throughput Sequence Data version 0.11.9. Babraham Bioinformatics. 2010. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 3 September 2022).
  57. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, Interactive, Scalable and Extensible Microbiome Data Science Using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
  58. Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-Resolution Sample Inference from Illumina Amplicon Data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Öpik, M.; Vanatoa, A.; Vanatoa, E.; Moora, M.; Davison, J.; Kalwij, J.M.; Reier, Ü.; Zobel, M. The Online Database MaarjAM Reveals Global and Ecosystemic Distribution Patterns in Arbuscular Mycorrhizal Fungi (Glomeromycota). New Phytol. 2010, 188, 223–241. [Google Scholar] [CrossRef]
  60. Arthikala, M.-K.; Nava, N.; Quinto, C. Effect of Rhizobium and Arbuscular Mycorrhizal Fungi Inoculation on Electrolyte Leakage in Phaseolus vulgaris Roots Overexpressing RbohB. Plant Signal. Behav. 2015, 10, e1011932. [Google Scholar] [CrossRef]
  61. Rosikiewicz, P.; Bonvin, J.; Sanders, I.R. Cost-Efficient Production of in vitro Rhizophagus irregularis. Mycorrhiza 2017, 27, 477–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Chen, E.C.H.; Morin, E.; Beaudet, D.; Noel, J.; Yildirir, G.; Ndikumana, S.; Charron, P.; St-Onge, C.; Giorgi, J.; Krüger, M.; et al. High Intraspecific Genome Diversity in the Model Arbuscular Mycorrhizal Symbiont Rhizophagus irregularis. New Phytol. 2018, 220, 1161–1171. [Google Scholar] [CrossRef] [Green Version]
  63. Jansa, J.; Smith, F.A.; Smith, S.E. Are There Benefits of Simultaneous Root Colonization by Different Arbuscular Mycorrhizal Fungi? New Phytol. 2008, 177, 779–789. [Google Scholar] [CrossRef] [PubMed]
  64. Werner, G.D.A.; Kiers, E.T. Order of Arrival Structures Arbuscular Mycorrhizal Colonization of Plants. New Phytol. 2015, 205, 1515–1524. [Google Scholar] [CrossRef]
  65. Hart, M.M.; Forsythe, J.; Oshowski, B.; Bücking, H.; Jansa, J.; Kiers, E.T. Hiding in a Crowd—Does Diversity Facilitate Persistence of a Low-Quality Fungal Partner in the Mycorrhizal Symbiosis? Symbiosis 2013, 59, 47–56. [Google Scholar] [CrossRef]
  66. Drapeau, R.; Fortin, J.A.; Gagnon, C. Antifungal Activity of Rhizobium. Can. J. Bot. 1973, 51, 681–682. [Google Scholar] [CrossRef]
  67. Breil, B.; Borneman, J.; Triplett, E.W. A Newly Discovered Gene, TfuA, Involved in the Production of the Ribosomally Synthesized Peptide Antibiotic Trifolitoxin. J. Bacteriol. 1996, 178, 4150–4156. [Google Scholar] [CrossRef] [Green Version]
  68. Das, K.; Prasanna, R.; Saxena, A.K. Rhizobia: A Potential Biocontrol Agent for Soilborne Fungal Pathogens. Folia Microbiol. (Praha) 2017, 62, 425–435. [Google Scholar] [CrossRef] [PubMed]
  69. Kiers, E.T.; Denison, R.F. Sanctions, Cooperation, and the Stability of Plant-Rhizosphere Mutualisms. Annu. Rev. Ecol. Evol. Syst. 2008, 39, 215–236. [Google Scholar] [CrossRef] [Green Version]
  70. Ballhorn, D.J.; Kautz, S.; Schädler, M. Induced Plant Defense via Volatile Production Is Dependent on Rhizobial Symbiosis. Oecologia 2013, 172, 833–846. [Google Scholar] [CrossRef] [PubMed]
  71. Larimer, A.L.; Clay, K.; Bever, J.D. Synergism and Context Dependency of Interactions between Arbuscular Mycorrhizal Fungi and Rhizobia with a Prairie Legume. Ecology 2014, 95, 1045–1054. [Google Scholar] [CrossRef] [Green Version]
  72. Xiao, D.; He, X.; Zhang, W.; Cheng, M.; Hu, P.; Wang, K. Diazotroph and Arbuscular Mycorrhizal Fungal Diversity and Community Composition Responses to Karst and Non-Karst Soils. Appl. Soil Ecol. 2022, 170, 104227. [Google Scholar] [CrossRef]
  73. Abdel-Lateif, K.; Bogusz, D.; Hocher, V. The Role of Flavonoids in the Establishment of Plant Roots Endosymbioses with Arbuscular Mycorrhiza Fungi, Rhizobia and Frankia Bacteria. Plant Signal. Behav. 2012, 7, 636–641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Tóth, K.; Stacey, G. Does Plant Immunity Play a Critical Role during Initiation of the Legume-Rhizobium Symbiosis? Front. Plant Sci. 2015, 6, 401. [Google Scholar]
  75. Tsikou, D.; Nikolaou, C.N.; Tsiknia, M.; Papadopoulou, K.K.; Ehaliotis, C. Interplay between Rhizobial Nodulation and Arbuscular Mycorrhizal Fungal Colonization in Lotus japonicus Roots. J. Appl. Microbiol. 2023, 134, lxac010. [Google Scholar] [CrossRef]
  76. Etesami, H.; Alikhani, H.A.; Akbari, A.A. Evaluation of Plant Growth Hormones Production (IAA) Ability by Iranian Soils Rhizobial Strains and Effects of Superior Strains Application on Wheat Growth Indexes. World Appl. Sci. J. 2009, 6, 1576–1584. [Google Scholar]
  77. Olsson, P.A.; Hammer, E.C.; Pallon, J.; van Aarle, I.M.; Wallander, H. Elemental Composition in Vesicles of an Arbuscular Mycorrhizal Fungus, as Revealed by PIXE Analysis. Fungal Biol. 2011, 115, 643–648. [Google Scholar] [CrossRef] [PubMed]
  78. Volpin, H.; Phillips, D.A. Respiratory Elicitors from Rhizobium meliloti Affect Intact Alfalfa Roots. Plant Physiol. 1998, 116, 777–783. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  79. Wang, L.; Jia, X.; Zhao, Y.; Zhang, C.; Gao, Y.; Li, X.; Cao, K.; Zhang, N. Effects of Elevated CO2 on Arbuscular Mycorrhizal Fungi Associated with Robinia pseudoacacia L. Grown in Cadmium-Contaminated Soils. Sci. Total Environ. 2021, 768, 144453. [Google Scholar] [CrossRef]
  80. Zhu, X.; Song, F.; Liu, S.; Liu, F.; Li, X. Arbuscular Mycorrhiza Enhances Nutrient Accumulation in Wheat Exposed to Elevated CO2 and Soil Salinity. J. Plant Nutr. Soil Sci. 2018, 181, 836–846. [Google Scholar] [CrossRef]
  81. Drigo, B.; Pijl, A.S.; Duyts, H.; Kielak, A.M.; Gamper, H.A.; Houtekamer, M.J.; Boschker, H.T.S.; Bodelier, P.L.E.; Whiteley, A.S.; van Veen, J.A.; et al. Shifting Carbon Flow from Roots into Associated Microbial Communities in Response to Elevated Atmospheric CO2. Proc. Natl. Acad. Sci. USA 2010, 107, 10938–10942. [Google Scholar] [CrossRef] [Green Version]
  82. Gavito, M.E.; Curtis, P.S.; Mikkelsen, T.N.; Jakobsen, I. Atmospheric CO2 and Mycorrhiza Effects on Biomass Allocation and Nutrient Uptake of Nodulated Pea (Pisum sativum L.) Plants. J. Exp. Bot. 2000, 51, 1931–1938. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Klironomos, J.N.; Ursic, M.; Rillig, M.; Allen, M.F. Interspecific Differences in the Response of Arbuscular Mycorrhizal Fungi to Artemisia tridentata Grown under Elevated Atmospheric CO2. New Phytol. 1998, 138, 599–605. [Google Scholar] [CrossRef]
  84. Gouws, L.M.; Botes, E.; Wiese, A.J.; Trenkamp, S.; Torres-Jerez, I.; Tang, Y.; Hills, P.N.; Usadel, B.; Lloyd, J.R.; Fernie, A.R.; et al. The Plant Growth Promoting Substance, Lumichrome, Mimics Starch, and Ethylene-Associated Symbiotic Responses in Lotus and Tomato Roots. Front. Plant Sci. 2012, 3, 120. [Google Scholar] [CrossRef] [Green Version]
  85. Maherali, H.; Klironomos, J.N. Influence of Phylogeny on Fungal Community Assembly and Ecosystem Functioning. Science 2007, 316, 1746–1748. [Google Scholar] [CrossRef] [Green Version]
  86. Denison, R.F.; Kiers, E.T. Life Histories of Symbiotic Rhizobia and Mycorrhizal Fungi. Curr. Biol. 2011, 21, R775–R785. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  87. Gough, E.C.; Owen, K.J.; Zwart, R.S.; Thompson, J.P. Arbuscular Mycorrhizal Fungi Acted Synergistically with Bradyrhizobium Sp. to Improve Nodulation, Nitrogen Fixation, Plant Growth and Seed Yield of Mung Bean (Vigna radiata) but Increased the Population Density of the Root-Lesion Nematode Pratylenchus Thornei. Plant Soil 2021, 465, 431–452. [Google Scholar] [CrossRef]
  88. Bueno de Mesquita, C.P.; Martinez del Río, C.M.; Suding, K.N.; Schmidt, S.K. Rapid Temporal Changes in Root Colonization by Arbuscular Mycorrhizal Fungi and Fine Root Endophytes, Not Dark Septate Endophytes, Track Plant Activity and Environment in an Alpine Ecosystem. Mycorrhiza 2018, 28, 717–726. [Google Scholar] [CrossRef] [PubMed]
  89. Martínez-García, L.B.; de Dios Miranda, J.; Pugnaire, F.I. Impacts of Changing Rainfall Patterns on Mycorrhizal Status of a Shrub from Arid Environments. Eur. J. Soil Biol. 2012, 50, 64–67. [Google Scholar] [CrossRef]
† These authors contributed equally to this work.
Agronomy 13 00876 g001 550
Figure 1. Total fresh weight in Phaseolus vulgaris (common bean) 35 days after being co-inoculated with arbuscular mycorrhizal fungi (AMF) inoculum and Rhizobium tropici CIAT 899. n = 8. Bars represent the mean ± standard deviation. Different letters indicate significant differences among treatments of same tissue, Tukey HSD (p ≤ 0.05). M, arbuscular mycorrhizal fungi inoculated; B2, irrigated with 50 µM riboflavin; Rt, Rhizobium tropici CIAT 899 inoculation; C, control without inoculation.
Figure 1. Total fresh weight in Phaseolus vulgaris (common bean) 35 days after being co-inoculated with arbuscular mycorrhizal fungi (AMF) inoculum and Rhizobium tropici CIAT 899. n = 8. Bars represent the mean ± standard deviation. Different letters indicate significant differences among treatments of same tissue, Tukey HSD (p ≤ 0.05). M, arbuscular mycorrhizal fungi inoculated; B2, irrigated with 50 µM riboflavin; Rt, Rhizobium tropici CIAT 899 inoculation; C, control without inoculation.
Agronomy 13 00876 g001
Agronomy 13 00876 g002 550
Figure 2. Riboflavin stimulates arbuscular mycorrhizal fungi (AMF) colonization. (a) Root colonization percentage by AMF, and (b) proportion of AMF structures in roots with different riboflavin concentrations 35 days after inoculation. n = 4. Bars represent the mean ± standard deviation. Different letters indicate significant differences between treatments, Tukey HSD (p ≤ 0.05).
Figure 2. Riboflavin stimulates arbuscular mycorrhizal fungi (AMF) colonization. (a) Root colonization percentage by AMF, and (b) proportion of AMF structures in roots with different riboflavin concentrations 35 days after inoculation. n = 4. Bars represent the mean ± standard deviation. Different letters indicate significant differences between treatments, Tukey HSD (p ≤ 0.05).
Agronomy 13 00876 g002
Agronomy 13 00876 g003 550
Figure 3. Effect of coinoculation of Rhizobium tropici and riboflavin (vitamin B2) in Phaseolus vulgaris. (a) Percentage of root colonization by Arbuscular mycorrhizal fungi (AMF) colonization percentage, and (b) percentage of colonization by AMF structures in roots with or without riboflavin and with or without Rhizobium tropici 35 days after inoculation. N = 4. Bars represent the mean ± standard deviation. M, AMF inoculum; B2, riboflavin (50 µM); Rt, R. tropici CIAT 899. *, significant differences (t-test, p ≤ 0.05).
Figure 3. Effect of coinoculation of Rhizobium tropici and riboflavin (vitamin B2) in Phaseolus vulgaris. (a) Percentage of root colonization by Arbuscular mycorrhizal fungi (AMF) colonization percentage, and (b) percentage of colonization by AMF structures in roots with or without riboflavin and with or without Rhizobium tropici 35 days after inoculation. N = 4. Bars represent the mean ± standard deviation. M, AMF inoculum; B2, riboflavin (50 µM); Rt, R. tropici CIAT 899. *, significant differences (t-test, p ≤ 0.05).
Agronomy 13 00876 g003
Agronomy 13 00876 g004 550
Figure 4. Arbuscular mycorrhizal fungi (AMF) composition and relative abundances in Phaseolus vulgaris root determined by a sequencing analysis of mycorrhizal SSU rRNA amplicons. Left, original inoculum obtained from Brachiaria decumbens Stapf (Poaceae). M, arbuscular mycorrhizal fungi inoculation; B2, irrigated with 50 µM riboflavin n; Rt, Rhizobium tropici CIAT 899 inoculation; C, control without inoculation.
Figure 4. Arbuscular mycorrhizal fungi (AMF) composition and relative abundances in Phaseolus vulgaris root determined by a sequencing analysis of mycorrhizal SSU rRNA amplicons. Left, original inoculum obtained from Brachiaria decumbens Stapf (Poaceae). M, arbuscular mycorrhizal fungi inoculation; B2, irrigated with 50 µM riboflavin n; Rt, Rhizobium tropici CIAT 899 inoculation; C, control without inoculation.
Agronomy 13 00876 g004
Table
Table 1. List of arbuscular mycorrhizal fungi (AMF) species contained in the inoculum identified by SSU rRNA sequence analysis.
Table 1. List of arbuscular mycorrhizal fungi (AMF) species contained in the inoculum identified by SSU rRNA sequence analysis.
FamilySpeciesSynonym
ArchaeosporaceaeArchaeospora trappei (R.N. Ames and Linderman) J.B. Morton and D. RedeckerAcaulospora trappei
AcaulosporaceaeAcaulospora sp
GigasporaceaeDentiscutata savannicola (R.A. Herrera and Ferrer) C. Walker and A. SchüßlerGigaspora savannicola; Fuscutata savannicola; Scutellospora savannicola
Gigaspora rosea T.H. Nicolson and N.C. Schenck
Cetraspora pellucida (T.H. Nicolson and N.C. Schenck) Oehl, F.A. Souza and SieverdingScutellospora pellucida
DiversisporaceaeDiversispora varaderana J. Błaszkowski, G. Chwat, Kovács and Góralska
ClaroideoglomeraceaeClaroideoglomus etunicatum (W.N. Becker and Gerd.) C. Walker and A. SchüßlerGlomus etunicatum; Entrophospora etunicata [44]
GlomeraceaeDominikia bernensis Oehl, Palenz., Sánchez-Castro, N.M.F. Sousa and G.A. Silva
Dominikia lithuanica J. Błaszkowski, G. Chwat, A. Góralska
Rhizophagus aggregatus (N.C. Schenck and G.S. Sm.) C. WalkerGlomus aggregatum;
Rhizoglomus aggregatum
Glomus macrocarpum T.H. Nicolson and GerdEndogone macrocarpa
Funneliformis mosseae T.H. Nicolson and Gerd
Kamienskia bistrata J. Błaszkowski, G. Chwat and Kovács
Rhizophagus irregularis Błaszk., Wubet, Renker and Buscot (C. Walker and A. Schüßler comb. Nov)
Rhizophagus neocaledonicus D. Redecker, Crossay and Cilia
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Banuelos, J.; Martínez-Romero, E.; Montaño, N.M.; Camargo-Ricalde, S.L. Rhizobium tropici and Riboflavin Amendment Condition Arbuscular Mycorrhiza Colonization in Phaseolus vulgaris L. Agronomy 2023, 13, 876. https://doi.org/10.3390/agronomy13030876

AMA Style

Banuelos J, Martínez-Romero E, Montaño NM, Camargo-Ricalde SL. Rhizobium tropici and Riboflavin Amendment Condition Arbuscular Mycorrhiza Colonization in Phaseolus vulgaris L. Agronomy. 2023; 13(3):876. https://doi.org/10.3390/agronomy13030876

Chicago/Turabian Style

Banuelos, Jacob, Esperanza Martínez-Romero, Noé Manuel Montaño, and Sara Lucía Camargo-Ricalde. 2023. "Rhizobium tropici and Riboflavin Amendment Condition Arbuscular Mycorrhiza Colonization in Phaseolus vulgaris L." Agronomy 13, no. 3: 876. https://doi.org/10.3390/agronomy13030876

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop