Next Article in Journal
Scaling Climate Smart Agriculture in East Africa: Experiences and Lessons
Previous Article in Journal
Water Accounting and Productivity Analysis to Improve Water Savings of Nile River Basin, East Africa: From Accountability to Sustainability
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 4
10.3390/agronomy12040819
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Authenticity Identification of Saccharum officinarum and Saccharum spontaneum Germplasm Materials

by
Xueting Li
1,†,
Yirong Guo
1,†,
Fei Huang
1,
Qiusong Wang
1,
Jin Chai
1,
Fan Yu
1,2,3,
Jiayun Wu
4,
Muqing Zhang
2,* and
Zuhu Deng
1,2,3,*
1
National Engineering Research Center for Sugarcane & Guangxi Key Laboratory of Sugarcane Biology, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
State Key Laboratory for Protection and Utilization of Subtropical Agro-Bioresources, Guangxi University, Nanning 530004, China
3
Key Laboratory of Sugarcane Biology and Genetic Breeding, Ministry of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
4
Guangdong Sugarcane Genetic Improvement Engineering Center, Institute of Nanfan and Seed Industry, Guangdong Academy of Sciences, Guangzhou 510316, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2022, 12(4), 819; https://doi.org/10.3390/agronomy12040819
Submission received: 1 March 2022 / Revised: 21 March 2022 / Accepted: 24 March 2022 / Published: 28 March 2022
Browse Figures
Versions Notes

Abstract

:
Sugarcane is an important sugar and energy crop in the world. Germplasm innovation is a significant way to breed breakthrough sugarcane varieties. Modern sugarcane varieties all contain the blood relationship of Saccharum officinarum and Saccharum spontaneum. High sugar results from S. officinarum and the resistance genes from S. spontaneum. In order to improve the sugarcane quality, breeders use S. officinarum and S. spontaneum to cross and obtain hybrid offspring with high sugar and high resistance. Therefore, the authenticity of S. officinarum and S. spontaneum progeny materials directly affects the efficiency of sugarcane breeding. In this study, the tetra-primer amplification hindered mutation system (ARMS PCR) was used to identify ten suspected S. officinarum and eleven suspected S. spontaneum germplasm materials, then further validated by chromosome counting and genome in situ hybridization (GISH). Among the ten suspected S. officinarum materials to be identified, three were real S. officinarum materials, they were 14NG124, 51NG103, and Guan A. Nine of the eleven suspected S. spontaneum to be identified were fake S. spontaneum materials, these were Yunge 2007-12-165, Guangxi 87-20, Yunnan 82-16, Yunge 2007-11, YNLC 16, Laos No. 2, Yunnan 82-29, 2015-83, and 2013-20. The ARMS PCR results were the same as the GISH results. The three real S. officinarum materials had 80 chromosomes. Using ARMS PCR and GISH, three S. officinarum and nine S. spontaneum materials were proven to be authentic. Through chromosome number statistics, it was found that the three real S. officinarum had 80 chromosomes. Authentic materials were identified and selected to enrich the genetic background of sugarcane through hybridization and reduce the influence on the breeding process of the misuse of fake S. officinarum and S. spontaneum.

1. Introduction

Saccharum spp. is an essential crop for producing sugar and bioethanol. It mainly grows in tropical and subtropical regions. Due to the high biomass productivity, sugarcane can be used as raw feedback for the sugar industry, energy, fiber, sugar-based chemicals, and food industry. Sugarcane produces sugar which accounts for more than 85% of the total sugar in the world. It is one of the most critical sugar crops globally and the source of income for the main sugarcane-producing areas [1]. S. spontaneum played a significant role in sugarcane breeding and modern sugarcane varieties for more than a century. Modern sugarcane cultivars result from S. officinarum and S. spontaneum. It is considered that high sugar genes come from S. officinarum and the resistance genes come from S. spontaneum. S. officinarum (2n = 80), known as a “noble species” [2], performs good characteristics, including large stalk, high sucrose content, and low fiber. However, S. officinarum has many apparent defects, including poor resistance to diseases and insects and poor tillering ability. S. spontaneum (2n = 40~128, x = 4~16) has excellent characteristics, including a robust root system, more tillering, strong resistance to diseases and insects, and exceptional adaptability [3].
S. officinarum was usually used as a female parent to cross or backcross with other materials. The chromosome inheritance and genetic progress of fake S. officinarum or real S. officinarum were different. When S. officinarum is female for hybrid or backcross, the inheritance of chromosome was always 2n + n, while that of the fake S. officinarum is n + n, the proportion of chromosomes of S. officinarum in the offspring was reduced, and multiple backcrosses were required to restore the high sugar characteristics of S. officinarum, which seriously affected the nobility process [4,5]. The resistance and agronomic traits of the parents play a crucial role in obtaining excellent offspring. If the fake were selected, its utilization value would be overestimated, making it challenging to obtain the expected results, giving unclear chromosome genetic background, and wasting time, human resources, and other resources, seriously delaying the breeding process. Thus, the identification of real or fake is essential for sugarcane breeding [6].
Many methods and technologies were developed and used to accurately identify the authenticity of parental materials. With the development of sequencing technology, SNPs were used in germplasm identification. Tetra-primer ARMS PCR technology has been widely used to analyze and identify various germplasm genotypes such as rice, pepper, and orange [7,8,9]. Tetra-primer ARMS PCR was developed and designed to successfully identify 71 materials with S. spontaneum [10], it was an effective method for us to perform sequence comparison analysis on 45S rDNA and was designed to identify whether it contains the chromosome of S. officinarum and S. spontaneum [6]. Tetra-primer ARMS PCR could quickly distinguish the genera of the germplasm resources of various crops [11]. Due to the limitation of the sugarcane genome map, the research on sugarcane SNP lags behind that of rice, rapeseed, and other crops [12]. In recent years, nuclear ribosomal DNA internal transcribed spacer(nrDNA-ITS) as a DNA fragment with conserved length in the evolution process of the nuclear genome, but with large changes in the nucleotide sequence, rapid evolution, good stability, and convenient sequencing, its sequence can be used as a marker to judge the genetic relationship between species [13,14].
GISH has been extensively used in hybrid chromosome source analysis and genetic relationship identification [15,16,17]. So far, many studies have confirmed that GISH technology is accurate and efficient in deciphering the chromosome composition and translocation of a variety of natural allopolyploid materials [18,19,20,21]. It is mainly used in chromosome recombination, identification of interspecific relationships, and chromosome inheritance in the research of sugarcane genetics. The hybridization of parental DNA probes with different markers to the chromosomes in the metaphase of mitosis could effectively distinguish the source of the interspecies hybrids and distinguish whether chromosome exchange occurs or not [22,23,24,25,26]. GISH has made remarkable achievements in identifying real and fake hybrids of sugarcane, especially in identifying atypical S. officinarum with more than 80 chromosomes. The interspecies origin of Saccharum barberi and S. sinense only comes from S. officinarum and S. spontaneum [26]. Using GISH, four atypical S. officinarum materials with 2n > 80 were proven to be the hybrid offspring of S. officinarum and S. spontaneum [27]. Five materials were identified as the hybrid offspring of S. officinarum and S. spontaneum, rather than S. officinarum, and, in which, there exists chromosome exchange [28]. It was confirmed by GISH that the genetic model of the F1 generation of the cross between E. rockii × N. porphyrocoma was “n + n” [29]. GISH was generally used to identify chromosomes from different genera, but it was difficult to distinguish the progeny of interspecific hybridization using GISH because of the high genomic homology of interspecific materials. Although GISH has exceptionally high accuracy in identifying genetic relationships among sugarcane species, red and green fluorescent signals could be detected by GISH, which could determine the source of chromosomes. However, it is challenging to distinguish materials with close genetic relationships or high genome homology [30]. S. officinarum and S. spontaneum belong to the genus of Saccharum spp., and there has been no previous report using the method of GISH to identify whether it is real or fake.
In this study, we use three methods to identify and analyze the tested materials. Tetra-primer ARMS PCR designed by our group was used to initially identify the germplasm material of S. spontaneum or S. officinarum, then further confirmed by chromosome counting and GISH. Authenticity identification of this germplasm would improve the breeding efficiency in our sugarcane breeding.

2. Materials and Methods

2.1. Plant Materials

The tested materials include ten suspected S. officinarum clones, including 14NG124, 28NG16, 28NG251, 51NG103, 51NG150, Bar Wil Spt, Guan A, Karakarawa, 48Mouna, and 51NG92, and eleven suspected S. spontaneum clones, including Yunge 2007-12-165, Guangxi 87-20, IAC2330, C15-792, Yunnan 82-16, Yunge 2007-11, YNLC 16, Laos No. 2, Yunnan 82-19, 2015-83, and 2013-20. All materials were provided by the National Sugarcane Resource Nursery in Sugarcane Research Institute of Yunnan Academy of Agricultural Sciences and preserved in the Germplasm Resource Nursery of the Fujian Agriculture and Forestry University.

2.2. Experimental Methods

2.2.1. Tetra-Primer ARMS PCR Procedure

The tetra-primer ARMS PCR was designed based on nrDNA-ITS. We performed the procedure using the primers FO1, RO1, FI1, and RI1 (FO1: GTTTTTGAACGCAAG TTGCGCCCGAGGC; RO1: AATTCGGGCGACGAAGCCACCCGATTCT; FI1: GCCGGCGCATCGGC CCTAAGGACCTAT; RI1: GAGCGGCTATGCGCTGCGGTGCTTCT). The reaction system was as follows (Table 1). PCR amplification conditions were as follows: pre-denaturation at 95 °C for 5 min, 6 cycles of 95 °C for 30 s, 78 °C for 20 s, each cycle decreased by 1 °C, 72 °C for 20 s. The reaction ends at 95 °C for 30 s, 71 °C for 10 s, 72 °C for 10 s, and finally at 72 °C for 5 min in 24 cycles. We used 2.0% agarose gel for electrophoresis detection.

2.2.2. Sugarcane Root Culture, Sampling, Processing, and Storage

Sugarcane root culture, sampling, processing, and storage: Healthy sugarcane stems with more root tips were selected and cultured in a constant temperature incubator. The root tips (2~3 cm) were harvested, then placed in saturated p-dichlorobenzene-α-bromonaphthalene solution at 25 °C for 2 h, fixed with freshly prepared Carnoy’s fixative (ethanol:acetic acid = 3:1), and kept at 4 °C for 24 h. The root tips were washed by ddH2O 2~3 times for 10 min, then dehydrated in 75%, 95%, 100% ethanol for 10 min at room temperature. Finally, the root tips were placed in 75% ethanol and stored in a refrigerator at −20 °C.

2.2.3. Genome In Situ Hybridization Slide and Probes Preparation

The root tip was cut and incubated in 0.075 mol·L−1 KCl at 37 °C for 30 min, then the section containing dividing cells was dissected and digested in an enzyme mixture (1% pectolyase Y23, 2% pectinase, 2% RS, and 4% cellulase Onozuka R-10) at 37 °C for 4 h. After digestion, the root sections were washed in ddH2O two times, briefly. The root sections were carefully broken by using a pipette tip. The suspension cells were dropped onto glass slides and another 10 µL acetic acid was dropped onto them when the slide had almost dried. The prepared root tips were observed by Leica microscope at 40× to count chromosome numbers using Image-Pro Plus 6.0 software for statistics.
The hybridization probe was labeled with biotin on Badila (S. officinarum) and digoxigenin on Yunnan 82-114 (S. spontaneum) and obtained by enzyme digestion and the specific preparation reaction. The mix is shown in Table 2 (the final gDNA concentration was 100 ng/μL). The mixture was placed for 2 h at 15 °C. The most suitable size of probe was 300–500 bp. Then we added 2 μL of 0.5 M EDTA (pH = 8.0) and incubated at 65 °C for 10 min to stop the reaction.

2.2.4. Genome In Situ Hybridization

The gDNA of S. officinarum (Badila gDNA) was labeled with digoxigenin-11-dUTP (Roche, Switzerland, 11093088910). Bio16-dUTP (Roche, Switzerland, 11093070910) used to label the gDNA of S. spontaneum (Yunnan82-114 gDNA). We used a nick translation kit (Roche, Switzerland, 10976776001) to label the probe. We used 10 μL of 1% pepsin (A100685-0250, Sangon, Shanghai, China), treated at 37 °C for 30 min, used 70% deionized formamide (200-842-0, Sangon, Shanghai, China) 100 μL, and denatured at 70 °C for 2 min 30 s. Then we used different concentrations of alcohol (75%, 95%, and 100%) at −20 °C for five minutes each, eluted by 2 × SSC, the hybridization solution containing the two DNA probes was prepared and dropped onto the slide, added hybridization solution, and hybridized overnight at 37 °C. The slides were washed in 2 × SSC for 10 min at 42 °C, 2 × SSC and 4 × SSC with Tween for 5 min each at room temperature. We added anti-digoxigenin-fluorescein (Roche, Switzerland, 11207741910) for 1 h at 37 °C and then washed three times with 4 × SSC with Tween for 8 min at 37 °C, and rhodamine antibodies (Vector, Torrance, CA, USA, A-2005) for 1 h at 37 °C and then washed three times with 4 × SSC with Tween for 8 min at 37 °C. Then, 10 μL Antifade mounting medium with 4′-6-diamidino-2-phenylindole (Vector, USA, H-1200, DAPI) was used for counterstaining. We used an AxioScope A1 imaging microscope, processed by AxioVision software to deal with the fluorescence image.

3. Results

3.1. Identification of Suspected S. officinarum

3.1.1. Tetra-Primer ARMS PCR Identification of Real or Fake S. officinarum

The tetra-primer ARMS PCR was used to amplify the DNA from the ten suspected S. officinarum. Both S. officinarum and S. spontaneum have a PCR product of 428 bp. The real S. officinarum has a unique PCR product of 278 bp, while the S. spontaneum has 203 bp. The results are shown in Figure 1, the three materials 14NG124, 51NG103, and Guan A with only two PCR products (428 bp and 278 bp) could be preliminarily identified as a real S. officinarum clone; the other seven materials with three PCR products (428 bp, 203 bp, and 278 bp) could be preliminarily identified as fake clones of S. officinarum, including 28NG16, 28NG251, 51NG150, 51NG92, Karakarawa, Bar Wil Spt, and 48 Mouna (Figure 1).

3.1.2. Chromosome Counting of Suspected S. officinarum

Chromosome statistics were performed on cells with a clean background, complete morphology, and well-dispersed chromosomes of ten suspected S. officinarum materials (Figure 2). The statistical results were shown in Table 1. The chromosome number of 14NG124, 51NG103, and Guan A was 2n = 80, according to the typical S. officinarum. However, the chromosome number of the other seven suspected S. officinarum materials was 2n > 80, including 28NG16, 28NG251, 51NG92, 51NG150, 48 Mouna, Karakarawa, and Bar Wil Spt (Table 3).

3.1.3. Identification of Real or Fake S. officinarum by GISH

Two probes were used for GISH with ten suspected S. officinarum materials, including biotin-labeled S. officinarum genomic and digoxigenin-labeled S. spontaneum genomic probes. Green signals were detected in the overall chromosomes of 14NG124, 51NG103, and Guan A, indicating that these three materials only contained the S. officinarum chromosome (Figure 3A–C). The signals of the other seven materials contain both S. officinarum and S. spontaneum chromosomes, including 28NG16, 28NG251, 51NG92, 48 Mouna, Karakarawa, 51MG150, and Bar Wil Spt (Figure 3D–J).

3.2. Identification of Suspected S. spontaneum Materials

3.2.1. Tetra-Primer ARMS PCR Identification of Real and Fake S. spontaneum

S. spontaneum materials have a unique PCR product of 203 bp. As shown in Figure 4, the nine materials with a PCR product of 203 bp could be considered genuine S. spontaneum, including Yunge 2007-12-165, Guangxi 87-20, Yunnan 82-16, Yunge 2007-11, YNLC 16, Laos No. 2, Yunnan 82-29, 2015-8, and 2013-20. The two materials, IAC 2330 and C15-792, had both PCR products of the S. spontaneum (203 bp) and the S. officinarum (278 bp), which could be regarded as fake S. spontaneum, indicating that both should be offspring of S. officinarum and S. spontaneum through hybridization.

3.2.2. Chromosome Counting of the Suspected S. spontaneum

The number of chromosomes accounted for the base number of chromosomes x = 8 in all 11 clones (Table 4, Figure 5).

3.2.3. Identification of Real and Fake S. spontaneum by GISH

The gDNA of Badila (S. officinarum, biotin) and Yunnan 82-114 (S. spontaneum, digoxigenin) were used as probes. Chromosomes with red signals were detected in Yunge 2007-12-165, Guangxi 87-20, Yunnan 82-16, Yunge 2007-11, YNLC 16, Laos No. 2, Yunnan 82-29, 2015-83, and 2013-20, whereas the green fluorescent signals were relatively weak, indicating that all of them contained S. spontaneum chromosomes (Figure 6A,B,E–K). In the other two materials of IAC 2330 and C15-792, there were two kinds of chromosomes from S. officinarum and S. spontaneum (Figure 6C,D).

4. Discussion

The chromosome number of typical S. officinarum was 2n = 80, x = 10 [31], and the common clones were Badila, Vietnamese cattlecane. However, there were also atypical S. officinarum with a chromosome number that was not 80, of which two were found on the island of New Guinea, such as clones NG77-56 (2n = 116) and NG77-26 (2n = 70) [32]. These atypical S. officinarum were interspecies hybrids of the genus Saccharum [33]. In total 129 typical S. officinarum materials with chromosome number 2n = 80 were identified as S. officinarum clones from the 144 morphologically recognized ones, and the remaining materials were identified as atypical S. officinarum or hybrids [34]. Based on the study of 585 clones collected in Cannanore, India, 526 clones were typical S. officinarum with 2n = 80, and 59 were atypical materials with 2n = 78–120, indicating that the clones with the number of chromosomes 2n < 80 were aneuploid of S. officinarum, and the ones with chromosome number 2n > 80 were most likely to be hybrid [35]. The results presented here showed five atypical S. officinarum (2n > 80) were not real S. officinarum, but the hybrid offspring of S. officinarum and S. spontaneum by the GISH method. Four atypical S. officinarum with 2n > 80 were also consistent with the result verified by Jaga Thesan [36]. It could be concluded that there was mutual verification of chromosome count and GISH, and the result was more accurate and objective when using cytology to identify S. officinarum [27]. This study identified the authenticity of 10 suspected S. officinarum and confirmed that only three of these materials, 14NG124, 51NG103, and Guan A, were real S. officinarum with 80 chromosomes. The numbers of chromosomes with over 80 from the other seven clones were the fake S. officinarum, including 28NG16, 28NG251, 51NG92, 51NG150, Karakarawa, Bar Wil Spt, and 48 Mouna. These seven fake S. officinarum materials were all composed of S. officinarum and S. spontaneum chromosomes.
Modern sugarcane varieties are often the result of hybridization, of which few original parental germplasms are used, so their chromosomal makeup is very similar. About 80% of the chromosomes in sugarcane varieties were from S. officinarum, about 10–15% from S. spontaneum, and the rest were from the exchange and recombination of the two species [37,38]. The genetic basis was limited, and the reduction of S. spontaneum chromosomes has also caused a general decline in disease resistance and adaptability. Although sugarcane breeders in various countries have never stopped noble breeding, no breakthrough varieties have been bred in two decades. Therefore, germplasm innovation of sugarcane must be carried out to solve the current “bottleneck” in the sugarcane breeding program. Distant hybridization was currently the most effective and crucial way to innovate sugarcane germplasm. More primitive S. officinarum and S. spontaneum must be hybridized to breed varieties with high yield, high sugar, strong disease resistance, and adaptability. We hope to introduce new genes through intergenic and interspecific hybridization, especially the introduction of resistance genes from wild germplasm, to breed new varieties and broaden the genetic basis of germplasm materials. The identification of chromosomes in germplasm innovation is of great significance. Now cytological research could ascertain the chromosome transmission methods of various intergenic hybrids and the chromosome composition of the offspring of different materials hybrids. Chromosome identification could help identify the authenticity of the offspring of hybrids quickly, improve the effectiveness of breeding utilization, and promote breeding progress.
In recent years, the use of cytology to identify the chromosomal composition of different materials, and then to study and track its genetic evolution, the most popular method is the oligo-FISH developed based on FISH, which can analyze the chromosomal composition and infer the genetic evolution of chromosomes [39,40]. There is also the use of SSR to make probes to label different chromosomes [41]. With the release of the sugarcane genome, we can analyze specific fragments of different chromosomes by bioinformatics methods, and we can identify the chromosomal composition of sugarcane materials using only simple PCR [42]. The identification method will become simpler and more accurate as the technology is updated and can promote the development of sugarcane breeding.

5. Conclusions

Using ARMS PCR, GISH, and chromosome number statistics to investigate the authenticity of S. officinarum and S. spontaneum, we found that only 3 of the 10 suspected S. officinarum were proven to be authentic, and the number of chromosomes was 80. Nine of the eleven suspected S. spontaneum were real. The verification of real and fake S. officinarum or S. spontaneum can effectively improve the sugarcane breeding process that was affected by fake seeds.

Author Contributions

Z.D. and M.Z. designed the research; X.L. and F.H. performed the experiments; X.L., Y.G., F.H., Q.W., J.C. and F.Y. analyzed data. X.L., Y.G. and J.W. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31771863) and was supported by an earmarked fund for Modern Agriculture Technology of China (CARS-170106). This project was also granted from the State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources (SKLCUSA-a201912, SKLCUSA-b201806) and was supported by the Special Fund for Science and Technology Innovation of Fujian Agriculture and Forestry University (KFA17168A, KFA17525A, KFA17169A).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets supporting the conclusions of this manuscript and materials generated in this study are available from the corresponding author upon request.

Acknowledgments

We thank the National Sugarcane Resource Nursery in Sugarcane Research Institute of Yunnan Academy of Agricultural Sciences for providing the plant materials used in this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, L.; Ma, L. Application of S. spontaneum in Sugarcane Cross-breeding. Sugar Crops China 2006, 1, 1–4. [Google Scholar]
  2. Bakker, H. The Origins of Sugar Cane; Springer: New York, NY, USA, 1999. [Google Scholar]
  3. Moore, P.H.; Paterson, A.H.; Tew, T. Sugarcane: The Crop, the Plant, and Domestication. In Sugarcane: Physiology, Biochemistry, and Functional Biology; John Wiley & Sons: Hoboken, NJ, USA, 2013. [Google Scholar]
  4. Hermann, S.R.; Aitken, K.S.; Jackson, P.A.; George, A.W.; Piperidis, N.; Wei, X.; Kilian, A.; Detering, F.J.E. Evidence for second division restitution as the basis for 2n + n maternal chromosome transmission in a sugarcane cross. Euphytica 2012, 187, 359–368. [Google Scholar] [CrossRef]
  5. Mehra, P.N.; Sood, O.P. Floating Chromosomal Populations in Saccharum spontaneum L. Cytologia 1974, 39, 681–696. [Google Scholar] [CrossRef] [Green Version]
  6. James, G.L. An Introduction to Sugarcane. In Sugarcane; John Wiley & Sons: Hoboken, NJ, USA, 2007. [Google Scholar]
  7. Hou, Y.; Luo, Q.; Chen, C.; Zhou, M. Application of tetra primer ARMS-PCR approach for detection of Fusarium graminearum genotypes with resistance to carbendazim. Australas. Plant Pathol. 2013, 42, 73–78. [Google Scholar] [CrossRef]
  8. Ana, G.C.; Shanna Moore, F.; Ramiro, G.O.; Molly, J.; Arnedo-Andrés, M.S. Identification, validation and survey of a single nucleotide polymorphism (SNP) associated with pungency in Capsicum spp. Theor. Appl. Genet. 2007, 115, 907–916. [Google Scholar]
  9. Zhao, J.; Yang, X.; Zeng, X.; Zhong, S.; Fang, J.; Luo, J.; Zeng, Y.; Xiang, X. Analysis on Germplasm Resources of Exocarpium Citri Grandis Using SNP Molecular Markers. Mol. Plant Breed. 2016, 1203–1211. [Google Scholar]
  10. Yang, S.; Li, X.; Huang, F.; Huang, Y.; Liu, X.; Wu, J.; Wang, Q.; Deng, Z.; Chen, R.; Zhang, M. A new method based on SNP of nrDNA-ITS to identify Saccharum spontaneum and its progeny in the genus Saccharum. PLoS ONE 2018, 13, e0197458. [Google Scholar] [CrossRef] [Green Version]
  11. Lu, F.H.; Neil, M.K.; Laura-Jayne, G.; Luo, M.C.; Anthony, H.; Bevan, M.W. Reduced chromatin accessibility underlies gene expression differences in homologous chromosome arms of diploid Aegilops tauschii and hexaploid wheat. GigaScience 2020, 6, giaa070. [Google Scholar] [CrossRef]
  12. You, Q.; Yang, X.; Peng, Z.; Islam, M.S.; Wang, J. Development of an Axiom Sugarcane100K SNP array for genetic map construction and QTL identification. Theor. Appl. Genet. 2019, 132, 2829–2845. [Google Scholar] [CrossRef]
  13. Xiaoquan, W.; Zhengrong, D.; Deyuan, H.J.A.P.S. The Systematic Position of Beesia: Evidence from ITS (nrDNA) Sequence Analysis. Acta Phytotaxon. Sin. 1998, 36, 403–410. [Google Scholar]
  14. Liu, Z.; Wang, X.Q.; Chen, Z.D.; Lin, Q.; Lu, A.M.J.A.B.S. The Phylogeny of Schisandraceae Inferred from Sequence Analysis of the nrDNA ITS Region. Acta Bot. Sin. 2000, 42, 758–761. [Google Scholar]
  15. Pachakkil, B.; Terajima, Y.; Ohmido, N.; Ebina, M.; Irei, S.; Hayashi, H.; Takagi, H. Cytogenetic and agronomic characterization of intergeneric hybrids between Saccharum spp. hybrid and Erianthus arundinaceus. Sci. Rep. 2019, 9, 1748. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Wilkes, T.M.; Francki, M.G.; Langridge, P.; Karp, A.; Jones, R.N.; Forster, J.W. Analysis of rye B-chromosome structure using fluorescencein situ hybridization (FISH). Chromosome Res. 1995, 3, 466–472. [Google Scholar] [CrossRef] [PubMed]
  17. Cao, M.; Sleper, D.A.; Dong, F.; Jiang, J. Genomic in situ hybridization (GISH) reveals high chromosome pairing affinity between Lolium perenne and Festuca mairei. Genome 2000, 43, 398–403. [Google Scholar] [CrossRef]
  18. An, D.; Ma, P.; Luo, Q.; Xu, H.; Xu, Y. Molecular cytogenetic characterization of a new wheat-rye 4R chromosome;translocation line resistant to powdery mildew. Chromosome Res. 2013, 21, 419–432. [Google Scholar] [CrossRef]
  19. Harper, J.; Armstead, I.; Thomas, A.; James, C.; Gasior, D.; Bisaga, M.; Roberts, L.; King, I.; King, J. Alien introgression in the grasses Lolium perenne (perennial ryegrass) and Festuca pratensis (meadow fescue): The development of seven monosomic substitution lines and their molecular and cytological characterization. Ann. Bot. 2011, 107, 1313. [Google Scholar] [CrossRef] [Green Version]
  20. Imen, M.; Véronique, C.; Anne-Marie, T.; Cecile, H.; Virginie, H.; Harry, B.; Olivier, C.; Boulos, C.; Joseph, J. Newly synthesized wheat allohexaploids display progenitor-dependent meiotic stability and aneuploidy but structural genomic additivity. New Phytol. 2010, 186, 86–101. [Google Scholar]
  21. Peng, Z.; Wanlong, L.; Bernd, F.; Gill, B.S. The origin of a “zebra” chromosome in wheat suggests nonhomologous recombination as a novel mechanism for new chromosome evolution and step changes in chromosome number. Genetics 2008, 179, 1169. [Google Scholar]
  22. Jenkin, M.J.; Reader, S.M.; Purdie, K.A.; Miller, T.E. Detection of rDNA sites in sugarcane by FISH. Chromosome Res. 1995, 3, 444. [Google Scholar] [CrossRef]
  23. D’Hont, A.; Grivet, L.; Feldmann, P.; Rao, S.; Berding, N.; Glaszmann, J.C. Characterisation of the double genome structure of modern sugarcane cultivars (Saccharum spp.) by molecular cytogenetics. Mol. Gen. Genet. 1996, 250, 405–413. [Google Scholar] [CrossRef]
  24. Piperidis, G.; Christopher, M.J.; Carroll, B.J.; Berding, N.; D’Hont, A. Molecular contribution to selection of intergeneric hybrids between sugarcane and the wild species Erianthus arundinaceus. Genome 2000, 43, 1033–1037. [Google Scholar] [CrossRef] [PubMed]
  25. Huang, D.Y.; Zheng, C.; Zhuang, N.S.; Zhu, W.; Gao, H.Q.; Han, P.Y. Studies on the Genomic System Evolution of Sugarcane. Chin. J. Trop. Crops 2000, 21, 000043–000051. [Google Scholar]
  26. D’Hont, A.; Paulet, F.; Glaszmann, J.C. Oligoclonal interspecific origin of ‘North Indian’ and ‘Chinese’ sugarcanes. Chromosome Res. 2002, 10, 253–262. [Google Scholar] [CrossRef] [PubMed]
  27. Yu, F.; Wang, P.; Li, X.; Huang, Y.; Wang, Q.; Luo, L.; Jing, Y.; Liu, X.; Deng, Z.; Wu, J. Characterization of chromosome composition of sugarcane in nobilization by using genomic in situ hybridization. Mol. Cytogenet. 2018, 11, 35. [Google Scholar] [CrossRef] [Green Version]
  28. Piperidis, N.; Chen, J.W.; Deng, H.H.; Wang, L.P.; Jackson, P.; Piperidis, G. GISH characterization of Erianthus arundinaceus chromosomes in three generations of sugarcane intergeneric hybrids. Genome 2010, 53, 331–336. [Google Scholar] [CrossRef]
  29. Chang, H.; Wang, Q.; Qiu, Y.; Qin, Y.; Fang, N. Production, Identification and Characterization of Erianthus rockii × Narenga porphyrocoma Intergeneric Hybrids as a New Germplasm for Sugarcane Breeding and Genetic Research. Sugar Tech 2020, 22, 389–395. [Google Scholar] [CrossRef]
  30. Kato, A.; Vega, J.M.; Han, F.; Lamb, J.C.; Birchler, J.A. Advances in plant chromosome identification and cytogenetic techniques. Curr. Opin. Plant Biol. 2005, 8, 148–154. [Google Scholar] [CrossRef]
  31. D’Hont, A.; Rao, P.S.; Feldmann, P.; Grivet, L.; Islam-Faridi, N.; Taylor, P.; Glaszmann, J.C. Identification and characterisation of sugarcane intergeneric hybrids, Saccharum officinarum × Erianthus arundinaceus, with molecular markers and DNA in situ hybridisation. TAG. Theor. Appl. Genet. Theor. Angew. Genet. 1995, 91, 320. [Google Scholar] [CrossRef]
  32. Sobhakumari, V.P. New determinations of somatic chromosome number in cultivated and wild species of Saccharum. Caryologia 2013, 66, 268–274. [Google Scholar] [CrossRef]
  33. Piperidis, G.; D’Hont, A.; Hogarth, D.M. Chromosome composition analysis of various Saccharum interspecific hybrids by genomic in situ hybridisation (GISH). In Proceedings of the International Society of Sugar Cane Technologists XXIV Congress, Brisbane, Australia, 17–21 September 2001; pp. 565–566. [Google Scholar]
  34. Price, S. Cytological studies in Saccharum and allied genera. VI. Chromosome numbers in S. officinarum and other noble sugar canes. Hawaii. Plant. Rec. 1960, 56, 183–194. [Google Scholar]
  35. Shah, S.S.; Jagathesan, D.; Venkataraman, M.R. Introgression in Saccharum officinarum and Saccharum robustum. Indian J. Genet. Plant Breed. 1970, 30, 668–672. [Google Scholar]
  36. Piperidis, G.; Piperidis, N.; Hont, A. Molecular cytogenetic investigation of chromosome composition and transmission in sugarcane. Mol. Genet. Genom. 2010, 284, 65–73. [Google Scholar] [CrossRef] [PubMed]
  37. Cuadrado, A.; Acevedo, R.; de la Espina, S.M.D.; Jouve, N.; de la Torre, C. Genome remodelling in three modern S. officinarum ×S. spontaneum sugarcane cultivars. J. Exp. Bot. 2004, 55, 847–854. [Google Scholar] [CrossRef] [Green Version]
  38. D’ Hont, A. Unraveling the genome structure of polyploids using FISH and GISH; examples of sugarcane and banana. Cytogenet. Genome Res. 2005, 109, 27–33. [Google Scholar] [CrossRef]
  39. Meng, Z.; Wang, Q.; Khurshid, H.; Raza, G.; Han, J.; Wang, B.; Wang, K. Chromosome Painting Provides Insights Into the Genome Structure and Evolution of Sugarcane. Front. Plant Sci. 2021, 12, 1890. [Google Scholar] [CrossRef] [PubMed]
  40. Yu, F.; Zhao, X.; Chai, J.; Ding, X.; Li, X.; Huang, Y.; Wang, X.; Wu, J.; Zhang, M.; Yang, Q. Chromosome-specific painting unveils chromosomal fusions and distinct allopolyploid species in the Saccharum complex. New Phytol. 2021, 233, 1953–1965. [Google Scholar] [CrossRef]
  41. Metcalfe, C.J.; Li, J.; Giorgi, D.; Doleel, J.; Aitken, K.S. Flow cytometric characterisation of the complex polyploid genome of Saccharum officinarum and modern sugarcane cultivars. Sci. Rep. 2019, 9, 19362. [Google Scholar] [CrossRef] [Green Version]
  42. Zhang, J.; Zhang, X.; Tang, H.; Zhang, Q.; Ming, R. Allele-defined genome of the autopolyploid sugarcane Saccharum spontaneum L. Nat. Genet. 2018, 50, 1565–1573. [Google Scholar] [CrossRef] [Green Version]
Agronomy 12 00819 g001 550
Figure 1. Agarose gel electrophoresis of 10 suspected S. officinarum tetra-primer ARMS PCR products. M: 100 bp DNA ladder marker. Lanes 1–10: 14NG124, 51NG103, Guan A, 28NG16, 28NG251, 51NG92, 48 Mouna Karakarawa, 51NG150, and Bar Wil Spt are suspected S. officinarum. Lanes 11–12: Loethers, Badila, are S. officinarum. Lanes 13–14: Yunnan 82-50, Yunnan 82-114, are S. spontaneum. Lanes 15–16: Yacheng 58-44, Yacheng 58-47 are F1 generations produced between S. officinarum and S. spontaneum. Lane 17: ddH2O.
Figure 1. Agarose gel electrophoresis of 10 suspected S. officinarum tetra-primer ARMS PCR products. M: 100 bp DNA ladder marker. Lanes 1–10: 14NG124, 51NG103, Guan A, 28NG16, 28NG251, 51NG92, 48 Mouna Karakarawa, 51NG150, and Bar Wil Spt are suspected S. officinarum. Lanes 11–12: Loethers, Badila, are S. officinarum. Lanes 13–14: Yunnan 82-50, Yunnan 82-114, are S. spontaneum. Lanes 15–16: Yacheng 58-44, Yacheng 58-47 are F1 generations produced between S. officinarum and S. spontaneum. Lane 17: ddH2O.
Agronomy 12 00819 g001
Agronomy 12 00819 g002 550
Figure 2. Mitotic chromosomes of 10 suspected S. officinarum clones from root tips. (A): 14NG124; (B): 51NG103; (C): Guan A; (D): 28NG16; (E): 28NG251; (F): 51NG92; (G): 48 Mouna; (H): Karakarawa; (I): 51NG150; (J): Bar Wil Sp; scale bar: 10 μm.
Figure 2. Mitotic chromosomes of 10 suspected S. officinarum clones from root tips. (A): 14NG124; (B): 51NG103; (C): Guan A; (D): 28NG16; (E): 28NG251; (F): 51NG92; (G): 48 Mouna; (H): Karakarawa; (I): 51NG150; (J): Bar Wil Sp; scale bar: 10 μm.
Agronomy 12 00819 g002
Agronomy 12 00819 g003 550
Figure 3. GISH analysis of chromosome components in 10 suspected S. officinarum clones GISH of mitotic cells from root tips. (A): 14NG124; (B): 51NG103; (C): Guan A; (D): 28NG16; (E): 28NG251; (F): 51NG92; (G): 48 Mouna; (H): Karakarawa; (I): 51NG150; (J): Bar Wil Spt; scale bar: 5 μm. S. officinarum labeled by biotin and S. spontaneum labeled by digoxigenin, the orange fluorescent signal in the chromosome of S. spontaneum, and green or yellow-green in S. officinarum.
Figure 3. GISH analysis of chromosome components in 10 suspected S. officinarum clones GISH of mitotic cells from root tips. (A): 14NG124; (B): 51NG103; (C): Guan A; (D): 28NG16; (E): 28NG251; (F): 51NG92; (G): 48 Mouna; (H): Karakarawa; (I): 51NG150; (J): Bar Wil Spt; scale bar: 5 μm. S. officinarum labeled by biotin and S. spontaneum labeled by digoxigenin, the orange fluorescent signal in the chromosome of S. spontaneum, and green or yellow-green in S. officinarum.
Agronomy 12 00819 g003
Agronomy 12 00819 g004 550
Figure 4. Agarose gel electrophoresis of tetra-primer ARMS PCR product of 11 suspected S. spontaneum. M: 100 bp DNA ladder marker. Lanes 1–11: Yunge 2007-12-165, Guangxi 87-20, IAC 2330, C15-792, Yunnan 82-16, Yunge 2007-11, YNLC 16, Laos No. 2, Yunnan 82-29, 2015-83, and 2013-20 are suspected S. spontaneum. Lanes 12–13: Loethers, Badila, are S. officinarum. Lanes 14–15: Yunnan 82-50, Yunnan 82-114, are S. spontaneum. Lanes 16–17: Yacheng 58-44 and Yacheng 58-47 are F1 generations produced between S. officinarum and S. spontaneum. Lane 18: ddH2O.
Figure 4. Agarose gel electrophoresis of tetra-primer ARMS PCR product of 11 suspected S. spontaneum. M: 100 bp DNA ladder marker. Lanes 1–11: Yunge 2007-12-165, Guangxi 87-20, IAC 2330, C15-792, Yunnan 82-16, Yunge 2007-11, YNLC 16, Laos No. 2, Yunnan 82-29, 2015-83, and 2013-20 are suspected S. spontaneum. Lanes 12–13: Loethers, Badila, are S. officinarum. Lanes 14–15: Yunnan 82-50, Yunnan 82-114, are S. spontaneum. Lanes 16–17: Yacheng 58-44 and Yacheng 58-47 are F1 generations produced between S. officinarum and S. spontaneum. Lane 18: ddH2O.
Agronomy 12 00819 g004
Agronomy 12 00819 g005 550
Figure 5. Mitotic chromosomes of 11 suspected S. spontaneum clones from root tips. (A): Yunge 2007-12-165; (B): Guangxi 87-20; (C): IAC 2330; (D): C15-792; (E): Yunnan 82-16; (F): Yunge 2007-11; (G): YNLC 16; (H): Laos No. 2; (I): Yunnan 82-29; (J): 2015-83; (K): 2013-20; scale bar: 10 μm.
Figure 5. Mitotic chromosomes of 11 suspected S. spontaneum clones from root tips. (A): Yunge 2007-12-165; (B): Guangxi 87-20; (C): IAC 2330; (D): C15-792; (E): Yunnan 82-16; (F): Yunge 2007-11; (G): YNLC 16; (H): Laos No. 2; (I): Yunnan 82-29; (J): 2015-83; (K): 2013-20; scale bar: 10 μm.
Agronomy 12 00819 g005
Agronomy 12 00819 g006 550
Figure 6. GISH analysis of chromosome components in 11 suspected S. spontaneum clones GISH of mitotic cells from root tips. (A): Yunge 2007-12-165; (B): Guangxi 87-20; (C): IAC 2330; (D): C15-792; (E): Yunnan 82-16; (F): Yunge 2007-11; (G): YNLC 16; (H): Laos No. 2; (I): Yunnan 82-29; (J): 2015-83; (K): 2013-20; scale bar: 5 μm. S. officinarum labeled by biotin and S. spontaneum labeled by digoxigenin, the orange fluorescent signal in the chromosome of S. spontaneum, and green or yellow-green in S. officinarum.
Figure 6. GISH analysis of chromosome components in 11 suspected S. spontaneum clones GISH of mitotic cells from root tips. (A): Yunge 2007-12-165; (B): Guangxi 87-20; (C): IAC 2330; (D): C15-792; (E): Yunnan 82-16; (F): Yunge 2007-11; (G): YNLC 16; (H): Laos No. 2; (I): Yunnan 82-29; (J): 2015-83; (K): 2013-20; scale bar: 5 μm. S. officinarum labeled by biotin and S. spontaneum labeled by digoxigenin, the orange fluorescent signal in the chromosome of S. spontaneum, and green or yellow-green in S. officinarum.
Agronomy 12 00819 g006
Table
Table 1. Tetra-primer ARMS PCR mixtures.
Table 1. Tetra-primer ARMS PCR mixtures.
ComponentsVolume (μL)
ddH2O1.4
2 × GC buffer10.0
dNTP (2.5 mM each)2.4
Dimethylsulphoxide0.8
FO1 (5 μM)1.6
RO1 (5 μM)1.2
FI1 (5 μM)0.4
RI1 (5 μM)1.6
Template (gDNA; 50 ng/μL)0.4
Ex Taq (5 U/μL)0.2
Total volume20.0
Table
Table 2. Hybrid probe preparation system.
Table 2. Hybrid probe preparation system.
Experimental ReagentVolume
0.1 mM dNTP mix with Dig or Bio10 μL
10 × DNase I buffer2 μL
0.0005 U/μL DNase I2 μL
5 U/μL Polymerase I1 μL
2 μg gDNAx μL
ddH2O(5 − x) μL
Total20 μL
Table
Table 3. The number of chromosomes in 10 suspected S. officinarum clones.
Table 3. The number of chromosomes in 10 suspected S. officinarum clones.
CloneThe Total Number of Cells ObservedChromosome Number (2n)
14NG124302n = 80
28NG16302n = 116
28NG251302n = 110
51NG103302n = 80
51NG92302n = 106
Guan A302n = 80
48 Mouna302n = 96
Bar Wil Spt302n = 110
51NG150302n = 116
Karakarawa302n = 84
Table
Table 4. The number of chromosomes in 11 suspected S. spontaneum clones.
Table 4. The number of chromosomes in 11 suspected S. spontaneum clones.
CloneThe Total Number of Cells ObservedChromosome Number (2n)
2013-20302n = 80
2015-83302n = 64
Yunnan82-16302n = 64
Guangxi87-20302n = 80
IAC 2330302n = 80
Yunnan82-29302n = 80
C15-792302n = 72
Yunge2007-11302n = 64
Yunge2007-12-165302n = 80
Laos No. 2302n = 80
YNLC16302n = 80
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, X.; Guo, Y.; Huang, F.; Wang, Q.; Chai, J.; Yu, F.; Wu, J.; Zhang, M.; Deng, Z. Authenticity Identification of Saccharum officinarum and Saccharum spontaneum Germplasm Materials. Agronomy 2022, 12, 819. https://doi.org/10.3390/agronomy12040819

AMA Style

Li X, Guo Y, Huang F, Wang Q, Chai J, Yu F, Wu J, Zhang M, Deng Z. Authenticity Identification of Saccharum officinarum and Saccharum spontaneum Germplasm Materials. Agronomy. 2022; 12(4):819. https://doi.org/10.3390/agronomy12040819

Chicago/Turabian Style

Li, Xueting, Yirong Guo, Fei Huang, Qiusong Wang, Jin Chai, Fan Yu, Jiayun Wu, Muqing Zhang, and Zuhu Deng. 2022. "Authenticity Identification of Saccharum officinarum and Saccharum spontaneum Germplasm Materials" Agronomy 12, no. 4: 819. https://doi.org/10.3390/agronomy12040819

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop