Functional Analysis of ScABI3 from Syntrichia caninervis Mitt. in Medicago sativa L.

Abstract

ABI3 (ABSCISIC ACID INSENSITIVE 3) is a family of B3 transcription factors essential for regulating the abscisic acid (ABA) signaling pathway involved in various biological processes and abiotic stress. Our previous studies demonstrated that ectopic expression of ScABI3 from a desiccation-tolerant moss (Syntrichia caninervis) into Arabidopsis thaliana enhanced abiotic stress tolerance. However, studies on plant transformation using the ABI3 gene are limited and other possible functions of ScABI3 are not known. Here, we transformed the ScABI3 into alfalfa (Medicago sativa L.) and analyzed the effects on phenotype, photosynthetic efficiency, and nutritional quality. The results showed that the endogenous ABA content of the transgenic plants was significantly higher than WT, and the leaf-stem ratio, leaf area, and branch number increased with ScABI3 overexpression in alfalfa. Further analysis of the gas exchange parameters showed that the net photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr), and water-use efficiency (WUE) of the transgenic alfalfa were significantly higher than WT; meanwhile, the protein content of the transgenic lines was higher than the WT, but the crude fat content was lower. Thus, these findings suggest that ScABI3 can be used as a potential candidate gene to manipulate alfalfa’s growth and nutritional quality. This study will provide a theoretical basis for breeding alfalfa varieties and assist in forage production and animal husbandry in the future.

1. Introduction

Alfalfa (Medicago sativa L.) is a perennial herbaceous legume mainly distributed in the arid and semi-arid regions. It is one of the world’s most important forage species with vast economic importance due to its high nutritional quality, yield, and adaptability [1,2,3]. In addition, alfalfa, via biological nitrogen fixation, improves soil properties and supports subsequent crops [4]. Therefore, alfalfa is a potential bioenergy crop with commercial value [5,6]. However, the obligate outcrossing and autotetraploid character (2n = 4x = 32) leads to a long breeding cycle, high dependence on the parent, and limited germplasm materials [7]. Moreover, several environmental stress factors, such as salinity, drought, and high temperatures can limit alfalfa production [8]. Thus, in view of limited arable land, limited production possibilities, and an increasing demand of fodder, development of new alfalfa cultivars adapted to saline and arid soil conditions is required [9].

Due to the complexity of stress tolerance mechanisms, traditional breeding approaches have reached their limits. Thus, transgenic approaches are now being frequently used to breed stress-tolerant crops. Engineering specific regulatory genes is now an effective strategy to control the expression of stress responsive genes [7,9]. This approach, termed genetic engineering, can also improve plant growth and productivity by selectively delivering genes encoding enzymes, structural proteins, or regulatory proteins involved in stress resistance [8]. Genetic engineering is widely used to produce regenerated alfalfa. The first genetic engineering introduced the neomycin phosphotransferase gene (NPT) into alfalfa via Agrobacterium tumefaciens-mediated transformation to improve kanamycin resistance [10]. Subsequently, some key genes involved in the regulation of stress tolerance were isolated and identified for their functions in improving stress resistance and nutritional value in alfalfa [7]. In brief, the expression of exogenous genes in alfalfa has assisted breeding varieties with high yield, quality, and strong breed competence. However, little attention has been concentrated on the function of plant hormone signaling in transgenic alfalfa.

The transcription factor ABI3 (ABSCISIC ACID INSENSITIVE 3) is a plant-specific family of B3 domain-containing proteins essential for regulating the abscisic acid (ABA) signal transduction pathway [11]. ABI3 plays an important role in regulating biological processes, including plastid development, flower bud dormancy, flowering time, lateral root development, seed maturation, and desiccation tolerance [12,13,14]. Several studies have confirmed the role of ABI3 in the development and physiology of plants by genetic engineering. Overexpression of ABI3 in Arabidopsis thaliana enhanced freezing tolerance in response to ABA and low temperature [15], while the overexpression of AtABI3 also enhanced drought stress adaptation and photosynthetic efficiency in cotton [16]. Meanwhile, overexpression of PtABI3 acted on appropriate growth and differentiation of embryonic leaves before bud set and dormancy [17], and overexpression of MtABI3/MtRAV3 enhanced osmotic and salt tolerance and inhibited the growth of Medicago truncatula [18]. Syntrichia caninervis is a desert moss with extreme desiccation tolerance, rapid rehydration, and photosynthetic recovery, which is widely distributed in the Gurbantunggut Desert of Xinjiang and is considered an excellent material for studying desert plants and a potential source of genes for improving stress tolerance [19]. Previous studies have reported that ScABI3 is localized in the nucleus where it acts as a transcription factor. The ScABI3 gene is expressed under drought and dehydration conditions, but also by ABA treatments. Furthermore, ectopic expression of ScABI3 in A. thaliana enhances tolerance to salinity and osmotic stress due to improved water use efficiency, increased reactive oxygen species (ROS) scavenging ability and altered expression of genes responsive abiotic stress [20,21]. Therefore, ScABI3 is a potential target gene for the genetic improvement of crops, such as alfalfa.

The present study introduced ScABI3 into alfalfa by A. tumefaciens-mediated transformation and evaluated the phenotype, photosynthetic efficiency, and nutritional quality of ScABI3-overexpressing plants. The results showed that ScABI3 can promote plant leaf area and leaf-stem ratio, thereby improving nutritional quality and photosynthetic indicators. These findings will lay a foundation for utilizing high-quality genetic resources from desert plants for breeding new alfalfa varieties with better values.

2. Materials and Methods

2.1. Plant Material and Growth Conditions

Medicago sativa L. cv. Zhongmu No.1 as transgenic plant material was grown in a greenhouse at 25 °C, 16 h/8 h photoperiod, 150 µmol∙m⁻²∙s⁻¹ light intensity, and 30% relative humidity.

2.2. Construction of Plant Expression Vector and Transformation

Total RNA was isolated using RNAprep Pure Plant Kit (Tiangen, China), cDNA was synthesized using random hexamer primers with TranScript II One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, China) and used to amplify the ScABI3 with specific primers (ScABI3-F: AGCACTGGGAGGCTGATG and ScABI3-R: CTGGCTGATTCTTGAACGAC). The cDNA of ScABI3 was inserted into multiple cloning sites of Sal I and Kpn I in the pCAMBIA1301 expression vector, and the recombinant plasmid 35S::ScABI3-pCAMBIA1301 was transferred into A. tumefaciens EHA105 strain following liquid nitrogen freeze-thaw transformation method [20]. Overnight cultures of the transformed A. tumefaciens in LB medium containing kanamycin were centrifuged at 5000 rpm for 15 min at 4 °C and re-suspended in the same medium supplemented with 5% sucrose to an OD600 of 0.8.

Fully-developed trifoliate leaves were collected from ten-day-old alfalfa seedlings and sterilized; leaf discs were then cut into squares (0.5 × 0.5 cm) and infected with the transformed A. tumefaciens strains (MS + 100 μm/L acetosyringone + 30 g/L sucrose, Ph = 5.8) for three hours in the dark at 24 °C, and the infected leaf discs were transferred onto a co-culture medium (MS + 100 μm/L acetosyringone + 5 mg/L 2,4-D + 0.5 mg/L 6-BA + 150 mg/L cephalosporin + 30 g/L sucrose + 3 g/L Phytagel, pH = 5.8) for three days under dark conditions (24 °C, without light), and then transferred onto a screening medium (MS + 5 mg/L 2,4-D + 0.5 mg/L 6-BA + 250 mg/L cephalosporin + 30 mg/L hygromycin B + 30 g/L sucrose + 3.5 g/L Phytagel, pH = 5.8) for four weeks under light conditions (150 µmol∙m⁻²∙s⁻¹ light intensity at 24 °C and 16 h/8 h photoperiod). The resistant calli were allowed to proliferate and then transferred onto a budding medium (MS + 1 mg/L KT + 0.2 mg/L 6-BA + 250 mg/L cephalosporin + 30 mg/L hygromycin B + 30 g/L sucrose + 3.5 g/L Phytagel, pH = 5.8) for bud culture for six weeks under light conditions. Buds with visible cotyledons were removed from the calli and subsequently cultured in a rooting medium (1/2 MS + 0.5 mg/L NAA + 15 g/L + sucrose 7 g/L agar, pH = 5.8) for eight weeks under light conditions. The seedlings were then transferred into pots and grown for six weeks under light conditions for further analysis.

2.3. PCR Authentication and qRT-PCR Analysis

Genomic DNA was extracted from the transformed alfalfa leaves, and wild-type (WT) was used as a control using a Plant Genomic DNA Extraction Kit (Tiangen, Beijing, China) to amplify the ScABI3 with specific primers (ScABI3-F: ATGCAAGTCGCTCCGCAG and ScABI3-R: CTACTCCTCGAGCTCTGTCTTTGTG). The PCR was performed using the Thermal Cycler (Veriti 96, Applied Biosystems, Massachusetts, USA) at 95 °C for 3 min, followed by 35 cycles of amplification at 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. Meanwhile, Hygromycin B was amplified using the specific primers hyg-F and hyg-R (hyg-F: ATGAAAAAGCCTGAACTCACCGC and hyg-R: CTATTTCTTTGCCCTCGGACGAG) as follows: 95 °C for 3 min, followed by 35 cycles of amplification at 95 °C for 30 s, 50 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. The pCAMBIA-1301-ScABI3 was used as a positive control.

Total RNA was extracted from the leaves of the putative transgenic alfalfa using RNAprep Pure Plant Kit (Tiangen, China) and reverse transcribed into cDNA using TranScript II One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). Finally, the qRT-PCR reaction system and procedures were performed using the SYBR^® Premix Ex Taq^TM II (TIi RNaseH Plus; TaKaRa, Osaka City, Osaka Prefecture, Japan) and ScABI3 primer of real-time fluorescence quantitative PCR (ScABI3-F: GGTACTTCATCGTTCTGG and ScABI3-R: GTCACCGTCTAATCTCTG). The fluorescence intensity was analyzed by CFX96™ Real-Time System (Bio-Rad, California USA), the gene expression levels of ScABI3 were normalized relative to the reference gene using the 2^−ΔΔCt method; the expression level in WT alfalfa was used as the baseline, and MsGPDH was used as a reference gene (F: GTGCCAAGAAGGTTGTTA; R: GGAATGATGTTGAAGGAG). All analyses were confirmed triple times.

2.4. Determination of Endogenous ABA Content

The leaves of six-week-old plants of the transgenic and WT alfalfa were selected to determine their endogenous ABA content by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) (Agilent 1290; Agilent Technologies, Santa Clara, CA, USA), using (±)-ABA(Sigma, North Liberty, IA, USA) as the standard, as described previously [22]. The experiment was repeated three times to generate biological triplicates for data analysis. Finally, the ABA content was expressed as ng/g DW.

2.5. Measurement of Leaf Area

The area of the third leaf from the top of the six-week-old transgenic and WT alfalfa plants was measured with ImageJ software. The area was measured for at least 30 leaves per line, and each measurement was repeated three times.

2.6. Measurement of the Leaf-Stem Ratio

The fresh aboveground part of six-week-old transgenic plants and WT were selected. The leaf blade with sheaths was considered the leaf, and the remaining material was the stem. The stems and leaves were separated and weighed to record the fresh weight. Then, the leaf-stem ratio was calculated with the formula as follows:

Leaf-stem ratio = fresh weight of leaves/fresh weight of the stems

The measurement was repeated three times per line.

2.7. Determination of Photosynthetic Indicators

The gas exchange parameters, including the net photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr), and water-use efficiency (WUE), were measured using a LiCor 6400XT gas exchange system (Lincoln, NE, USA). Healthy and fully-open leaves of the six-week-old transgenic and WT alfalfa plants were randomly selected, and the parameters were measured between 9:00 and 11:00 under a controlled environment at an ambient humidity of 70%, a saturating photosynthetic photon flux density of 1400 mmol m⁻² s⁻¹, and a leaf chamber temperature of 25 °C. The leaves were kept under atmospheric CO₂ for 5 min to attain steady-stage photosynthesis before recording the data [23]. At least 30 replicate measurements were recorded per line.

2.8. Determination of Crude Protein and Fat Contents

The aboveground plant parts from the transgenic and WT alfalfa at the seedling stage were collected, oven-dried for 72 h at 80 °C, and the samples were ground to pass through a 1.0 mm sieve. The nitrogen content of the powder was analyzed using an automatic Kjeltec nitrogen determinator (Kjeltec 8400, FOSS, Hilleroed, Denmark). The crude protein content was estimated from the nitrogen content using the conversion factor of 6.25 [9,24].

The fatty acid composition of crude fat was extracted by the Soxhlet extractor method from the aboveground parts of alfalfa at the seedling stage, using the chloroform:methanol mixture (2:1, v/v). The crude fat content was determined gravimetrically after oven-drying (80 °C) the extract overnight, as previously described [25].

2.9. Statistical Analysis

SPSS statistical software (version 18.0; SPSS Inc., Chicago, USA) was used to perform the statistical analysis. Data were analyzed, and statistical significance was determined using a one-way analysis of variance (ANOVA). Differences were considered statistically significant at p < 0.05, p < 0.01, or p < 0.001. (* Indicates a significant difference p < 0.05; ** indicates an exceedingly significant difference p < 0.01; ***indicates an exceedingly significant difference p < 0.001).

3. Results

3.1. Regeneration of Transgenic Plants

The 35S::ScABI3-pCAMBIA1301 plasmid was transformed into alfalfa following the Agrobacterium-mediated method. The infected leaves were cultured in MS medium for 24 to 36 h in the dark (Figure 1A) and then transferred to different selection media containing hygromycin B to form calli (Figure 1B), buds (Figure 1C), and roots (Figure 1D,E). Subsequently, twelve regenerated alfalfa plantlets were transplanted into pots for further analysis (Figure 1F).

3.2. PCR and qRT-PCR Analysis of the Transgenics

PCR-based amplification of genomic DNA for initial screening of the putative T₀ transgenic alfalfa. All twelve transgenic lines generated an amplicon of the Hyg gene (1024 bp) consistent with the positive control (Figure 2A); meanwhile, the transgenic lines 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 generated an amplicon of 1695 bp specific for the ScABI3 gene (Figure 2B). However, no Hyg and ScABI3 bands appeared in the WT (Figure 2). These results confirmed that 10/12 lines were positive, resulting in a positive transformation rate of 83.3%.

Furthermore, qRT-PCR was performed to detect the ScABI3 expression at the transcriptional level. The ten transgenic lines expressed the ScABI3 to different levels; however, no expression was detected in the WT (Figure 3). These observations confirmed the successful transformation and expression of ScABI3 in alfalfa. Among these, three independent transgenic lines (line 1, line 2, and line 3) with high expression were selected for further analysis.

3.3. Endogenous ABA Content in Transgenic Alfalfa

Furthermore, we performed UPLC-MS to determine the content of endogenous ABA in the transgenic lines and clarify the relationship between ScABI3 and ABA in alfalfa. The average content of endogenous ABA in transgenic alfalfa was 2.55 μg/g, line 3 showed the highest ABA content of 2.85 μg/g among the transgenics, while line 1 showed the lowest content of 2.05 μg/g, and line 2 was in the middle (2.74 μg/g); all transgenic lines’ ABA content was significantly higher than the WT (1.74 μg/g) (p < 0.01) (Figure 4). These observations indicate that the overexpression of ScABI3 significantly increased the endogenous ABA content of alfalfa.

3.4. Phenotype Analysis

Furthermore, the leaf area, leaf-stem ratio, and branch number of the transgenic and WT alfalfa were determined to assess the effect of ScABI3 overexpression on the alfalfa phenotype. The average leave area of the transgenic line was 2.17 cm², and that of the WT was 1.44 cm² (p < 0.05); the transgenic lines had a 50.69% higher leaf area than WT (Figure 5A,B). Meanwhile, the leaf-stem ratio of the transgenic lines was 1.74, and that of the WT was 1.33 (p < 0.05); the transgenic lines had a 30.83% larger ratio than WT (Figure 5C). In addition, the overexpression of ScABI3 in alfalfa showed more branching (Figure 5D). These observations indicated that overexpression of ScABI3 promoted plant growth and development and showed an increase in leaf area and leaf-stem ratio.

3.5. Leaf Gas Exchange Parameters of Transgenic Alfalfa

We further analyzed the gas exchange parameters to know the photosynthetic efficiency of ScABI3-overexpressing lines. The average Pn of transgenic alfalfa was 182.10% higher than the WT (p < 0.001). Among the transgenics, line 3 had the highest Pn (19.25 μmol CO₂·m⁻²·s⁻¹), while line 2 had the lowest (12.36 μmol CO₂·m⁻²·s⁻¹); the Pn of WT was 5.32 μmol CO₂·m⁻²·s⁻¹ (Figure 6A). Similar trends were found in Gs, Tr, and WUE. The average Gs of transgenic alfalfa was 0.79 mol H₂O·m⁻²·s⁻¹, and that of WT was 0.23 mol H₂O·m⁻²·s⁻¹ (Figure 6B). The transgenic lines had a 243.09% higher stomatal conductance than the WT (p < 0.001). Meanwhile, the average Tr of transgenic alfalfa was 16.34 mmol H₂O·m⁻²·s⁻¹, and that of the WT was 5.56 mmol H₂O·m⁻²·s⁻¹ (Figure 6C); Tr of the transgenic alfalfa was 194.01% higher than the WT (p < 0.001). The average WUE of transgenic alfalfa (1.35 mmol CO₂·m⁻²·s⁻¹ per mol H₂O m⁻²·s⁻¹) was 67.04% higher than the WT (0.81 mmol CO₂·m⁻²·s⁻¹ per mol H₂O m⁻²·s⁻¹) (p < 0.001) (Figure 6D). These observations suggested that the overexpression of ScABI3 increased the photosynthetic efficiency and WUE of alfalfa.

3.6. Crude Protein and Fat Contents of Transgenic Alfalfa

Further analysis of the nutritional quality showed a significant difference in crude protein content between the transgenic and WT alfalfa. We found that the average crude protein content of the transgenic lines was 16.6% (dry matter), while that of the WT was 11.3% (p < 0.001). The crude protein of line 2 was the highest (18.2%), while that of line 3 was the lowest (16.9%). Thus, the overexpression of ScABI3 resulted in a 46.9% increase in the crude protein content of alfalfa (Figure 7A). Meanwhile, the average crude fat content of the ScABI3-overexpressing line was 0.65% (dry matter), which was significantly lower than that of the WT (0.98%) (p < 0.001), among the transgenics, line 2 had the highest crude fat content (0.69%), while line 3 had the lowest (0.63%) (Figure 7B). These results suggested that overexpression of ScABI3 was positively correlated with the crude protein but was negative for the crude fat.

4. Discussion

In the past, a number of high-quality alfalfa varieties have been cultivated by traditional breeding, but this manner is often limited by its unpredictability and randomness. Fortunately, due to recent developments in agricultural biotechnology, it is now possible to generate alfalfa with greatly enhanced nutritional content and stress tolerance [26]. Moreover, the development of transgenic breeding with improved growth and stress tolerance is one of the most efficient and economic strategies for coping with a risky environment [27]. Several studies have demonstrated that expressing exogenous genes is a feasible way to cultivate transgenic plants with more biomass and enhanced abiotic stress tolerance. For example, the miR156 overexpression improved shoot branching, elevated biomass production, and regulated a network of downstream genes to affect alfalfa growth and development [28,29]. The co-expression of ZxNHX and ZxVP1-1 genes encoding tonoplast Na⁺/H⁺ antiporter and H⁺-pyrophosphatase from Zygophyllum xanthoxylum in alfalfa improved biomass accumulation and salt and drought tolerance [27]; ZxNHX and ZxVP1-1 also accelerated the development of crop cultivars with higher yield and better quality [9]. Similarly, overexpression of MsASMT1 raised endogenous melatonin levels in transgenic alfalfa, exhibiting a range of phenotypic changes, including vigorous growth, increased plant height, enlarged leaves, and more branches [30]. Under salt stress, overexpression of the MtTdp2α gene significantly increased the biomass, total chlorophyll, and carotenoid content of Medicago truncatula [31]. Thus, an efficient transgenic technology, a mature transformation material, and excellent genes are necessary to obtain stress-resistant and high-yield transgenic alfalfa. In this study, ‘Zhongmu No.1’ was selected as the material to be used for genetic transformation based on its good adaptability, high efficiency, and the deciphered complete genome [32]. Therefore, we successfully cultivated transgenic alfalfa lines expressing ScABI3 with a high transformation rate (83.3%), short growth cycles (less than twenty weeks), and high-level transcription.

The phytohormone ABA plays a critical role in plant development and environmental stress responses [33,34,35]. The overexpression of ZmbZIP4 promoted ABA synthesis and enhanced abiotic stress resistance [36]. Ijaz et al. proved that the overexpression of the Annexins gene AnnSp2 in tomatoes improved salt and drought tolerance by synthesizing ABA and scavenging ROS [37]. Meanwhile, when the content increases, ABA causes stomatal closure, reduces transpiration rate, and alleviates stress damage [38]. However, the increased levels of ABA may lead to a decline in photosynthesis and yield; therefore, we need to find approaches to tackle stress without compromising yield. S. caninervis is a highly drought-tolerant desert moss that was key in transitioning aquatic to terrestrial plants. It is also a good source of genetic materials for stress tolerance [19]. Therefore, the study used one of its genes with the known function that is an ideal method of promoting the growth and quality of crops. The study showed overexpression of ScABI3 increased the endogenous ABA content of alfalfa (Figure 4), consistent with previous studies that have shown that ABA induces ABI3 gene expression and association with ABI3 [39,40]. This observation confirms that ABI3 participates in ABA signal transduction and may play a role in ABA synthesis. However, the specific regulatory mechanism underlying this increase in ABA content in the transgenic alfalfa remains unexplored.

In forage crops such as alfalfa, the leaf area, leaf-stem ratio, and branch number are important agronomic traits, reflecting growth capacity. Moreover, a larger leaf area and an increase in the branch number may increase the leaf-stem ratio, positively correlated with the yield and nutritional value [41,42,43]. Expression of Osa-MIR156bc increased alfalfa secondary branching, leaf biomass yield, and leaf-to-stem ratio [44]. In this study, the overexpression of ScABI3 improved the photosynthetic rate (Figure 6A); these observations are based on increased leaf area, leaf-stem ratio, and branch number. We conclude that ScABI3 enhanced the growth capacity (Figure 5) and consequently improved the nutritional composition, providing a resource for improving the quality of alfalfa.

Furthermore, we analyzed the transgenic gas exchange parameters, including Pn, Gs, Tr, and WUE, to evaluate their photosynthetic efficiency. Overexpression of ZmNF-YB16 showed a higher rate of photosynthesis and antioxidant capacity, improving the yield of transgenic maize [45]. The overexpression of oil palm R2R3-MYB subfamily genes (EgMYB111 and EgMYB157) increased the Pn, Gs, and photosynthetic efficiency of transgenic A. thaliana [46]. In this experiment, we found that transgenic alfalfa had higher Pn, Gs, Tr, and WUE than the WT (Figure 6), which indicated that overexpressing ScABI3 enhanced photosynthetic capacity by increasing the stomatal conductance, balancing the relationship between Tr and CO₂ uptake, and improving WUE.

Higher levels of crude protein and crude fat are the most important objectives for alfalfa breeding [47,48]. Transgenic alfalfa co-overexpressing ZxNHX and ZxVP1-1 genes from Z. xanthoxylum accumulated more crude protein and crude fat than WT [9]. Heterogeneous expression of Osa-MIR156bc improved the forage quality of alfalfa by increasing crude protein content [44]. It has been found that co-expression of GsGSTU13 and SCMRP increased methionine content and salt-alkaline tolerance of alfalfa, which can significantly expand the growth area and increase the feed value [49]. Overexpression of the Arabidopsis cystathionine γ-synthase (AtCGS) significantly improved levels of protein-bound methionine and cysteine and ameliorated the nutritional quality of forage crops [50]. In this experiment, the crude protein content in the aboveground part of the ScABI3 transgenic alfalfa at the seedling stage was 16.6%, significantly higher than the WT (11.3%; Figure 7A). This observation indicated that ScABI3 could probably increase the crude protein content via the leaf-stem ratio and branch number increase, consistent with earlier reports [44,51]. Crude fat, an essential part of the feed, improves the nutritional value and taste of forages [52] and generally prefers high-fat content. However, the decrease in crude fat content observed in the present study’s transgenics showed that the content was significantly lower than the WT (Figure 7B), which may suggest a role of ScABI3 in inhibiting fat biosynthesis-associated enzymes; thus, the specific mechanism underlying this change needs to be examined in the future.

5. Conclusions

In summary, we generated transgenic alfalfa expressing ScABI3 from desert moss S. caninervis, and discovered excellent phenotype, photosynthetic efficiency, and nutritional quality. The expression of the ScABI3 gene in alfalfa enhanced its growth performance by improving ABA content, leaf area, leaf-stem ratio, crude protein content, branch number, and photosynthetic efficiency. Thus, this study provides a foundation for further research on alfalfa improvement and aids breeders in developing high-quality varieties of forage crops. Our future work will be interested in the function of ScABI3 in responding to stress and using transcriptome and proteome analyses to evaluate the yield and nutritional quality of transgenic alfalfa.