Characterization and Identification of Native Pseudomonads from Red and Lateritic Regions of West Bengal

Abstract

Agricultural crops are facing a continuous threat due to biotic and abiotic stresses, thus, limiting the crop productivity, and thereby, threatening food security. Plant roots attract several kinds of microbes that induce resistance in plants against these stresses by enhancing the activity of the antioxidant enzymes, phenolic and other non-phenolic compounds, and thereby, have a beneficial effect on plants. Vast research has been carried out on biocontrol agents to manage soil-borne plant pathogens, but there has been limited success in the development of region-specific, commercially viable microbial inoculants. The present research was framed with a view to screen and evaluate native Pseudomonads from the rhizosphere of different crops in lateritic soils and their exploitation in biotic and abiotic stress management under the red and lateritic zone of West Bengal. In the lateritic area of West Bengal, the lowest pH as well as the highest culturable rhizobacterial population was found in the soil of Bankura. Among all the isolated rhizobacteria, 43.33% were found to be moderately antagonistic against three different soil-borne plant pathogens viz., Rhizoctonia solani, Sclerotinia sclerotiorum and Sclerotium rolfsii—while only 6.67% were found to be very highly antagonistic against these soil-borne plant pathogens. Augmented seeds of tomato, cowpea and French bean with native rhizobacteria enhanced the vigour index and 16.67% of the isolates were found to have a high value of vigour index in the normal and acid stress conditions. Based on acid tolerance, antagonistic activity and the seed vigour assay, a total of 13 isolates from 97 of lateritic area were selected. Out of the 13 selected isolates, 7 were positive for protease and lipase production, 8 isolates were positive for the production of HCN, siderophore and salicylic acid production and 9 isolates were found to be positive for IAA, phosphate solubilisation, amylase and chitinase production. Species of beneficial Pseudomonads such as Pseudomonas aeruginosa, P. fluorescens, P. Plecoglossicida, P. helmanticensis, P. geniculate, P. baetica and P. putida were found. Five isolates were used to study the effect on plant growth in terms of germination (%), root and shoot length, as well as fresh root and shoot weight and disease patterns in terms of pre- and post-emergence damping-off under the semi-field condition.

1. Introduction

Slightly acidic (pH value of soil ranging from 5.6 to 6.5) and severely acidic (pH value of soil less than 5.5) soils cover roughly 59 Mha and 31 Mha of land area in India, respectively [1]. As this type of soil is naturally poor in calcium, magnesium, nitrogen, phosphate and other nutrients, the fertility level of red and lateritic soil is quite low. Red and lateritic soil also has problems regarding metal toxicities such as aluminium, iron and manganese with various nutrient imbalances, which should be available to the plants for its normal functioning [2]. Therefore, nutrients are inaccessible to the plant in this sort of soil, resulting in unfavourable conditions for plant growth [3]. Phosphorus deficit is seen under highly acidic soil with a low pH value, whereas iron, manganese and zinc deficiencies are found in alkali soil with a high pH value. Because of its limited solubility and fixation in fertile soil, phosphorus (P) is an essential macronutrient that often limits plant growth. Due to the quick binding of applied phosphorus into fixed forms that are unavailable to plants, thus phosphorus shortage is a serious limitation to crop yield. The overuse of agrochemicals in conventional agricultural practices is causing low fertility and toxicity to the soil. As a result, in the current agriculture strategy, there is a growing desire for organic and toxicity free alternatives that are both cost-effective as well as environmentally beneficial [4]. Bacterial inocula from the rhizosphere could be a viable option for laterite soil’s integrated nutrient management plan. When cultivated in conjunction with a host plant, root-colonizing beneficial bacteria— known as plant growth-promoting rhizobacteria (PGPR)—are capable of enhancing plant growth and development. Seed germination, seedling emergence responses to external stress factors, plant protection from disease and root growth can all be enhanced in addition to plant growth. [5]. Direct plant-growth promotion by PGPR entails either giving the plant a bacterium-produced chemical, such as phytohormones, or aiding the uptake of particular nutrients from the soil environment [6]. Only 2–5 percent of bacteria in the rhizosphere stimulate plant growth [7], and among them, Pseudomonas sp. and Bacillus sp. are the most common. Due to their numerous activities such as of enhancing the soil nutrient status, secretion of plant growth regulators and suppression of soil-borne plant pathogens, some Pseudomonas species have been identified as among the most efficient phosphate-solubilizing bacteria and as major bio-inoculants [8]. Improving soil fertility by releasing bound phosphorus through the use of microbial inoculants is an important part of enhancing crop yield [9]. Phosphorous release from insoluble phosphate reported for several soil microorganisms has been attributed mainly to the production of organic acids and their chelating capacity [10]. Plant-growth promotion under the influence of microbes plays an important role in crop nutrition and soil fertility enhancement through a variety of mechanisms, including biological nitrogen fixation, native phosphorus solubilization, acquisition of essential macro- and micronutrients through the mineralization of organic manures/organic matter, production of plant growth-promoting substances, and disease control through the suppression of soil-borne pathogens [8]. The present study is focused on acidic stress mitigation through the exploration of native rhizospheric Pseudomonads, which briefly includes the characterization, analysis and identification of native Pseudomonads from the rhizospheric regions of different crops, weeds, fallow land and comes under the lateritic zone of West Bengal, India.

2. Materials and Methods

2.1. Estimation of Soil Chemical Properties, Isolation and Selection of Acid-Tolerant Rhizobacteria

Rhizospheric soil sampling for the isolation of Pseudomonads from various crops, fallow land and forest land was carried out between January 2018 to April 2018 and January 2019 to April 2019 from 67 different mouzas in five different districts of West Bengal under red and lateritic zones. Standard protocols were used for the estimation of various soil chemical parameters, such as soil pH [11], Electrical Conductivity (EC) [11], Organic Carbon (OC) [12], Nitrogen (N) [13], Phosphorus (P) [14], Potassium (K) [15], Sulphur (S) [16], Boron (B) [17], Zinc (Zn) [18], Iron (Fe) [18], Manganese (Mn) [18] and Copper (Cu) [18]. For isolation of Pseudomonads, serial dilution of the soil suspension was done after 5 and 6 fold (10⁻⁵ and 10⁻⁶) and plated on petri plates containing Pseudomonas Isolation Agar Base (M406). The culturable population of native rhizospheric Pseudomonads in GIS-tagged diverse surveyed areas were used to produce a map using ArcMap 10.3.1 software. The rhizobacteria were tested for acid tolerance by growing them on Nutrient Agar (NA) media at different pH levels (6, 5 and 4). Acid-tolerant strains were chosen and subcultured in acidic NA media after being able to thrive at pH 4.

2.2. Antagonistic Potentiality of Rhizobacteria against Different Soil-Borne Plant Pathogens

The in vitro antagonistic potentiality of the isolated rhizobacteria was assessed by dual culture practice [19] against three different soil-borne fungal phytopathogens viz., Rhizoctonia solani, Sclerotinia sclerotiorum and Sclerotium rolfsii.

2.3. Rhizobacteria Mediated Seed Germination and Seedling Vigour Test

The ability of rhizobacterial isolates to enhance seedling growth was tested [20] in normal water agar medium (0.6 percent agar in distilled water) as well as acidic water agar medium (0.6 percent agar in distilled water, adjusted to pH 4.5).

2.4. Screening for Different Rhizobacterial Secondary Metabolite Production

2.4.1. Indole Acetic Acid (IAA) Production

Salkwasky’s reagent was used to estimate the production of Indol Acetic Acid (IAA) by the isolates [21].

2.4.2. Phosphate Solubilization

Ten ml of ammonium molybdate was added and thoroughly mixed in the Pikovskaya’s broth and was inoculated with rhizobacterial strain. The flask’s contents were diluted to 45 mL and then 0.25 mL of chlorostannous acid was added. At 600 nm, the solution’s blue colour intensity was measured. The standard curve was used to calculate the quantity of soluble phosphorus.

2.4.3. HCN Production

HCN production was assessed by absorbance of filter paper strips at 625 nm by using 0.5% picric acid and 2% sodium carbonate solution [22].

2.4.4. Siderophore Production

Hathway’s reagent was used for the estimation of siderophore synthesis [23] by the isolates.

2.4.5. Salicylic Acid (SA) Production

Solvent extraction of chloroform and reaction with ferric chloride was performed to quantify salicylic acid production [24].

2.5. Extracellular Hydrolytic Enzyme Production by Rhizobacteria

Production of the extracellular hydrolytic enzymes was carried out using spot inoculation of the bacterial isolates in the appropriate solid media followed by incubation at 28 ± 2 °C for a recommended time period. Amylase production was measured 48 h after incubation in starch agar medium and pouring the iodine solution on top. The presence of a clear halo zone in the media against a dark blue backdrop (starch–iodide complex) suggested amylase activity. Agar media for chitinase detection was prepared with a colloidal chitin base and the bromocresol purple was used as an indicator. Bacterial isolates were spotted onto the media and inspected for the formation of purple-coloured zones on a yellow-coloured background after four days of incubation at 28 ± 2 °C [25]. The isolates were spotted on skim milk agar media (M763, Himedia) for the protease test. Lipase production test was performed by using Lipase assay media containing tween-80. for the lipase test.

2.6. Identification of the Isolates

2.6.1. Isolation of Genomic DNA

Single colony of each isolate was inoculated into 20 mL of nutrient broth (NB) in 50 mL conical flasks for overnight incubation at 28 ± 1 °C with constant shaking at 200 rpm. The bacterial cells were harvested as pellet in the micro centrifuge tubes by giving a centrifugation for 10 min at 9167 g. The pellets were washed with 1 M NaCl followed by three washes with sterile double distilled water. Proteinase K (50 μg/ml) of 200 mL volume was prepared for DNA extraction using 10 mM Tris-HCL (pH 7.5) and 1 M EDTA (pH 8.0). Bacterial pellets were gently dissolved in 400 µL of Proteinase K solution before being incubated in a hot water bath at 56 °C for 15 min. The enzyme activity was deactivated for 15 min at 80 °C, then the bacterial pellets were immediately placed on ice and stored for 5 min. The DNA-containing supernatant was separated by centrifugation at 12,000 rpm for 5 min, then transferred to a separate sterile micro centrifuge tube and stored at −20 °C for future use.

2.6.2. PCR Amplification of 16S rDNA

The 16S rDNA gene was amplified using the universal primers 27F (5’AGAGTTTGATCCTGGTCAGAACGCT3’) and 1492R (5’TACGGCTACCTTGTTACGACTTCACCCC-3’) [26]. Reaction volume contained 50 ng of bacterial genomic DNA, 2.5 µL 10X Taq polymerase buffer, 2 mM MgCl₂, 50 mM Tris-HCl, 200 M deoxynucleoside triphosphates, 0.4 M of each primer and 1U of Taq polymerase (Bangalore Genei). The following thermal cycles are used in PCR machine (HIMEDIA, LAA1060 WEE 32): initial denaturation at 95 °C for 4 min followed by 32 cycles of denaturation at 94 °C for 45 s, annealing at 56 °C for 1 min and extension at 72 °C for 1.5 min, followed by a final extension at 72 °C for 10 min and final hold at 4 °C. The PCR product was run in agarose gel (1.5% w/v) mL containing 0.5 g/mL ethidium bromide (EtBr) at 70 Volt for 30 min to check for the presence of the specific PCR products and desirable level of amplification. An image-based gel documentation system was used to capture the images of the agarose gels. The molecular size of the amplicon generated was determined comparing with 100bp molecular ladder (Himedia MBT130-200LN, HiMedia Laboratories Pvt. Ltd., Mumbai, Maharashtra, India).

2.6.3. Sequencing of the 16S rDNA Regions and Sequence Analysis

Dideoxy sequencing (AgriGenome Labs Pvt. Ltd., Kochi, India) was used to sequence the amplified products and the trimmed nucleotide sequences of each bacterial isolates were identified using the Basic Local Alignment Search Tool (BLAST) of National Centre for Biotechnology Information (NCBI) with a non-redundant nucleotide database and default parameters. Through GenBank Bankit submission tools, the 16S rDNA region of native bacterial isolates was deposited to the NCBI nucleotide database maintained by the National Center for Biotechnology Information, U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894, USA and accession numbers were obtained. Partial sequences of 16S rDNA of different Pseudomonas type species and other Pseudomonads species were retrieved from the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/nucleotide (accessed on 27 September 2022) to interpret the genetic diversity of the native Pseudomonads isolates. These 16S rDNA sequences were aligned and end-trimmed using ClustalW multiple alignment tool implemented in MEGAX [27]. To understand the evolutionary relationship of the isolates, a phylogenetic tree was created using the neighbour-joining approach with 1000 bootstrap.

2.7. Effect of Lateritic Pseudomonads on Growth of Tomato and Cowpea

A pot experiment was conducted in RCBD design containing four replications with the bacterial isolates of lateritic area (BCLP4, GP2, CK2LP12, GP8 and SS2LP25) using the soil of lateritic origin. Tomato and cowpea seeds were treated with various bacterial suspension (BCLP4: 9.04 CFU/gram, GP2: 9.09 CFU/gram, CK2LP12: 9.04 CFU/gram, GP8: 8.93 CFU/gram and SS2LP25: 9.11 CFU/gram) of the bacterial isolates and water irrigation of 180 mL was applied in three-day intervals to the pots having bacterial formulations as well as in the control one. Root length (cm), shoot length (cm), fresh root weight (g), fresh shoot weight (g) and severity of damping-off (%) were recorded after 28 days of sowing from each treatment and replication.

2.8. Statistics Analysis

Replicated experimental observations for RCBD design were analysed by SPSS software (v24.0, IBM, Armonk, NY, USA) with Tukey-HSD test at a p < 0.05 significance level.

3. Results

3.1. Survey and Collection of Soil Samples

Soil samples weighing about 100 g were collected from rhizospheric regions of each cultivable crop, fallow pasture and from forest lands of various locations in red and laterite regions of West Bengal viz., West Midnapore, Bankura, Jhargram, Purulia and Birbhum. Among the sampled soils, of the lateritic area, the average lowest pH was noted in the soils of the Bankura (5.24) district followed by Jhargram (5.30), Purulia (5.50), West Midnapore (5.65) and Birbhum (5.73) (

Table 1. Soil pH and population of Pseudomonads and related genera at surveyed red and lateritic areas of West Bengal.

Block	pH	Pseudomonads Population (Log CFU/Gram of Soil)
West Midnapore	5.65 (5.00–6.10) ± 0.38 *	5.63 (5.46–6.29) ± 0.36
Bankura	5.24 (4.41–6.63) ± 0.53	5.80 (5.36–6.22) ± 0.22
Jhargram	5.30 (5.50–5.61) ± 0.42	5.46 (5.44–5.47) ± 0.02
Purulia	5.50 (5.42–5.60) ± 0.14	5.68 (5.23–6.13) ± 0.64
Birbhum	5.73 (4.51–7.13) ± 0.70	5.67 (5.00–6.24) ± 0.37

*: Representation of data in cells indicates mean (range) ± standard deviation.

).

3.2. Population of Pseudomonads and Related Genera

The highest population of Pseudomonads and its related genera was found in the soils of Bankura (5.80 log CFU/gram) followed by Purulia (5.68 CFU/gram), Birbhum (5.67 CFU/gram), West Midnapore (5.63 CFU/gram) and Jhargram (5.46 CFU/gram) (Table 1). The Pearson correlation (t-Test) between Pseudomonads population and various soil chemical parameters of the lateritic area indicated a positive correlation of population of Pseudomonads with the organic carbon (r = 0.970) and nitrogen (r = 0.966) content of the soil at 1% significance level negative correlation of the same with potassium (r = 0.380) content of the soil at 5% level of significance and was found negatively correlated with manganese (r = 0.602) at 1% level of significance (

Table 2. Correlation between the population of Pseudomonads and related genera in soil with lateritic soil chemical properties (using t-Test).

	Pseudomonads
	Pearson Correlation Coefficient (2-Tailed)	p Value	N
pH	−0.287	0.1	34
EC	0.06	0.738	34
OC	0.970 **	0	34
N	0.966 **	0	34
P	−0.009	0.959	34
K	−0.380 *	0.027	34
S	−0.331	0.056	34
Zn	−0.253	0.148	34
B	0.196	0.267	34
Fe	−0.26	0.138	34
Mn	−0.602 **	0	34
Cu	0.111	0.534	34

** Correlation is significant at the 0.01 level. * Correlation is significant at the 0.05 level. OC: organic carbon, N: nitrogen, P: phosphorus, K: potassium, S: sulphur, Zn: zinc, B: boron, Fe: iron, Mn: manganese and Cu: copper from the soil samples.

). A map was constructed according to the variation of culturable population of native rhizospheric Pseudomonads in GIS-tagged surveyed areas of lateritic zones of West Bengal through ArcMap 10.3.1 software (Esri, Redlands, CA, USA), which clearly depicted the highest mean population of Pseudomonads in Bankura and Purulia, followed by the area of Birbhum, West Midnapore and Jhargram under red and lateritic zones of West Bengal (Figure 1).

3.3. In-Vitro Antagonistic Activity of Rhizospheric Bacteria of Lateritic Zone against Soil-Borne Fungal Pathogens

The identification of acid-tolerant isolates among 97 native rhizospheric Pseudomonads and associated genera isolated from the lateritic zone of West Bengal was carried out on the basis of their ability to grow on NA medium of pH 4. Thirty isolates were selected, which were able to tolerate the acidic medium of pH 4 and were maintained as pure culture at 4 °C in the test tube slants of NA medium for further use. The antagonistic potentiality of the thirty native rhizospheric Pseudomonads and associated isolates of the red and lateritic zones were screened against three different soil-borne phytopathogens—viz., Sclerotinia sclerotiorum, Rhizoctonia solani and Sclerotium rolfsii—by a dual culture plate assay. Among all of them, isolate GP8 exhibited the maximum mycelial inhibition against R. solani (63.89% inhibition) followed by isolate BCLP4 (62.78% inhibition). When the rhizobacterial isolates were challenged against Sclerotinia sclerotiorum, the maximum mycelial inhibition of 63.89% was observed in the BCLP4–Sclerotinia sclerotiorum dual plate assay followed by GP8–Sclerotinia sclerotiorum (62.78% of mycelial inhibition) dual plate assay. When the native rhizobacterial isolates were evaluated against Sclerotium rolfsii, isolate GP8 exhibited the maximum mycelial inhibition (76.11% inhibition) followed by the native rhizobacterial isolates BCLP4 (62.80% of inhibition). Among the acid-tolerant rhizospheric bacteria of the red and lateritic zones, the highest average antagonistic activity against all the three soil-borne fungal pathogens (Sclerotinia sclerotiorum, Rhizoctonia solani and Sclerotium rolfsii) was observed by isolate GP8 (67.59% inhibition) followed by the rhizobacterial isolate BCLP4 (63.15% inhibition). A cluster analysis was carried out based on the mycelial inhibition ability of all the 30 isolates against three soil-borne fungal plant pathogens, using the average linkage between the groups, which distributed the isolates of lateritic regions into five clusters (

Table 3. Distribution of average antagonistic activity of Pseudomonads and associated isolates of the lateritic area of West Bengal.

Cluster	Antagonism Level	Range	Mean	Abundance (%)	Isolate Member
I	Very Low Antagonistic	8.52–13.33	10.95 (±1.71)	30	TTLP15, BGLP29, BCLP1, RBLP7, TSLPQ3, BGLP30, ST3LP22, IPLP28, RCLP8
II	Low Antagonistic	18.33–20	19.26 (±0.85)	10	RC2LP9, SDLP11, ST2LP20
III	Moderate Antagonistic	29.81–41.85	36.08 (±3.02)	43.33	ST3LP23, SS2LP27, SK2LP10, BGLP21, IBLP24, JMLP2, TTLP16, ST2LP19, GP3, ST2LP18, SS2LP26, GP1, ST2LP17
IV	Highly Antagonistic	46.48–54.26	49.51 (±4.17)	10	CK2LP12, SS2LP25, GP2
V	Very Highly Antagonistic	63.15–67.59	65.37 (±3.14)	6.67	BCLP4, GP8

). Out of the 30 isolates, the maximum number of isolates (43.33%) were categorized as moderately antagonist with a mean mycelial inhibition of 36.08% followed by very low antagonistic ability (30.00% abundance) and low antagonistic as well high antagonist isolates each having 10% of the total rhizobacteria. Only two rhizobacteria (6.67% of total)—viz., BCLP4 and GP8—were found to be very highly antagonistic against all the three soil-borne plant pathogens.

3.4. In-vitro Seedling Vigour Assay Test for the Evaluation of Plant-Growth Promotion Potentiality of Native Rhizobacterial Isolates of Red and Lateritic Zones

When treated with various selected acid-tolerant rhizobacterial isolates (able to grow at pH 4) under both normal and acid stressed conditions, tomato, cowpea and French bean seedlings performed better in terms of various plant growth parameters such as seed germinability, root length, shoot length and vigour index in all treatments compared to the control and increased the vigour index considerably (at a 5% level of significance). Among the acid tolerant lateritic isolates, isolate GP8 was found to be best for tomato at pH 7 with a vigour index of 1179.40 and fresh weight of 28.12 mg, followed by SS2LP25 with a vigour index value of 1174.20 and fresh weight of 27.50 mg. At pH 4.5, SS2LP25 produced the maximum vigour index of 1026.00 and fresh weight of 25.58 mg, followed by GP8 with a vigour index of 1010.00 and fresh weight of 22.52 mg. Cowpea seeds treated with GP8 at a normal pH medium of 7 produced the maximum vigour index of 1802.00 and fresh weight of 0.86 g, followed by isolate BCLP4 with a vigour index of 1782.00 and fresh weight of 0.98 g. In the stressed condition of 4.5 pH medium, BCLP4 exhibited maximum vigour index of 1404.00 and fresh weight of 0.74 g, followed by GP2 with a vigour index of 1402.00 and fresh weight of 0.74 g. The French bean seeds at pH 7 showed the best plant-growth promotion under the influence of GP2 with a vigour index of 1710.00 and fresh weight of 1.10 g, followed by BCLP4 with a vigour index of 1648.00 and fresh weight of 0.95 g. At pH 4.5, BCLP4 produced a vigour index of 1490.00 and fresh weight of 0.80 g, followed by GP2 with a vigour index of 1459.40 and fresh weight of 0.89 g. Seeds inoculated with the tested rhizobacteria produced greater values of vigour index; the values were greater than the uninoculated one. The distribution of all lateritic rhizobacteria was also carried out by k mean cluster analysis (

Table 4. Distribution of lateritic Pseudomonads and associated isolates, based on k mean cluster analysis of the average vigour index.

	On Normal Media				On 4.5 pH Media
	Cluster 1	Cluster 2	Cluster 3	Cluster 4	Cluster 1	Cluster 2	Cluster 3	Cluster 4
Mean	763.57 (±26.63)	833.82 (±18.29)	881.32 (±16.52)	1493.20 (±28.07)	551.49 (±11.05)	503.96 (±12.50)	643.04 (±32.54)	1254.92 (±25.28)
Min	733.51	800.97	862.32	1462.00	535.53	477.65	620.03	1215.73
Max	787.60	855.07	913.33	1524.40	575.65	521.28	666.05	1281.40
Percent of abundance	20.00	30.00	33.33	16.67	43.33	33.33	6.67	16.67
Isolate Member	TSLP13 TTLP16 ST2LP18 ST2LP20 SS2LP26 IPLP28	JMLP2 RC2LP9 SDLP11 TTLP15 ST2LP17 ST2LP19 ST3LP23 BGLP29 BGLP30	BCLP1 GP3 GP1 RBLP7 RCLP8 SK2LP10 BGLP21 ST3LP22 IBLP24 SS2LP27	BCLP4 GP2 CK2LP12 GP8 SS2LP25	BCLP1 JMLP2 RC2LP9 SK2LP10 SDLP11 ST2LP17 BGLP21 ST3LP22 ST3LP23 SS2LP26 SS2LP27 IPLP28 BGLP29	RBLP7 RCLP8 TSLP13 TTLP15 TTLP16 ST2LP18 ST2LP19 ST2LP20 IBLP24 BGLP30	GP3 GP1	BCLP4 GP2 CK2LP12 GP8 SS2LP25

) based on the average vigour index of all three seeds (tomato, cowpea and French bean) on normal media as well as on pH 4.5 media. In the normal medium, 20.00% of the lateritic isolates with mean vigour index of 763.57 belonged to cluster 1, 30.00% of the isolates with mean vigour index of 833.82 fall in cluster 2, 33.33% of the isolates with mean vigour index of 881.32 in cluster 3 and 16.67% of total lateritic rhizobacteria (BCLP4, GP2, CK2LP12, GP8 and SS2LP25) were found with highest average vigour index of 1493.20. (Table 4). In the medium of pH 4.5, the same isolates (BCLP4, GP2, CK2LP12, GP8 and SS2LP25) were found in cluster 4 with 16.67% abundance of the total lateritic rhizobacteria with a mean average vigour index of 1254.92 (Table 4). Screening of the bacterial growth ability on low pH-containing media for these rhizobacteria was carried out; the identification of 13 acid-tolerant rhizobacteria—which not only tolerate acidic stress but also express their antagonistic activity against different plant pathogens as well as plant growth-promoting ability in their naturally stress condition—was selected, which is a major objective of the present study.

3.5. Production of Secondary Metabolites by the Isolates Responsible for Antagonistic Activity as Well as Plant-Growth Promotion

Among all the 30 acid-tolerant isolates, 13 isolates showed comparatively good antagonistic as well as plant-growth promotion activity and hence, were selected for further study. Out of these 30 isolates, 7 were positive for protease and lipase production and 8 isolates were positive for the production of HCN, siderophore and salicylic acid production. Nine isolates were positive for IAA, phosphate solubilisation, amylase and chitinase production (

Table 5. The biochemical and enzymatic assay of native acid-tolerant Pseudomonads and related isolates.

Isolate	Indol Acetic Acid	Phosphate-Solubilisation	Amylase	Hydrogen Cyanide	Siderophore	Salicylic Acid	Chitinase	Protease	Lipase
JMLP2	−	−	−	−	−	+	−	−	−
GP3	+	++	+	++	+	+	+	−	+
BCLP4	++	+++	++	++	+	++	++	+	+
GP2	++	+++	++	++	+	++	++	+	+
GP1	+	++	+	++	+	−	+	+	+
SK2LP10	+	+	+	−	−	+	−	−	−
CK2LP12	++	++	++	+	+	++	++	+	+
GP8	++	+++	++	++	+	++	++	+	+
BGLP21	−	+	−	−	−	−	+	+	−
ST3LP23	+	−	+	+	−	−	−	−	−
IBLP24	−	−	−	−	−	−	+	−	−
SS2LP25	++	++	++	+	+	++	++	+	+
SS2LP27	−	−	−	−	+	−	−	−	−

−: No production, +: Production in less amount, ++: Production in moderate amount and +++: Production in large amount.

). SPSS v 1924.0 was used to test the Pearson correlation study; the stepwise linear regression analysis was done by considering the vigour index augmentation assay for tomato, cowpea and French bean; and the average mycelial inhibition of the three soil-borne fungal plant pathogens (Rhizoctonia solani, Sclerotinia sclerotiorum and Sclerotium rolfsii) as dependent variable and production of secondary metabolites as well as production of hydrolytic enzymes as independent variables. The two-tailed Pearson’s correlation between the plant-growth promotion potentiality of rhizobacterial isolates of the lateritic region and their secondary metabolites and cell wall-degrading enzyme production revealed that IAA production (0.922), phosphate solubilisation (0.788), HCN production (0.856), siderophore production (0.917) and chitinase activity were positively correlated with the average vigour index of the seedlings of the three plants (tomato, cowpea and French bean) at 1% significance level; whereas salicylic acid production (0.882) and lipase production (0.655) were positively correlated with the average vigour index of the same seedlings at 5% significance level (

Table 6. Pearson correlation coefficients of the average vigour index (AVI) (dependent variable) with the producrion of various secondary metabolite (independent variables) of lateritic Pseudomonads and associated isolates (using t-Test).

	IAA	P-SOL	AMY	HCN	SID	SA	CHI	PROT	LIP
AVI	0.922 **	0.788 **	0.527	0.856 **	0.917 **	0.882 **	0.755 **	0.466	0.655 *

IAA: Indol Acetic Acid, P-SOL: Phosphate Solubalization, AMY: Amylase, HCN: Hydrogen Cyanide, SID: Siderophore, SA: Salicylic Acid, CHI: Chitinase, PROT: Protease and LIP: Lipase. ** Correlation is significant at the 0.01 level, * Correlation is significant at the 0.05 level. Stepwise linear regression model of average vigour index (AVI) with the secondary metabolite production of lateritic Pseudomonads isolates.

). The stepwise linear multiple regression model illustrates that the IAA production was the only important predictor for the evaluation of the plant-growth promotion potentiality of the rhizobacterial isolates of the lateritic zone (Equation (1) and Figure 2a). By taking the average mycelial inhibition as a dependant variable, IAA production (0.899), phosphate solubilisation (0.935), HCN production (0.806), siderophore production (0.938), salicylic acid (0.867) and chitinase production (0.772) were positively correlated with the average mycelial inhibition at 1% significance level (

Table 7. Pearson correlation coefficients of average mycelial inhibition (AMI) (dependent variable) with the production of various secondary metabolite (independent variables) of lateritic Pseudomonads and associated isolates (using t-Test).

	IAA	P-SOL	AMY	HCN	SID	SA	CHI	PROT	LIP
AMI	0.899 **	0.935 **	0.544	0.806 **	0.938 **	0.867 **	0.772 **	0.477	0.592

IAA: Indol Acetic Acid, P-SOL: Phosphate Solubalization, AMY: Amylase, HCN: Hydrogen Cyanide, SID: Siderophore, SA: Salicylic Acid, CHI: Chitinase, PROT: Protease and LIP: Lipase. ** Correlation is significant at the 0.01 level. Stepwise linear regression model of average mycelial inhibition (AMI) with the secondary metabolite production of saline Pseudomonads isolates.

). The linear multiple regression model shows that the phosphate solubilisation and siderophore production were the two critical predictors associated with the antagonistic potentiality of the rhizobacterial isolates of the lateritic zones (Equation (2) and Figure 2b).

Y(AVI) = 122.798 + 46.377 (IAA)

(1)

R² = 0.850 and Adjusted R² = 0.836

(2)

Y(AMI) = 12.695 + 1.568 (SID) + 6.045 (P-SOL).

(3)

R² = 0.923 and Adjusted R² = 0.908

(4)

3.6. Identification of Rhizobacterial Isolates by 16S rDNA Sequencing and Phylogenetic Analysis

The genomic DNA of all selected 13 rhizobacteria were extracted, the amplification of the rhizobacterial 16S rDNA regions was performed using the 16S-specific primers 27F and 1492R, and the amplified product was sequenced using Sanger sequencing for the confirmation of rhizobacterial isolates. Sequences thus obtained were confirmed through the BLASTn tool of NCBI. On the basis of the BLAST results, rhizobacterial isolates from lateritic regions of West Bengal had a 99 to 100 per cent match with 16S rDNA sequences of Pseudomonas present in the GenBank database. These sequences were further submitted to the NCBI database and accession numbers were obtained (

Table 8. Identification of different Pseudomonads isolates from red and lateritic areas of West Bengal through the BLAST search of the 16S rDNA sequences.

Sl. No.	Isolate	Location, Latitude, and Longitude	Crops/Local Names of the Plants	Closely Related to	Query Cover	Percent Identity	Best BLAST Hit (Accession No.)	Submitted GenBank (Accession No.)
1	JMLP2	Joypur 23°00′08″ 87°29′48″	Tomato	Pseudomonas aeruginosa	100%	99.74	MT633047.1	MW150989
2	GP3	Bishnupur 22°57′41″ 87°23′51″	Cowpea	Pseudomonas aeruginosa	100%	100	KY885171.1	MW150966
3	BCLP4	Bishnupur 22°57′16″ 87°24′10″	Rice	Pseudomonas fluorescence	100%	99.62	MN256402.1	MW151093
4	GP2	Bishnupur 22°56′27″ 87°24′16″	Rice	Pseudomonas aeruginosa	100%	99.17	KU962126.1	MW150802
5	GP1	Chandrakona-II 22°47′01′′ 87°32′08′′	Rice	Pseudomonas plecoglossicida	100%	99.73	JX841311.1	MW149439
6	SK2LP10	Simlapal 22°53′03′′ 87°04′30′′	Brinjal	Pseudomonas helmanticensis	100%	100	MT605322.1	MW162629
7	CK2LP12	Chandrakona-II 22°46′01′′ 87°31′08′′	Rice	Pseudomonas geniculata	100%	100	MG994997.1	MW151265
8	GP8	Raipur 22°46′01″ 86°57′29″	Ridgegourd	Pseudomonas aeruginosa	100%	99.75	CP033832.1	MW150967
9	BGLP21	Bolpur 23°38′32′′ 87°37′48″	Grass	Pseudomonas plecoglossicida	100%	99.44	KJ819566.1	MW151579
10	ST3LP23	Suri-I 23°55′26″ 87°31′54″	Pumpkin	Pseudomonas baetica	100%	99.33	MT078677.1	MW244838
11	IBLP24	Ilamnagar 23°38′23″ 87°36′16″	Grass	Pseudomonas helmanthicensis	99%	99.72	MN421384.1	MW159691
12	SS2LP25	Suri-I 23°93′25″ 87°52′27″	Rice	Pseudomonas putida	100%	99.46	MT424798.1	MW159690
13	SS2LP27	Suri-I 23°93′25″ 87°52′27″	Rice	Pseudomonas baetica	100%	99.73	LT838076.1	MW164781

).

The isolates were aligned with the type species of Pseudomonas, some non-type sequences based on the BLAST result and Stenotrophomonas maltophilia sequence as outgroups and the phylogenetic tree was constructed. The evolutionary study was carried out by MEGA X, using the neighbour-joining method, using 42 nucleotide sequences. It is evident from Figure 3 that red lateritic isolates, although fall under Pseudomonas sp., have a wide diversity in species level and formed several major and minor clusters and subclusters with global isolates.

3.7. Effect of Lateritic Pseudomonads on Growth Promotion of Tomato and Reduction of Disease Severity

Growth of all the tomato plants under the influence of Pseudomonad isolates had an improved growth, when compared with the control one (Figure 4). Highest germination percentage was recorded in the tomato seeds inoculated with BCLP4 (92.50%) and SS2LP25 (92.50%), followed by GP8 (90.00%), GP2 (85.00%), CK2LP12 (82.50%) and lowest in the control (77.50%) as depicted in

Table 9. Impact of native lateritic Pseudomonads on tomato plants in terms of germination, plant growth and disease severity.

Treatments	Details	Germination %	Root Length (cm)	Shoot Length (cm)	Fresh Root Weight (g)	Fresh Shoot Weight (g)	Pre-Emergence Damping-Off (%)	Post-Emergence Damping-Off (%)
T1	BCLP4	92.50 (74.11) *	6.98 a α	17.40 a	3.33 a	5.40 a	2.78 (9.59) a	5.63 (13.72) a
T2	GP2	85.00 (67.21)	5.64 cd	15.60 bc	2.59 c	4.67 c	5.90 (14.06) a	12.60 (20.79) abc
T3	CK2LP12	82.50 (65.27)	5.15 d	15.20 c	2.32 c	4.32 d	9.03 (17.49) ab	16.96 (24.32) bc
T4	GP8	90.00 (71.57)	6.51 ab	16.63 ab	3.19 ab	5.24 ab	5.56 (13.63) a	5.90 (14.06) a
T5	SS2LP25	92.50 (74.11)	6.07 bc	16.01 bc	2.96 b	5.00 b	5.28 (13.28) a	8.68 (17.14) ab
T6	CONTROL	77.50 (61.68)	4.37 e	10.43 d	2.04 d	3.88 e	19.20(25.99) b	23.81 (29.21) c
SEm (±)		3.024	0.201	0.343	0.087	0.118	4.135	3.578
CD (<0.05)		9.056	0.603	1.026	0.262	0.354	-	10.713

* Values in the parentheses are angular transformed values. Values are the mean of four replications and each replicated value is the mean of 5 plants. ^α Values with different letters are significantly different at p < 0.05.

. Root length of the seedling was noted to be maximum in BCLP4 (6.98 cm), followed by GP8 (6.51 cm), SS2LP25 (6.07 cm), GP2 (5.64 cm), CK2LP12 (5.15 cm) and minimum in the control (4.37 cm) after 28 days of sowing. Similarly, the shoot length of the plant was found to be highest in BCLP4 (17.40 cm), followed by GP8 (16.63 cm), SS2LP25 (16.01 cm), GP2 (15.60 cm), CK2LP12 (15.20 cm) and minimum in the control (10.43 cm). The fresh root weight also taken after 28 days of sowing, was highest in BCLP4 (3.33 g), followed by GP8 (3.19 g), SS2LP25 (2.96 g), GP2 (2.59 g), CK2LP12 (2.32 g) and was found to be minimum in the control (2.04 g). The fresh shoot weight was also found to be maximum in BCLP4 (5.40 g), followed by GP8 (5.24 g), SS2LP25 (5.00 g), GP2 (4.67 g), CK2LP12 (4.32 g) and minimum in the control (3.88 g). The effects of pre-emergence damping-off (%) was minimal in tomato seeds treated with isolate BCLP4 (2.78%), followed by 5.28% in SS2LP25-treated seeds, and was maximal (19.20%) in untreated seeds. A similar pattern was observed for post-emergence damping-off (%) infections, which were found to be least prevalent in BCLP4-treated seeds with a value of 5.63%, followed by GP8-treated seeds with a value of 5.90% and most abundant in control seeds with a value of 23.81%. (Table 9).

3.8. Effect of Lateritic Pseudomonads on Growth Promotion of Cowpea and Reduction of Disease Severity

In cowpea plant, all the isolates were found to enhanced the growth, compared to the untreated plants (Figure 5). As exhibited in

Table 10. Impact of native lateritic Pseudomonads on cowpea plants in terms of germination, plant growth and disease severity.

Treatments	Details	Germination %	Root Length (cm)	Shoot Length (cm)	Fresh Root Weight (g)	Fresh Shoot Weight (g)	Pre-Emergence Damping-Off (%)	Post-Emergence Damping-Off (%)
T1	BCLP4	95.00 (77.08) *	4.39 a α	29.03 a	0.17 a	1.90 a	2.50 (9.10) a	5.28 (13.28) a
T2	GP2	85.00 (67.21)	3.77 bc	22.35 d	0.13 b	1.38 b	9.03 (17.49) ab	13.05 (21.17) abc
T3	CK2LP12	82.50 (65.27)	3.60 cd	21.13 d	0.12 b	1.27 bc	15.28 (23.01) b	18.60 (25.55) bc
T4	GP8	95.00 (77.08)	4.19 a	26.75 b	0.16 a	1.87 a	2.50 (9.10) a	5.56 (13.63) a
T5	SS2LP25	92.50 (74.11)	4.04 ab	24.40 c	0.15 a	1.40 b	5.56 (13.63) a	9.03 (17.49) ab
T6	CONTROL	77.50 (61.68)	3.25 d	18.86 e	0.11 b	1.16 c	16.07 (23.63) b	22.62 (28.40) d
SEm (±)		3.879	0.110	0.709	0.007	0.071	3.576	3.548
CD (<0.05)		11.614	0.328	2.122	0.022	0.212	10.706	10.623

* Values in the bracket are angular transformed values. Values are the mean of four replications and each replicated value is the mean of 5 plants. ^α Values with different letters are significantly different at p < 0.05.

, highest germination percentage was recorded in the tomato seeds inoculated with BCLP4 (95.00%), followed by GP8 (95.00%), SS2LP25 (92.50%), GP2 (85.00%), CK2LP12 (82.50%) and lowest in the control (77.50%). The root length of the seedling was noted to be maximum in BCLP4 (4.39 cm), followed by GP8 (4.19 cm), SS2LP25 (4.04 cm), GP2 (3.77 cm), CK2LP12 (3.60 cm) and minimum in the control (3.25 cm) after 28 days of sowing. Similarly, the shoot length of the plant was found to be highest with BCLP4 (29.03 cm), followed by GP8 (26.75 cm), SS2LP25 (24.40 cm), GP2 (22.35 cm), CK2LP12 (21.13 cm) and minimum in the control (18.86 cm). The fresh root weight also taken after 28 days of sowing, was highest in BCLP4 (0.17 g), followed by GP8 (0.16 g), SS2LP25 (0.15 g), GP2 (0.13 g), CK2LP12 (0.12 g) and minimum in the control (0.11 g). The fresh shoot weight was also found to be maximum in BCLP4 (1.90 g), followed by GP8 (1.87 g), SS2LP25 (1.40 g), GP2 (1.38 g), CK2LP12 (1.27 g) and minimum in the control (1.16 g). The effect of pre-emergence damping-off (%) diseases was found to be minimum in the cowpea seeds treated with isolate BCLP4 (2.50%) and GP8 with a value of 2.50%, followed by 5.56% in SS2LP25-treated seeds and maximum (16.07%) in the untreated seeds. A similar trend was noted in the post-emergence damping-off (%) diseases whereas the minimum was found in BCLP4-treated seeds with a value of 5.28%, followed by 5.56% in the seeds treated with GP8 and the maximum was found with a value of 22.62% in the control (Table 10).

4. Discussion

Soil pH is the best predictor of changes in soil microbial communities and bacterial relative abundance regarding in relation to the diversity of PGPRs is positively affected by soil pH [28]. Apart from directly stimulating plant growth via a variety of mechanisms, the PGPRs also indirectly stimulate plant growth by protecting plants from a variety of soil-borne plant diseases. Pseudomonas spp. have been found with diverse modes of action, including antimicrobial chemical production and the stimulation of plant defence mechanisms [29]. Biologically controlling plant diseases has long been investigated and the introduction of beneficial microbes into soil or the rhizosphere has been advocated for the biological management of soil-borne plant pathogens [30]. In the present study, among the isolated native acid-tolerant rhizobacteria, 10% were shown to be highly antagonistic against three major soil-borne fungal plant pathogens—viz., Rhizoctonia solani, Sclerotinia sclerotiorum and Sclerotium rolfsii. Previous studies reflect that the biocontrol strains of Pseudomonas have a positive effect on plant growth and antagonistic activity [31]. The effect of antagonistic Pseudomonas on the growth of pathogenic fungi that cause root rot was tested in vitro [32]; when used as a bio-priming seed treatment, the long-term effectiveness of these bacterial agents against the occurrence of faba bean root rot was shown to be superior as compared to the control.

In addition to their antagonistic effect on different soil-borne fungal plant pathogens, the isolates of Pseudomonas spp. used in the present study were also shown to improve seedling growth. A significant (p < 0.05) improvement in the growth of tomato, cowpea and French bean seedlings treated with the native Pseudomonas was reported when compared with the untreated control, showing the potential of various species of Pseudomonas in terms of improved plant vigour; thus, this clearly indicates that in addition to controlling plant disease, the isolates used in the present study stimulated seedling growth. In this regard, multiple strains of fluorescent Pseudomonads have been found earlier with the ability to stimulate seed germination as well as the shoot and root development of different crops [32]. In this investigation, nearly 17% of the isolates were found to be effective in promoting plant growth in both normal as well as acidic stress conditions. The native rhizospheric bacteria of red and lateritic regions of West Bengal may have a variety of plant growth-promoting properties that aid in crop growth and also help in the alleviation of abiotic stress, either directly or indirectly.

Many rhizobacteria can produce IAA, which can help plant growth and reduce insect and disease infestations. As a result, IAA production capability is regarded as an essential criterion for identifying potent plant growth-promoting rhizobacteria [33]. The current findings revealed that nine out of thirteen rhizobacterial isolates (GP3, BCLP4, GP2, GP1, SK2LP10, CK2LP12, GP8, ST3LP23 and SS2LP25) have the ability to produce IAA—this was found to be the only important predictor for the evaluation of plant-growth promotion potentiality and might be considered as plant growth-promoting rhizobacteria. In the rhizospheric zone, the PGPRs additionally release different organic acids, which cause phosphate solubilization from insoluble complexes, boosting phosphate availability for plant uptake [34]. Nine rhizobacterial isolates (GP3, BCLP4, GP2, GP1, SK2LP10, CK2LP12, GP8, BGLP21 and SS2LP25) in the current experiment were positive for phosphate solubilization, which was found to be one of the important predictors associated with the antagonistic potentiality of rhizobacterial isolates. Additionally, it has been seen that phosphate solubilization is not only linked with antagonizing fungal pathogens, but also with inducing plant growth [35]. The production of siderophores was positive for GP3, BCLP4, GP2, GP1, CK2LP12, GP8, SS2LP25 and SS2LP27 and siderophore production was found to be one of the most important predictors of antagonistic potentiality of the isolates used in the present study. Siderophores are an important source of accessible iron for plant nutrition and play a role in phytopathogen spatial invasion by creating chelate of ferric iron [Fe (III)] and make it available for the plant cells. Under iron-limiting circumstances, many P. fluorescens isolates are known to release fluorescent and yellow-green, water soluble siderophores [36]. In the current study, eight isolates (GP3, BCLP4, GP2, GP1, CK2LP12, GP8, ST3LP23 and SS2LP25) were found to produce HCN, which is one of the most important metabolites of PGPR. HCN exerts various benefits on plant health, primarily by acting as metabolic inhibitors against phytopathogens. The microbial synthesis of HCN was identified as a key antifungal characteristic for controlling root-infecting fungus [37].

The 16S rDNA gene, which codes for the 30S subunit of bacterial ribosomal RNA and was used to identify rhizobacterial isolates in the current investigation, is found in one or more copies in all bacterial species. Phylogeny based on the 16S rDNA sequence is considered good enough in support of avoiding the complex DNA–DNA hybridization technology. As a result, the 16S rDNA-based phylogeny is currently widely utilised for bacterial identification and taxonomy around the world. Therefore, 16S rDNA sequencing of all rhizobacteria from red and lateritic zone of West Bengal was undertaken, and the taxonomy was determined by comparing all 16S rDNA sequences of similar bacterial type strains collected from the NCBI database.

The plant shoot length, root length and shoot biomass of native Pseudomonads-inoculated plants were significantly increased as compared to the control plants. Among the five efficient native Pseudomonads of the lateritic zone, higher plant growth-promoting potentiality was exhibited by three isolates (BCLP4, GP8 and SS2LP25). The use of these PGPR may be the key to improve farming under acidic stress conditions. In the present agricultural scenario, there is a growing demand on bio-rational approaches for the management of biotic and abiotic stresses without impacting the soil and environmental health. Therefore, the studies in the following directions are required, keeping consideration of the biotic and abiotic stresses in the backdrop of the climate change scenario.