Next Article in Journal
The Evolution of Molecular Genotyping in Plant Breeding
Next Article in Special Issue
Outcrossing Rate and Fruit Yield of Hass Avocado Trees Decline at Increasing Distance from a Polliniser Cultivar
Previous Article in Journal
Metabolomic Analysis of Arabidopsis ost1-4 Mutant Revealed the Cold Response Regulation Mechanisms by OPEN STOMATA 1 (OST1) at Metabolic Level
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 10
10.3390/agronomy13102568
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Flower Visitors, Levels of Cross-Fertilisation, and Pollen-Parent Effects on Fruit Quality in Mango Orchards

by
Wiebke Kämper
1,2,*,
Joel Nichols
2,
Trong D. Tran
3,4,
Christopher J. Burwell
5,6,
Scott Byrnes
5 and
Stephen J. Trueman
1
1
Centre for Planetary Health and Food Security, School of Environment and Science, Griffith University, Nathan, QLD 4111, Australia
2
Functional Agrobiodiversity & Agroecology, Department of Crop Sciences, University of Göttingen, 37077 Göttingen, Germany
3
Centre for Bioinnovation, University of the Sunshine Coast, Sippy Downs, QLD 4556, Australia
4
School of Science, Technology and Engineering, University of the Sunshine Coast, Sippy Downs, QLD 4556, Australia
5
School of Environment and Science, Griffith University, Nathan, QLD 4111, Australia
6
Biodiversity Program, Queensland Museum, South Brisbane, QlD 4101, Australia
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(10), 2568; https://doi.org/10.3390/agronomy13102568
Submission received: 1 September 2023 / Revised: 28 September 2023 / Accepted: 29 September 2023 / Published: 6 October 2023
(This article belongs to the Special Issue Reproductive Biology of Mediterranean, Subtropical and Tropical Crops)
Browse Figures
Versions Notes

Abstract

:
Pollination is essential for the reproductive output of crops. Anthropogenic disturbance and global pollinator decline limit pollination success, reducing the quantity or quality of pollen. Relationships between the abundance of flower visitors and fruit production are often poorly understood. We aimed to (1) identify and quantify flower visitors in a mango orchard; (2) assess how much of the crop resulted from self- versus cross-pollination at increasing distances from a cross-pollen source in large, single-cultivar blocks of the cultivar Kensington Pride or the cultivar Calypso; and (3) determine how pollen parentage affected the size, colour, flavour attributes, and nutritional quality of fruit. Mango flowers were mostly visited by rhiniid flies and coccinellid beetles. Approximately 30% of the fruit were the result of cross-pollination, with the percentage significantly decreasing with an increasing distance from a cross-pollen source in the cultivar Calypso. Self-pollinated Calypso fruit were slightly larger and heavier, with higher acid and total polyphenol concentrations than cross-pollinated fruit. Our results showed higher-than-expected levels of cross-fertilisation among fruit, although self-pollen was likely more abundant than cross-pollen in the large orchard blocks. Our results suggest the preferential cross-fertilisation of flowers or the preferential retention of cross-fertilised fruitlets, both representing strategies for circumventing inbreeding depression. Growers should establish vegetated habitats to support pollinator populations and interplant cultivars more closely to maximise cross-pollen transfer.

1. Introduction

The world population and global food demand continue to rise rapidly, and the projected agricultural production cannot meet the future food demand. Agricultural production often relies on animal pollination [1,2], yet declines in wild bee populations and an under-supply of managed bee hives are placing pressure on pollination services and crop yields [3,4,5,6,7,8]. Human disturbance to the environment is increasingly limiting plant reproduction by reducing the quantity or quality of pollen deposited on flowers [9]. Suboptimal pollination has been identified in many crops, resulting in crop yields that are below the physiological carrying capacity of the plants [10,11]. The reasons for poor pollination and yield include suboptimal weather conditions, insufficient pollinators, and a poor transfer of compatible pollen genotypes during flowering [10,12,13]. Self-incompatible crops require the deposition of genetically different cross-pollen on the stigma for successful reproduction [10,14]. Large, single-cultivar blocks of clonally-propagated tree crops are often favoured by farmers because they simplify farming practices such as irrigation, fertiliser application, and pest, disease, and harvest management, but they also increase the distance between cultivars so that compatible pollen must often travel long distances to the flowers of a different cultivar [15,16].
Many mass-flowering tree crops experience an extensive abscission of flowers and fruitlets within 2–3 weeks after flowering, as well as premature fruit drop in which most of the initially set fruitlets abscise before reaching maturity [13,17,18]. The suspected causes of flower and fruitlet abscission include environmental factors such as suboptimal temperatures, drought, or inadequate pollen deposition, physiological factors such as limited mineral nutrient or carbohydrate supply, and genetic factors such as pollen–pistil incompatibility or early-acting inbreeding depression [17,19,20]. Preferential retention of cross-fertilised fruitlets has been observed in some self-compatible and partially self-incompatible plants, with cross-fertilised fruitlets more likely to be retained until maturity [21,22,23]. Pollen–pistil incompatibility can result in fertilisation failure, while inbreeding depression can result in, for example, embryo deformation or the formation of less vigorous embryos that produce smaller fruit with lower nutritional quality [24,25,26,27,28].
Mango (Mangifera indica L., Anacardiaceae) is a mass-flowering tropical tree from South and Southeast Asia that has a very high flower/fruit ratio 29. Mango flesh is nutrient-rich and a good source of vitamins A and C, potassium, and fibre [30]. Mango flesh is also an excellent source of flavonoids and carotenoids, which reduce the risk of cardiac disease and have anti-cancer and anti-viral properties [30]. Mango pollination can be mediated by animal pollinators including bees and flies [29]. Mango pollinators in Australian orchards have received little attention, but there is some evidence that various fly genera play key roles [31]. Mango fruit can be produced by self-pollination or cross-pollination, with outcrossing rates dependent on the cultivar, but cross-pollination is generally beneficial for fruitlet development [29,31]. Late-acting self-incompatibility has been described for the mango cultivar Ataúlfo, with both self- and cross-pollen tubes entering the embryo sac, though self-pollen produces atrophied embryos that abort or result in malformed fruit [22]. Some self-compatible tropical tree crops such as some avocado cultivars produce fruit by either self-pollination or cross-pollination, but post-zygotic preference is given to cross-pollinated fruitlets, with higher outcrossing rates detected among the mature fruits than the young fruitlets [29,32].
Low fruitlet set and high fruitlet drop have led to low productivity of some mango cultivars. It is unclear whether this low productivity is due to cultivar-specific self-sterility or due to environmental or physiological factors. Here, we identified and quantified flower visitors in an Australian mango orchard and examined the levels of self- and cross-paternity among mature fruit of two cultivars, Kensington Pride and Calypso (Figure 1), that were planted in large, single-cultivar blocks. Specifically, we aimed to (i) identify and quantify flower visitors; (ii) determine the outcrossing rates of the two cultivars at different distances from a cross-pollen source, and (iii) assess the effects of pollen parentage on the size, colour, flavour attributes, and nutritional quality, including the mineral nutrient and polyphenol concentrations, of the fruit. The results of this study will highlight the types of pollinators important for mango fruit production and identify strategies for maximising reproductive output.

2. Results

2.1. Mango Flower Visitors

We observed a total of 715 flower visitors on mango flowers, including 317 Diptera, 288 Coleoptera, 92 Hymenoptera, 11 Lepidoptera, 4 Hemiptera, 2 Mantodea, and 1 Araneae. The most common dipteran family was Rhiniidae (representing 82% of all Diptera visits), with most visits by Stomorhina discolor (Fabricius, 1794). Almost all Coleoptera (99% of all Coleoptera visits) visitors were members of the Coccinellidae family, with most visits by Coccinella transversalis (Fabricius, 1781) (Figure 2). The most common hymenopteran families were Apidae (55% of all Hymenoptera visits) and Formicidae (37% of all Hymenoptera visits).

2.2. Effect of Distance from a Cross-Pollen Source on Paternity

A total of 31 ± 4% of Kensington Pride fruit and 30 ± 4% of Calypso fruit resulted from cross-pollination, respectively, whereas the remainder resulted from self-pollination. Almost all (93%) of the cross-pollinated Kensington Pride fruit were pollinated by Calypso, while 86% and 14% of the cross-pollinated Calypso fruit were pollinated by Kensington Pride and Honey Gold, respectively. The distance from a cross-pollen source did not significantly affect the percentages of self- and cross-pollinated fruit in the cultivar Kensington Pride (Figure 3; F = 0.97, P = 0.43). The percentage of self-pollinated Calypso fruit increased significantly from 49 ± 10% to 84 ± 5% by row 5, i.e., by 45 m from a cross-pollen source (Figure 3, F = 7.57, P = 0.001).

2.3. Effect of Paternity on Fruit Size and Quality

Self-pollinated and cross-pollinated Kensington Pride fruit did not differ significantly in mass, size, Brix value, acidity, the Brix/acid ratio, mineral nutrient concentrations, or total polyphenol concentration (Table 1). The skin of self-pollinated Kensington Pride fruit was slightly darker than the skin of cross-pollinated fruit (F = 5.09, P = 0.03). The self-pollinated Calypso fruit had a 4% higher mass and a 2% greater width than the cross-pollinated fruit (mass: F = 5.07, P = 0.03; width: F = 5.64, P = 0.02), while the brightness, redness and yellowness of the fruit did not differ significantly (Table 1). Self-pollinated and cross-pollinated Calypso fruit did not differ significantly in colour, mineral nutrient concentrations, Brix value, or the Brix/acid ratio, but the self-pollinated Calypso fruit had 10% greater acidity and a 11% higher total polyphenol concentration than the cross-pollinated fruit (Table 1: acidity: F = 5.06, P = 0.03; polyphenol: F = 10.43, P = 0.001).

3. Discussion

Our results show that approximately 30% of both the Kensington Pride and the Calypso fruit resulted from cross-pollination, representing higher-than-expected cross-fertilisation levels among fruit in large, single-cultivar blocks where self-pollen was likely to be much more abundant than cross-pollen. Distance from a cross-pollen source did not significantly affect the percentage of Kensington Pride fruit that were cross-pollinated. However, the percentage of Calypso fruit that were cross-pollinated decreased from 51% at one row from the cross-pollen source to 16% at five rows from the cross-pollen source, suggesting that cross-pollen was not moved effectively by pollinators across this single-cultivar block. The availability of cross-pollen could be improved by interplanting cultivars closely, potentially enhancing pollination efficiency and crop production. The two most common flower visitors included flies of the family Rhiniidae and beetles of the family Coccinellidae. Taking measures to attract diverse and abundant flower visitors, such as maintaining or establishing vegetated habitat, could help to sustainably and ecologically increase crop productivity. Self-pollinated Kensington Pride fruit were slightly darker than cross-pollinated Kensington Pride fruit, while the self-pollinated Calypso fruit were slightly larger and heavier and had higher acid and polyphenol concentrations than the cross-pollinated Calypso fruit.
Cross-pollen was not moved effectively across the single-cultivar Calypso block, with lower percentages of cross-pollinated fruit being found at increasing distances from the cross-pollen source. Limited across-row transport of cross pollen has also been reported in other crops where honeybees and native bees represent the main flower visitors [12,16,33]. However, bees did not dominate the flower visitor community in the mango orchard. Flies were the main flower visitors, with most flies belonging to the family Rhiniidae. The second-most common flower visitors were beetles, with the majority belonging to the family Coccinellidae, which was previously identified as an important visitor taxon for mango and avocado flowers [29,31,34]. Different flower visitor taxa have different inter-plant movement patterns which can affect their capacity to transfer cross-pollen between the trees of different cultivars [35,36]. It has been hypothesised that bees are more likely to forage along rows, while members of the fly families Syrphidae and Calliphoridae have more erratic movement patterns, increasing their likelihood of transferring cross-pollen [35,36,37]. The most abundant fly visitor at our site, Stomorhina discolor, is highly efficient at single-visit pollination (measured as the number of pollen grains deposited during a single visit) for tree crops such as avocado and macadamia [34]. Attempts to increase fly populations have been made by releasing blowflies and flesh flies into mango orchards and by providing material for fly breeding [31,38]. More studies are needed to investigate different flower-visiting taxa for their movement patterns and effectiveness as cross-pollinators in orchards so that measures to enhance insect populations can be targeted at the most effective pollinators.
Mango is an andromonoecius species with either male (i.e., staminate) or hermafroditic flowers [29]. We considered that self-pollen was more available to flowers than cross-pollen regardless of the row location because (1) mango stigmas are receptive during anthesis within individual hermaphroditic flowers, meaning that autogamous self-pollination is possible and not limited by mechanisms such as dichogamy [29]; (2) trees of the same cultivar were planted in wide blocks, with all trees along a row belonging to the same genotype, making the closest neighbouring tree a self-pollen source; and (3) flowering may be more synchronised between trees of the same cultivar than between trees of different cultivars, increasing the likelihood of self-pollen deposition. We found that 51% of the Calypso fruit at one row and 16% of the Calypso fruit at seven rows from the Kensington Pride trees resulted from cross-pollination. We also found that 41% of the Kensington Pride fruit at one row and 27% of the Kensington Pride fruit at eight rows from the Calypso trees resulted from cross-pollination. These percentages were not likely to have reflected the ratio of available self-pollen to cross-pollen, especially in the middle rows of the single-cultivar blocks. The higher-than-expected percentages of cross-pollinated fruit throughout the orchard rows suggest preferential fertilisation by cross-pollen tubes or the preferential retention of cross-fertilised fruitlets. Cross-fertilised fruitlets are retained preferentially on trees of the mango cultivar Osteen [39].
The yields of mango trees might be increased when many flowers on a tree receive cross-pollen, regardless of whether preferential cross-fertilisation of flowers or preferential retention of cross-fertilised fruitlets caused the higher-than-expected outcrossing levels. We did not record tree yields, but fruit set and yield are higher after cross-pollination than self-pollination in many other self-compatible and partially self-incompatible tree crops such as almond, avocado, durian, and macadamia [12,40,41,42]. Row configuration affects the contribution of different pollen parents to the final harvest and can thus affect yield, fruit size, and fruit quality [37]. It is important to interplant trees of different cultivars closely by, for example, planting alternate rows of different cultivars or by planting polliniser trees within rows in crops that benefit from cross-pollination. Mixed cropping of different cultivars, i.e., avoiding the establishment of large blocks of single cultivars, has great potential to enhance the deposition of cross-pollen and provide higher yield and fruit quality [12,16,40,43]. However, the extent to which different cultivars need to be interplanted may depend on the degree to which the crop is dependent on insects to transport pollen and the degree to which the crop is obligately outcrossing [9,44]. Close interplanting of different cultivars has been recommended for almond and macadamia orchards as most cultivars of both crops are bee-pollinated and highly outcrossing [12,15,16,45]. Further research is required to establish the relationships between yield and distance to a different cultivar in mango orchards, especially because the two mango cultivars in the current study clearly displayed a mixed mating system rather than a highly outcrossing system. Mixed cropping of different cultivars can also shape flower visitor communities because the specific floral traits of individual cultivars may attract different species, thereby affecting the abundance and diversity of flower visitors [43,46,47,48,49]. Establishing natural habitat near orchards, including the provision of nesting sites or maintaining within-row vegetation, is beneficial for attracting a diverse flower visitor community [50,51,52]. For instance, the diversity of several fly and bee taxa is greater in orchards with wildflower strips [53,54]. The mango orchard used in this study was surrounded by natural forest on two sides, likely enhancing the abundance and diversity of insect pollinators within the orchard. However, the within-row vegetation was mown regularly, minimising the availability of floral resources within the orchard and thus the orchard’s attractiveness to insect pollinators. Agricultural intensification often leads to the destruction of natural habitat, and natural within-row vegetation is often removed or flower strips are not planted to avoid interference with agricultural practices such as the harvesting of crop from the orchard floor. Agriculture thus often disrupts flower visitor communities even though crop productivity is determined by ecosystem services such as pollination. Little research has focused on how to attract and retain the most efficient flower visitors by, for example, strategically planting the most attractive cultivars, despite this being a promising ecological intensification strategy.
A preference for the cross-fertilisation of flowers or the preferential retention of cross-fertilised fruitlets could be the result of genetic factors such as pre-zygotic or post-zygotic self-incompatibility or, alternatively, physiological factors that determine how maternal resources are allocated among fruitlets within an individual tree. We found that differences in mass, width, brightness, acidity, and total polyphenol concentration between self-pollinated and cross-pollinated fruit of a single cultivar were generally smaller than the differences between the two cultivars in our study or differences between other mango cultivars [55,56]. The effect of different pollen parents on fruit characteristics is termed xenia [57,58]. The effects of xenia have been identified in other single-seeded tree crops such as almond, avocado, and macadamia, typically with cross-pollination providing higher mass or nutrient concentrations than self-pollination [12,26,40,45]. However, we found that the self-pollinated Calypso fruit had higher fruit mass, acidity, and polyphenol concentrations than the cross-pollinated fruit while also having similar mineral nutrient concentrations. Our results, therefore, do not suggest that the higher-than-expected outcrossing levels were the result of preferential resource partitioning to individual cross-fertilised fruitlets.

4. Materials and Methods

4.1. Study Sites and Design

We performed the study, which commenced in August 2019, in a commercial mango orchard (25°8′57″ S, 152°22′32″ E) near Childers, Queensland, Australia. The orchard contained single-cultivar blocks of the cultivars Kensington Pride, Calypso, and Honey Gold. We conducted the study in a 16-row-wide block of Kensington Pride and a 13-row-wide block of Calypso that were planted next to each other (Figure 4). The Kensington Pride and Calypso trees were 6 years old, and the tree spacing was 9 m between rows and 4 m within rows. A block of Honey Gold trees was planted on the other side of a road in 2019, approximately 40 m away. Natural forest surrounded two sides of the orchard (Figure 4). No honeybee (Apis mellifera, Linnaeus, 1758) or stingless bee (Tetragonula spp., Moure, 1961) hives were introduced into the orchard.
We recorded flower visitors and collected fruit from trees along six transects per cultivar. A transect consisted of four trees, starting at a tree bordering the other cultivar (row 1) and then moving away from the other cultivar to trees in rows 3, 5, and the middle row of the block (row 8 for Kensington Pride and row 7 for Calypso). We counted flower visitors that contacted a flower within a 1 m3 quadrat on the illuminated side of each experimental tree in a 5-minute period between 0800 H and 1600 H during peak flowering on three days: 19 August, 21 August, and 23 August 2019. Flower visitors were identified into morphospecies in the field, specimens were collected for each morphospecies, and the specimens were identified further in the laboratory.
We harvested 240 mature Kensington Pride fruit on 7 January 2020 and 240 mature Calypso fruit on 20 January 2020, collecting 10 fruit in a stratified design from each tree, with each tree divided into five sectors on the side of the tree that faced its neighbouring cultivar. Two fruit were sampled per sector: one from the inside and one from the outside of the canopy. The maturity of the fruit on the trees was estimated by cutting off a fruit segment and assessing the colour of the flesh. We rinsed the fruit with detergent for 5 sec, after snapping off the stalk, to avoid sap burn and kept them in the shade until they were moved to a controlled-temperature room (18 °C) in the afternoon of the harvest day where they were stored until ripe. The Kensington Pride and Calypso fruit were ripe after 12.2 ± 0.4 d (mean ± SE) and 11.0 ± 0.3 d, respectively. Ripeness was confirmed by measuring skin firmness, using a handheld sclerometer (8 mm head; Lutron Electronic Model: FR-5120, Coopersburg, PA). Fruit were considered ripe when the maximum force required to impress the sclerometer tip 1 mm deep was <20 N for Kensington Pride and <25 N for Calypso [59,60]. The fresh mass, length, and width of the fruit were measured, before fruit colour was assessed using a CR-10 colorimeter (Konica, Minolta, Chiyoda, Japan). We removed the peel and seed from each fruit and stored a section of approximately 50% of the total flesh at −80 °C. We collected subsamples of the flesh to measure the (i) concentrations of 14 mineral nutrients; (ii) total soluble solid concentration (TSS); (iii) acidity; and (iv) total polyphenol concentration. The seeds were cracked, and a subsample was taken from each embryo for paternity analysis.

4.2. Mineral Nutrients

We determined the concentrations of 14 nutrients from a pooled flesh sample taken from two locations, near the apex and along the equator, of each fruit. The concentrations of nitrogen (N) and carbon (C) were determined by combustion analysis (TruSpec®, LECO Corporation, St. Joseph, MI, USA) [61,62]. The phosphorus (P), potassium (K), aluminium (Al), boron (B), calcium (Ca), copper (Cu), iron (Fe), magnesium (Mg), manganese (Mn), sodium (Na), sulphur (S), and zinc (Zn) concentrations were determined by inductively coupled plasma–atomic emission spectroscopy (Vista Pro®, Varian Incorporation, Palo Alto, CA, USA) after nitric and perchloric acid digestion [63,64].

4.3. TSS and Acidity

We defrosted a subsample from each fruit and manually squeezed a section of approximately one-eighth of the total fruit flesh through filter paper (Whatman Grade 114). We determined the TSS (°Brix) and acidity of the juice using a PAL-BX|ACID15 sugar and acidity meter (Atago, Tokyo, Japan), and we then calculated the Brix/acid ratio for each fruit.

4.4. Total Polyphenol Concentration

We placed a subsample of defrosted flesh sample (0.6 g wet mass) in a 50 mL Falcon tube and added 6 mL of deionised water. We incubated the samples for 30 min and blended them at 8000–15,000 rpm for approximately 30 sec, using an IKA Ultra Turrax T25 (IKA, Staufen, Germany) with an 18 mm disperser to break down pulp cells and release polyphenols into the solution. We spun the samples at 3200 rpm for 10 min to clear the solution of particulate matter for colorimetric analysis using a Discrete Chemical Analyzer (Thermo Scientific, Waltham, MA, USA), adopting the Folin–Ciocalteu method. We used sample extract (50 μL), Folin–Ciocalteau reagent (50 μL), and 10% sodium carbonate (200 μL) for the colorimetric analysis and compared the results with standard gallic acid solutions in the range of 0–250 μg/mL at a wavelength of 700 nm.

4.5. Paternity

DNA extraction followed the protocol for glass-fibre plate extraction [65]. Seeds of the polyembryonic cultivar Kensington Pride contained a mean ± SE of 6.6 ± 0.8 embryos, of which at least one was a true sexual embryo and the others were nucellar (asexual) embryos. We analysed subsamples of 10–15 mg that comprised a maximum of three embryos, and this required a maximum of four subsamples per fruit. We performed DNA extraction and paternity testing on each subsample. A single subsample of ~50 mg was used for the monoembryonic cultivar Calypso. The extracted DNA was amplified at eight microsatellite loci [66,67,68]. The 5′ end of each forward primer was fluorescently labelled (Table 2). We performed two multiplex PCRs per DNA extract, using the Qiagen Type-it Microsatellite PCR Kit (Qiagen, Hilden, Germany). The reactions were performed in 12.5 μL reaction volumes containing approximately 20 ng of DNA template, 5.6 μL of Type-it Multiplex PCR Master Mix, 2 μM of each primer, and 3.6 μL of RNase-free water. PCR was performed with initial denaturation at 95 °C for 5 min, followed by 32 cycles of 95 °C for 30 s, 57 °C for 90 s, and 72 °C for 30 s, followed by final elongation at 60 °C for 30 min.
We generated genotypes using a 3130xl Genetic Analyser (Applied Biosystems, Foster City, CA, USA), and allele sizes were scored relative to an internal standard (600 LIZ® Size Standard, Applied Biosystems) using the software, GeneMarker version 2.6.3 (SoftGenetics, State College, PA, USA). We assigned the pollen parent of each Kensington Pride fruit manually. We considered a fruit cross-pollinated if an allele that only occurred in a cross-pollen parent was detected in at least one subsample of that fruit. The pollen parent of the Calypso fruit was assigned using the software CERVUS version 3.0.7 [69]. We only considered pollen parents possible if CERVUS assigned a positive logarithm of odds (LOD) score. We only assigned a specific pollen parent if, additionally, the best match met the 95% strict-confidence level. Simulations of paternity were run using the following parameters: a proportion of mistyped loci of 0.01, a proportion of candidate fathers sampled at 0.99, and offspring simulated at 100,000.

4.6. Statistical Analyses

We calculated the proportions of self-pollinated and cross-pollinated fruit for each tree. We used a one-way analysis of variance (ANOVA) to test whether the distance from a cross-pollen source (measured as the number of rows) affected the proportions of self-pollinated and cross-pollinated fruit. We performed Tukey’s HSD tests when differences were detected (using the R package ”agricolae”). We used linear mixed models, considering the tree number and transect as random effects to compare size and nutritional quality between self-pollinated and cross-pollinated fruit (using the R package “lmerTest”). Specifically, we compared the mass, length, width, colour (L*: brightness, a*: redness, and b*: yellowness), nutrient concentrations (C, N, Al, B, Ca, Cu, Fe, K, Mg, Mn, Na, P, S and Zn), Brix value, acidity, Brix/acid ratio, and polyphenol concentrations between self-pollinated and cross-pollinated fruit.

5. Conclusions

In conclusion, the main visitors to mango flowers were rhiniid flies and coccinellid beetles. Most fruit resulted from self-pollination. The outcrossing levels of approximately 30% were higher than expected in the large, single-cultivar blocks where self-pollen was likely to be much more abundant than cross-pollen. These higher-than-expected cross-fertilisation levels could be the result of strategies to circumvent inbreeding depression such as the preferential cross-fertilisation of flowers or the preferential retention of cross-fertilised fruitlets. We recommend mixed cropping utilising different cultivars to maximise (1) cross-pollen deposition and (2) the attractiveness of orchards to a diverse flower-visitor community. We further recommend that growers maintain or establish vegetated habitat within and around orchards to support diverse and abundant flower-visitor communities.

Author Contributions

Conceptualization: W.K., S.J.T.; data curation: W.K.; formal analysis: W.K., J.N. and C.J.B.; funding acquisition: S.J.T.; investigation: W.K., J.N. and C.J.B.; methodology: W.K., J.N., T.D.T., C.J.B. and S.B.; project administration: W.K. and S.J.T.; validation: W.K.; visualization: WK; writing—original draft: W.K. and J.N.; writing—review and editing: T.D.T., C.J.B. and S.J.T. All authors have read and agreed to the published version of the manuscript.

Funding

This project was supported by Project PH16001 of the Hort Frontiers Pollination Fund, part of the Hort Frontiers strategic partnership initiative developed by Hort Innovation, with co-investment from Griffith University, University of the Sunshine Coast, Plant & Food Research Ltd, and contributions from the Australian Government.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author and with the permission of Hort Innovation.

Acknowledgments

We thank Adam Kent from Simpson Farms for advice and access to the farm.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Klein, A.-M.; Vaissière, B.E.; Cane, J.H.; Steffan-Dewenter, I.; Cunningham, S.A.; Kremen, C.; Tscharntke, T. Importance of pollinators in changing landscapes for world crops. Proc. R. Soc. B 2007, 274, 303–313. [Google Scholar] [CrossRef] [PubMed]
  2. Ricketts, T.H.; Regetz, J.; Steffan-Dewenter, I.; Cunningham, S.A.; Kremen, C.; Bogdanski, A.; Gemmill-Herren, B.; Greenleaf, S.S.; Klein, A.M.; Mayfield, M.M. Landscape effects on crop pollination services: Are there general patterns? Ecol. Lett. 2008, 11, 499–515. [Google Scholar] [CrossRef]
  3. Aizen, M.A.; Harder, L.D. The global stock of domesticated honey bees is growing slower than agricultural demand for pollination. Curr. Biol. 2009, 19, 915–918. [Google Scholar] [CrossRef] [PubMed]
  4. Gallai, N.; Salles, J.-M.; Settele, J.; Vaissière, B.E. Economic valuation of the vulnerability of world agriculture confronted with pollinator decline. Ecol. Econ. 2009, 68, 810–821. [Google Scholar] [CrossRef]
  5. Klein, A.M.; Boreux, V.; Fornoff, F.; Mupepele, A.C.; Pufal, G. Relevance of wild and managed bees for human well-being. Curr. Opin. Insect Sci. 2018, 26, 82–88. [Google Scholar] [CrossRef] [PubMed]
  6. Patel, V.; Pauli, N.; Biggs, E.; Barbour, L.; Boruff, B.J. Why bees are critical for achieving sustainable development. Ambio 2020, 50, 49–59. [Google Scholar] [CrossRef] [PubMed]
  7. Potts, S.G.; Imperatriz-Fonseca, V.; Ngo, H.T.; Aizen, M.A.; Biesmeijer, J.C.; Breeze, T.D.; Dicks, L.V.; Garibaldi, L.A.; Hill, R.; Settele, J.; et al. Safeguarding pollinators and their values to human well-being. Nature 2016, 540, 220–229. [Google Scholar] [CrossRef]
  8. Mashilingi, S.K.; Zhang, H.; Garibaldi, L.A.; An, J. Honeybees are far too insufficient to supply optimum pollination services in agricultural systems worldwide. Agric. Ecosyst. Environ. 2022, 335, 108003. [Google Scholar] [CrossRef]
  9. Bennett, J.M.; Steets, J.A.; Burns, J.H.; Burkle, L.A.; Vamosi, J.C.; Wolowski, M.; Arceo-Gómez, G.; Burd, M.; Durka, W.; Ellis, A.G.; et al. Land use and pollinator dependency drives global patterns of pollen limitation in the Anthropocene. Nat. Commun. 2020, 11, 3999. [Google Scholar] [CrossRef]
  10. Aizen, M.A.; Harder, L.D. Expanding the limits of the pollen-limitation concept: Effects of pollen quantity and quality. Ecology 2007, 88, 271–281. [Google Scholar] [CrossRef]
  11. Garratt, M.P.D.; de Groot, G.A.; Albrecht, M.; Bosch, J.; Breeze, T.D.; Fountain, M.T.; Klein, A.M.; McKerchar, M.; Park, M.; Paxton, R.J.; et al. Opportunities to reduce pollination deficits and address production shortfalls in an important insect-pollinated crop. Ecol. Appl. 2021, 31, e02445. [Google Scholar] [CrossRef] [PubMed]
  12. Trueman, S.J.; Kämper, W.; Nichols, J.; Ogbourne, S.M.; Hawkes, D.; Peters, T.; Hosseini Bai, S.; Wallace, H.M. Pollen limitation and xenia effects in a cultivated mass-flowering tree, Macadamia integrifolia (Proteaceae). Ann. Bot. 2022, 129, 135–146. [Google Scholar] [CrossRef] [PubMed]
  13. Racskó, J.; Leite, G.B.; Petri, J.L.; Zhongfu, S.; Wang, Y.; Szabó, Z.; Soltész, M.; Nyéki, J. Fruit drop: The role of inner agents and environmental factors in the drop of flowers and fruits. Int. J. Hortic. Sci. 2007, 13, 13–23. [Google Scholar] [CrossRef]
  14. Fujii, S.; Kubo, K.-I.; Takayama, S. Non-self-and self-recognition models in plant self-incompatibility. Nat. Plants 2016, 2, 1–9. [Google Scholar] [CrossRef] [PubMed]
  15. Richards, T.E.; Kämper, W.; Trueman, S.J.; Wallace, H.M.; Ogbourne, S.M.; Brooks, P.R.; Nichols, J.; Hosseini Bai, S. Relationships between nut size, kernel quality, nutritional composition and levels of outcrossing in three macadamia cultivars. Plants 2020, 9, 228. [Google Scholar] [CrossRef]
  16. Kämper, W.; Trueman, S.J.; Ogbourne, S.M.; Wallace, H.M. Pollination services in a macadamia cultivar depend on across-orchard transport of cross pollen. J. Appl. Ecol. 2021, 58, 2529–2539. [Google Scholar] [CrossRef]
  17. Stephenson, A. Flower and fruit abortion: Proximate causes and ultimate functions. Annu. Rev. Ecol. Evol. Syst. 1981, 12, 253–279. [Google Scholar] [CrossRef]
  18. Li, C.; Wang, Y.; Huang, X.; Li, J.; Wang, H.; Li, J. An improved fruit transcriptome and the identification of the candidate genes involved in fruit abscission induced by carbohydrate stress in litchi. Front. Plant Sci. 2015, 6, 439. [Google Scholar] [CrossRef]
  19. Herbert, S.W.; Walton, D.A.; Wallace, H.M. The influence of pollen-parent and carbohydrate availability on macadamia yield and nut size. Sci. Hortic. 2019, 251, 241–246. [Google Scholar] [CrossRef]
  20. Trueman, S.J.; Turnbull, C.G.N. Fruit set, abscission and dry matter accumulation on girdled branches of macadamia. Ann. Bot. 1994, 74, 667–674. [Google Scholar] [CrossRef]
  21. Alcaraz, M.; Hormaza, J. Influence of physical distance between cultivars on yield, outcrossing rate and selective fruit drop in avocado (Persea americana, Lauraceae). Ann. Appl. Biol. 2011, 158, 354–361. [Google Scholar] [CrossRef]
  22. Gehrke-Velez, M.; Castillo, A.; Ruiz-Bello, C.; Moreno-Martinez, J.L.; Moreno-Basurto, G. Delayed self-incompatibility causes morphological alterations and crop reduction in ‘Ataúlfo’ mango (Mangifera indica L.). N. Z. J. Crop Hortic. Sci. 2012, 40, 215–227. [Google Scholar] [CrossRef]
  23. Vaughton, G.; Carthew, S.M. Evidence for selective fruit abortion in Banksia spinulosa (Proteaceae). Biol. J. Linn. Soc. 2008, 50, 35–46. [Google Scholar] [CrossRef]
  24. Dutta, S.; Srivastav, M.; Rymbai, H.; Chaudhary, R.; Singh, A.; Dubey, A.; Lal, K. Pollen–pistil interaction studies in mango (Mangifera indica L.) cultivars. Sci. Hortic. 2013, 160, 213–221. [Google Scholar] [CrossRef]
  25. Isaacs, R.; Kirk, A.K. Pollination services provided to small and large highbush blueberry fields by wild and managed bees. J. Appl. Ecol. 2010, 47, 841–849. [Google Scholar] [CrossRef]
  26. Brittain, C.; Kremen, C.; Garber, A.; Klein, A.-M. Pollination and plant resources change the nutritional quality of almonds for human health. PLoS ONE 2014, 9, e90082. [Google Scholar] [CrossRef] [PubMed]
  27. Gibbs, P.E. Late-acting self-incompatibility—The pariah breeding system in flowering plants. New Phytol. 2014, 203, 717–734. [Google Scholar] [CrossRef] [PubMed]
  28. Charlesworth, B.; Charlesworth, D. The genetic basis of inbreeding depression. Genet. Res. 1999, 74, 329–340. [Google Scholar] [CrossRef]
  29. Ramírez, F.; Davenport, T.L. Mango (Mangifera indica L.) pollination: A review. Sci. Hortic. 2016, 203, 158–168. [Google Scholar] [CrossRef]
  30. Evans, E.A.; Ballen, F.H.; Siddiq, M. Handbook of Mango Fruit: Production, Postharvest Science, Processing Technology and Nutrition; Siddiq, M., Brecht, J.K., Sidhu, J.S., Eds.; John Wiley & Sons Ltd.: Oxford, UK, 2017; pp. 1–16. [Google Scholar] [CrossRef]
  31. Cook, D.F.; Voss, S.C.; Finch, J.T.D.; Rader, R.C.; Cook, J.M.; Spurr, C.J. The role of flies as pollinators of horticultural crops: An Australian case study with worldwide relevance. Insects 2020, 11, 341. [Google Scholar] [CrossRef]
  32. Degani, C.; El-Batsri, R.; Gazit, S. Outcrossing rate, yield, and selective fruit abscission in ‘Ettinger’ and ‘Ardith’ avocado plots. J. Am. Soc. Hortic. Sci. Jashs 1997, 122, 813–817. [Google Scholar] [CrossRef]
  33. Sapir, G.; Baras, Z.; Azmon, G.; Goldway, M.; Shafir, S.; Allouche, A.; Stern, E.; Stern, R.A. Synergistic effects between bumblebees and honey bees in apple orchards increase cross pollination, seed number and fruit size. Sci. Hortic. 2017, 219, 107–117. [Google Scholar] [CrossRef]
  34. Willcox, B.K.; Howlett, B.G.; Robson, A.J.; Cutting, B.; Evans, L.; Jesson, L.; Kirkland, L.; Jean-Meyzonnier, M.; Potdevin, V.; Saunders, M.E.; et al. Evaluating the taxa that provide shared pollination services across multiple crops and regions. Sci. Rep. 2019, 9, 13538. [Google Scholar] [CrossRef]
  35. Raguso, R.A. Don’t forget the flies: Dipteran diversity and its consequences for floral ecology and evolution. Appl. Entomol. Zool. 2020, 55, 1–7. [Google Scholar] [CrossRef]
  36. Brittain, C.; Williams, N.; Kremen, C.; Klein, A.-M. Synergistic effects of non-Apis bees and honey bees for pollination services. Proc. R. Soc. B Biol. Sci. 2013, 280, 20122767. [Google Scholar] [CrossRef]
  37. MacInnis, G.; Forrest, J.R.K. Field design can affect cross-pollination and crop yield in strawberry (Fragaria x ananassa D.). Agric. Ecosyst. Environ. 2020, 289, 106738. [Google Scholar] [CrossRef]
  38. Sharma, S.; Abbas, S.; Shukia, R.; Sharma, S. An easy and quick method of breeding flies for pollination of mango blossoms. Insect Environ. 1998, 4, 76–77. [Google Scholar]
  39. Pérez, V.; Herrero, M.; Hormaza, J. Self-fertility and preferential cross-fertilization in mango (Mangifera indica). Sci. Hortic. 2016, 213, 373–378. [Google Scholar] [CrossRef]
  40. Kämper, W.; Ogbourne, S.M.; Hawkes, D.; Trueman, S.J. SNP markers reveal relationships between fruit paternity, fruit quality and distance from a cross-pollen source in avocado orchards. Sci. Rep. 2021, 11, 20043. [Google Scholar] [CrossRef] [PubMed]
  41. Sáez, A.; Aizen, M.A.; Medici, S.; Viel, M.; Villalobos, E.; Negri, P. Bees increase crop yield in an alleged pollinator-independent almond variety. Sci. Rep. 2020, 10, 3177. [Google Scholar] [CrossRef] [PubMed]
  42. Wayo, K.; Phankaew, C.; Stewart, A.B.; Bumrungsri, S. Bees are supplementary pollinators of self-compatible chiropterophilous durian. J. Trop. Ecol. 2018, 34, 41–52. [Google Scholar] [CrossRef]
  43. Eeraerts, M. Increasing wild bee richness and abundance on sequentially flowering cultivars of a pollinator-dependent crop. Agric. Ecosyst. Environ. 2022, 325, 107745. [Google Scholar] [CrossRef]
  44. Sedgley, M.; Bell, F.D.H.; Bell, D.; Winks, C.W.; Pattison, S.J.; Hancock, T.W. Self- and cross-compatibility of macadamia cultivars. J. Hortic. Sci. 1990, 65, 205–213. [Google Scholar] [CrossRef]
  45. Kämper, W.; Thorp, G.; Wirthensohn, M.; Brooks, P.; Trueman, S.J. Pollen paternity can affect kernel size and nutritional composition of self-incompatible and new self-compatible almond cultivars. Agronomy 2021, 11, 326. [Google Scholar] [CrossRef]
  46. Kremen, C.; Miles, A. Ecosystem services in biologically diversified versus conventional farming systems: Benefits, externalities, and trade-offs. Ecol. Soc. 2012, 17, 40. [Google Scholar] [CrossRef]
  47. Prasifka, J.R.; Mallinger, R.E.; Portlas, Z.M.; Hulke, B.S.; Fugate, K.K.; Paradis, T.; Hampton, M.E.; Carter, C.J. Using nectar-related traits to enhance crop-pollinator interactions. Front. Plant Sci. 2018, 9, 812. [Google Scholar] [CrossRef] [PubMed]
  48. Erickson, E.; Junker, R.R.; Ali, J.G.; McCartney, N.; Patch, H.M.; Grozinger, C.M. Complex floral traits shape pollinator attraction to ornamental plants. Ann. Bot. 2022, mcac082, 1–17. [Google Scholar] [CrossRef]
  49. Järvinen, A.; Himanen, S.J.; Raiskio, S.; Hyvönen, T. Intercropping of insect-pollinated crops supports a characteristic pollinator assemblage. Agric. Ecosyst. Environ. 2022, 332, 107930. [Google Scholar] [CrossRef]
  50. Alomar, D.; González-Estévez, M.A.; Traveset, A.; Lázaro, A. The intertwined effects of natural vegetation, local flower community, and pollinator diversity on the production of almond trees. Agric. Ecosyst. Environ. 2018, 264, 34–43. [Google Scholar] [CrossRef]
  51. Ferreira, J.V.A.; Storck-Tonon, D.; Ramos, A.W.P.; Costa, H.C.M.; Nogueira, D.S.; Mahlmann, T.; Oliveira, M.L.; Pereira, M.J.B.; da Silva, D.J.; Peres, C.A. Critical role of native forest and savannah habitats in retaining neotropical pollinator diversity in highly mechanized agricultural landscapes. Agric. Ecosyst. Environ. 2022, 338, 108084. [Google Scholar] [CrossRef]
  52. Campbell, A.J.; Wilby, A.; Sutton, P.; Wäckers, F.L. Do sown flower strips boost wild pollinator abundance and pollination services in a spring-flowering crop? A case study from UK cider apple orchards. Agric. Ecosyst. Environ. 2017, 239, 20–29. [Google Scholar] [CrossRef]
  53. McKerchar, M.; Potts, S.G.; Fountain, M.T.; Garratt, M.P.D.; Westbury, D.B. The potential for wildflower interventions to enhance natural enemies and pollinators in commercial apple orchards is limited by other management practices. Agric. Ecosyst. Environ. 2020, 301, 107034. [Google Scholar] [CrossRef]
  54. Carvell, C.; Mitschunas, N.; McDonald, R.; Hulmes, S.; Hulmes, L.; O’Connor, R.S.; Garratt, M.P.D.; Potts, S.G.; Fountain, M.T.; Sadykova, D.; et al. Establishment and management of wildflower areas for insect pollinators in commercial orchards. Basic. Appl. Ecol. 2022, 58, 2–14. [Google Scholar] [CrossRef]
  55. Lee, F.Y.; Vo, G.T.; Barrow, C.J.; Dunshea, F.R.; Suleria, H.A.R. Mango rejects and mango waste: Characterization and quantification of phenolic compounds and their antioxidant potential. J. Food Process. Preserv. 2021, 45, e15618. [Google Scholar] [CrossRef]
  56. Manthey, J.A.; Perkins-Veazie, P. Influences of harvest date and location on the levels of beta-carotene, ascorbic acid, total phenols, the in vitro antioxidant capacity, and phenolic profiles of five commercial varieties of mango (Mangifera indica L.). J. Agric. Food Chem. 2009, 57, 10825–10830. [Google Scholar] [CrossRef] [PubMed]
  57. Denney, J.O. Xenia includes metaxenia. HortScience 1992, 27, 722–728. [Google Scholar] [CrossRef]
  58. Liu, Y. Darwin’s pangenesis and certain anomalous phenomena. Adv. Genet. 2018, 102, 93–120. [Google Scholar] [CrossRef]
  59. Flitsanov, U.; Mizrach, A.; Liberzon, A.; Akerman, M.; Zauberman, G. Measurement of avocado softening at various temperatures using ultrasound. Postharvest Biol. Technol. 2000, 20, 279–286. [Google Scholar] [CrossRef]
  60. Hofman, P.; Bower, J.; Woolf, A. Harvesting, packing, postharvest technology, transport and processing. In The Avocado: Botany, Production and Uses; Schaffer, B., Wolstenholme, B.N., Whiley, A.W., Eds.; CABI: Boston, MA, USA, 2013; pp. 489–540. [Google Scholar]
  61. McGeehan, S.L.; Naylor, D.V. Automated instrumental analysis of carbon and nitrogen in plant and soil samples. Commun. Soil. Sci. Plant Anal. 1988, 19, 493–505. [Google Scholar] [CrossRef]
  62. Rayment, G.E.; Higginson, F.R. Australian Laboratory Handbook of Soil and Water Chemical Methods; Inkata: Melbourne, Australia, 1992. [Google Scholar]
  63. Munter, R.; Grande, R. Developments in Atomic Plasma Spectrochemical Analysis; Byrnes, R., Ed.; Heyden: London, UK, 1981; pp. 653–672. [Google Scholar]
  64. Martinie, G.D.; Schilt, A.A. Wet oxidation efficiencies of perchloric acid mixtures for various organic substances and the identities of residual matter. Anal. Chem. 1976, 48, 70–74. [Google Scholar] [CrossRef]
  65. Ivanova, N.V.; Fazekas, A.J.; Hebert, P.D.N. Semi-automated, membrane-based protocol for DNA isolation from plants. Plant Mol. Biol. Report. 2008, 26, 186. [Google Scholar] [CrossRef]
  66. Viruel, M.; Escribano, P.; Barbieri, M.; Ferri, M.; Hormaza, J. Fingerprinting, embryo type and geographic differentiation in mango (Mangifera indica L., Anacardiaceae) with microsatellites. Mol. Breed. 2005, 15, 383–393. [Google Scholar] [CrossRef]
  67. Schnell, R.J.; Olano, C.T.; Qunitanilla, W.E.; Meerow, A.W. Isolation and characterization of 15 microsatellite loci from mango (Mangifera indica L.) and cross-species amplification in closely related taxa. Mol. Ecol. Notes 2005, 5, 625–627. [Google Scholar] [CrossRef]
  68. Honsho, C.; Nishiyama, K.; Eiadthong, W.; Yonemori, K. Isolation and characterization of new microsatellite markers in mango (Mangifera indica). Mol. Ecol. Notes 2005, 5, 152–154. [Google Scholar] [CrossRef]
  69. Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [PubMed]
Agronomy 13 02568 g001
Figure 1. Mature fruit of the mango cultivars (A) Kensington Pride and (B) Calypso.
Figure 1. Mature fruit of the mango cultivars (A) Kensington Pride and (B) Calypso.
Agronomy 13 02568 g001
Agronomy 13 02568 g002
Figure 2. Number of flower visitors on (A) Kensington Pride and (B) Calypso mango flowers, recorded as the mean of three 5-minute periods in a 1 m3 section during three days at peak flowering (n = 72). Boxes around the y-axis labels indicate the family affiliation of each flower visitor species. Medians are presented with the 25th and 75th percentiles (boxes), maxima (whiskers), and outliers.
Figure 2. Number of flower visitors on (A) Kensington Pride and (B) Calypso mango flowers, recorded as the mean of three 5-minute periods in a 1 m3 section during three days at peak flowering (n = 72). Boxes around the y-axis labels indicate the family affiliation of each flower visitor species. Medians are presented with the 25th and 75th percentiles (boxes), maxima (whiskers), and outliers.
Agronomy 13 02568 g002
Agronomy 13 02568 g003
Figure 3. Percentages of self-pollinated and cross-pollinated (a) Kensington Pride and (b) Calypso mango fruit at different numbers of rows from a cross-pollen source. Fruit were sampled along transects, starting at trees adjacent to another cultivar (Row 1) and ending in the middle row of a single-cultivar block (Row 7 or 8). Means (+SEs) for cross-parentage with different letters between rows within a cultivar are significantly different (determined via a one-way ANOVA and Tukey’s HSD test; p ≤ 0.05, n = 6).
Figure 3. Percentages of self-pollinated and cross-pollinated (a) Kensington Pride and (b) Calypso mango fruit at different numbers of rows from a cross-pollen source. Fruit were sampled along transects, starting at trees adjacent to another cultivar (Row 1) and ending in the middle row of a single-cultivar block (Row 7 or 8). Means (+SEs) for cross-parentage with different letters between rows within a cultivar are significantly different (determined via a one-way ANOVA and Tukey’s HSD test; p ≤ 0.05, n = 6).
Agronomy 13 02568 g003
Agronomy 13 02568 g004
Figure 4. Mango orchard with a 16-row-wide block of Kensington Pride trees and a 13-row-wide block of Calypso trees planted next to each other. (A) The border between the cultivars and (B) an example of transects in Kensington Pride (‘X1’) and Calypso (‘X2’), respectively; the Honey Gold block is shown on the other side of a road. Natural forest surrounded the orchard along its eastern and southern boundaries.
Figure 4. Mango orchard with a 16-row-wide block of Kensington Pride trees and a 13-row-wide block of Calypso trees planted next to each other. (A) The border between the cultivars and (B) an example of transects in Kensington Pride (‘X1’) and Calypso (‘X2’), respectively; the Honey Gold block is shown on the other side of a road. Natural forest surrounded the orchard along its eastern and southern boundaries.
Agronomy 13 02568 g004
Table 1. Size, colour, and nutritional quality (mean ± SE) of self-pollinated and cross-pollinated Kensington Pride and Calypso mango fruit.
Table 1. Size, colour, and nutritional quality (mean ± SE) of self-pollinated and cross-pollinated Kensington Pride and Calypso mango fruit.
Kensington PrideCalypso
Self-PollinatedSelf-PollinatedSelf-PollinatedCross-Pollinated
Mass (g)387 ± 36386 ± 46397 ± 23 a379 ± 17 b
Length (mm)108.4 ± 4110.2 ± 698.1 ± 296.9 ± 2
Width (mm)85.3 ± 3.184.7 ± 3.290.2 ± 1.7 a88.2 ± 1.4 b
Brightness (L*)64.5 ± 1.3 a65.7 ± 1.7 b56.6 ± 2.156.0 ± 2.5
Redness (a*)6.92 ± 3.45.44 ± 3.334.5 ± 3.836.2 ± 4.7
Yellowness (b*)43.6 ± 2.245.1 ± 2.230.3 ± 2.729.3 ± 3.87
C (%)6.73 ± 0.316.84 ± 0.257.08 ± 0.286.84 ± 0.24
N (%)0.14 ± 0.030.13 ± 0.010.11 ± 0.010.11 ± 0.03
Al (mg/kg)0.51 ± 0.190.51 ± 0.280.45 ± 0.140.48 ± 0.11
B (mg/kg)2.12 ± 0.162.16 ± 0.271.96 ± 0.221.94 ± 0.16
Ca (mg/kg)150 ± 19139 ± 17163 ± 17158 ± 19
Cu (mg/kg)1.34 ± 0.091.45 ± 0.141.04 ± 0.101.02 ± 0.13
Fe (mg/kg)6.47 ± 1.725.71 ± 1.615.33 ± 1.165.52 ± 1.33
K (mg/kg)1911 ± 1211928 ± 2201620 ± 1141607 ± 140
Mg (mg/kg)122 ± 10118 ± 9103 ± 8100 ± 6
Mn (mg/kg)4.08 ± 0.603.94 ± 0.485.34 ± 0.845.18 ± 1.01
Na (mg/kg)5.74 ± 1.84.23 ± 1.113.3 ± 3.614.7 ± 2.4
P (mg/kg)166 ± 13168 ± 20136 ± 19132 ± 12
S (mg/kg)77.6 ± 15.476.9 ± 16.770.1 ± 14.770.1 ± 8.8
Zn (mg/kg)1.12 ± 0.261.00 ± 0.260.72 ± 0.140.83 ± 0.19
TSS (Brix)14.0 ± 0.514.0 ± 0.414.1 ± 0.514.0 ± 0.4
Acidity (mg/g)0.63 ± 0.070.63 ± 0.100.44 ± 0.04 a0.40 ± 0.06 b
Brix:acid ratio24.3 ± 2.623.9 ± 3.434.4 ± 3.137.7 ± 4.7
Polyphenols *13.1 ± 0.912.8 ± 1.210.7 ± 0.7 a9.7 ± 0.7 b
Means ± SEs with different letters and bold font within a cultivar are significantly different between self- and cross-pollinated fruit (mixed model; p ≤ 0.05; n = 24). * Total polyphenol concentration expressed as mg of gallic acid equivalent/100 g fresh mass.
Table 2. Characterisation of eight polymorphic microsatellite loci used to determine the paternity of mango fruit [65,66,67].
Table 2. Characterisation of eight polymorphic microsatellite loci used to determine the paternity of mango fruit [65,66,67].
LocusAccession NumberPrimer Sequences (5’ to 3’)Repeat MotifFluorescent LabelAllele
Sizes
LMMA1AY628373F: ATGGAGACTAGAATGTACAGAG(GA)13PET195–207
R: ATTAAATCTCGTCCACAAGT
LMMA8AY628380F: CATGGAGTTGTGATACCTAC(GA)12FAM252–271
R: CAGAGTTAGCCATATAGAGTG
LMMA10AY628382F: TTCTTTAGACTAAGAGCACATT(GA)10NED147–191
R: AGTTACAGATCTTCTCCAATT
LMMA11AY628383F: ATTATTTACCCTACAGAGTGC(GA)12VIC234–244
R: GTATTATCGGTAATGTCTTCAT
LMMA12AY628384F: AAAGATAGCATTTAATTAAGGA(GA)13FAM198–206
R: GTAAGTATCGCTGTTTGTTATT
MiSHRS-18AY942819F: AAACGAGGAAACAGAGCAC(AAC/GTT)8FAM90–111
R: CAAGTACCTGCTGCAACTAG
MiSHRS-39AY942829F: GAACGAGAAATCGGGAAC(GTT/AAC)8FAM348–369
R: GCAGCCATTGAATACAGAG
MIAC-5AB190348F: AATTATCCTATCCCTCGTATC(ACACACAT)3VIC119–139
R: AGAAACATGATGTGAACC(ACACACACAT)3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kämper, W.; Nichols, J.; Tran, T.D.; Burwell, C.J.; Byrnes, S.; Trueman, S.J. Flower Visitors, Levels of Cross-Fertilisation, and Pollen-Parent Effects on Fruit Quality in Mango Orchards. Agronomy 2023, 13, 2568. https://doi.org/10.3390/agronomy13102568

AMA Style

Kämper W, Nichols J, Tran TD, Burwell CJ, Byrnes S, Trueman SJ. Flower Visitors, Levels of Cross-Fertilisation, and Pollen-Parent Effects on Fruit Quality in Mango Orchards. Agronomy. 2023; 13(10):2568. https://doi.org/10.3390/agronomy13102568

Chicago/Turabian Style

Kämper, Wiebke, Joel Nichols, Trong D. Tran, Christopher J. Burwell, Scott Byrnes, and Stephen J. Trueman. 2023. "Flower Visitors, Levels of Cross-Fertilisation, and Pollen-Parent Effects on Fruit Quality in Mango Orchards" Agronomy 13, no. 10: 2568. https://doi.org/10.3390/agronomy13102568

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop