Next Article in Journal
Botulinum Toxin Type A for the Treatment of Auriculotemporal Neuralgia—A Case Series
Previous Article in Journal
Advanced Research on Animal Venoms in China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxins
Volume 15
Issue 4
10.3390/toxins15040273
toxins-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Analysis of the Effect of Plutella xylostella Polycalin and ABCC2 Transporter on Cry1Ac Susceptibility by CRISPR/Cas9-Mediated Knockout

by
Lei Xiong
1,2,3,
Zhaoxia Liu
1,2,3,4,
Jingge Li
1,2,3,
Shuyuan Yao
1,2,3,
Zeyun Li
1,2,3,
Xuanhao Chen
1,2,3,
Lingling Shen
1,2,3,
Zhen Zhang
1,2,3,
Yongbin Li
1,2,3,
Qing Hou
1,2,3,
Yuhang Zhang
1,2,3,
Minsheng You
1,2,3,
Zhiguang Yuchi
5 and
Shijun You
1,2,3,*
1
State Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops, Institute of Applied Ecology, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Ministerial and Provincial Joint Innovation Centre for Safety Production of Cross-Strait Crops, Fujian Agriculture and Forestry University, Fuzhou 350002, China
3
Joint International Research Laboratory of Ecological Pest Control, Ministry of Education, Fuzhou 350002, China
4
College of Oceanology and Food Science, Quanzhou Normal University, Quanzhou 362000, China
5
School of Pharmaceutical Science and Technology, Tianjin University, Tianjin 300072, China
*
Author to whom correspondence should be addressed.
Toxins 2023, 15(4), 273; https://doi.org/10.3390/toxins15040273
Submission received: 10 February 2023 / Revised: 28 March 2023 / Accepted: 4 April 2023 / Published: 6 April 2023
Browse Figures
Versions Notes

Abstract

:
Many insects, including the Plutella xylostella (L.), have developed varying degrees of resistance to many insecticides, including Bacillus thuringiensis (Bt) toxins, the bioinsecticides derived from Bt. The polycalin protein is one of the potential receptors for Bt toxins, and previous studies have confirmed that the Cry1Ac toxin can bind to the polycalin protein of P. xylostella, but whether polycalin is associated with the resistance of Bt toxins remains controversial. In this study, we compared the midgut of larvae from Cry1Ac-susceptible and -resistant strains, and found that the expression of the Pxpolycalin gene was largely reduced in the midgut of the resistant strains. Moreover, the spatial and temporal expression patterns of Pxpolycalin showed that it was mainly expressed in the larval stage and midgut tissue. However, genetic linkage experiments showed that the Pxpolycalin gene and its transcript level were not linked to Cry1Ac resistance, whereas both the PxABCC2 gene and its transcript levels were linked to Cry1Ac resistance. The larvae fed on a diet containing the Cry1Ac toxin showed no significant change in the expression of the Pxpolycalin gene in a short term. Furthermore, the knockout of polycalin and ATP-binding cassette transporter subfamily C2 (ABCC2) genes separately by CRISPR/Cas9 technology resulted in resistance to decreased susceptibility to Cry1Ac toxin. Our results provide new insights into the potential role of polycalin and ABCC2 proteins in Cry1Ac resistance and the mechanism underlying the resistance of insects to Bt toxins.
Keywords:
polycalin; ABCC2; Bacillus thuringiensis; CRISPR/Cas9
Key Contribution: Knockout of the Pxpolycalin or PxABCC2 genes by CRISPR/Cas9 technology made Plutella xylostella resistant to Cry1Ac toxin.

1. Introduction

Bacillus thuringiensis (Bt) is a kind of gram-positive bacterium which is friendly to people and the environment [1]. The active insecticidal ingredient produced by Bt can be used to control many kinds of insect pests, including lepidopteran, coleopteran, dipteran, etc [2]. However, with the long-term use of Bt toxins, a large number of insects have evolved resistance to Bt [3,4], including diamondback moth, Plutella xylostella (L.), the first reported case of Bt resistance in the field [5]. There is a pressing need to develop resistance management strategies accordingly.
Understanding the action mechanism of the Bt protein and insect resistance mechanism to Bt is of great significance for pest control and sustainable use of GM crops. Currently, the mechanism models of Bt mainly include the sequential binding model [6,7] and signal transduction pathway [7,8], among which the binding of toxin and receptor proteins is undoubtedly a key link for Bt toxins to play a role in. In addition, Guo et al. [9,10,11] found that the MAPK signaling pathway regulates the Bt resistance of P. xylostella by regulating the differential expression of ALP, APN, and ABCC genes, while MAPK [10,12] is regulated by the juvenile hormone (JH) [13] and 20-hydroxyecdysone (20E). At present, Bt toxin receptors have been reported mainly including aminopeptidase (APN) [14,15,16,17,18], cadherin/cadherin-like (CAD) [19,20,21,22,23,24,25], alkaline phosphatase (ALP) [26,27] and ATP binding cassette (ABC) transporter [28,29,30,31,32,33,34,35,36,37]. With the development of further research, an increasing number of receptor proteins, genes, and resistance pathways [38,39,40] have been reported to be involved in the toxicity of Bt to insects and the resistance of insects to Bt toxins, including polycalin in this study.
In 2016, Mauchamp et al. [41] identified a new lipid carrier protein in silkworm for the first time by two-dimensional electrophoresis and mass spectrometry, and named it polycalin (Pentadecacalin), where polycalin is a term coined [41] to describe proteins with multiple, lipocalin-like domains. Polycalin proteins of Bombyx mori [42], Helicoverpa armigera [43,44,45,46,47], P. xylostella, [48] and Spodoptera exigua [49] were demonstrated to bind to Bt Cry toxin by mass spectrometry or in vitro binding experiments. Similarly, heterologously expressed polycalin of H. armigera [44] showed a high affinity for the Cry2Aa toxin, and the mortality of neonate larvae decreased by 31.84% after ingestion of polycalin antisera and the Cry1Ac toxin. Using Western blot and Ligand blot experiments, Zhan et al. [50] first confirmed that the polycalin protein of P. xylostella has the property of binding to the Cry1Ac toxin, and the addition of Pxpolycalinf to Sf9 cells expressing ATP-binding cassette transporter subfamily C2 (ABCC2) significantly increased the toxicity of Cry1Ac to cells [51]. As a potential receptor for the Cry1Ac toxin in P. xylostella, the role of Pxpolycalin in Bt resistance in vivo remains to be studied.
In this study, we found that the expression level of the Pxpolycalin gene in the Cry1Ac-resistant strain was significantly lower than that in the Cry1Ac-susceptible strain, and the transcription level of the Pxpolycalin gene did not change significantly in a short term after feeding on the Bt Cry1Ac toxin. However, genetic linkage experiments showed that the Pxpolycalin gene and its transcript level were not linked to Cry1Ac resistance, whereas both the PxABCC2 gene and its transcript levels were linked to Cry1Ac resistance. The Pxpolycalin and PxABCC2 homozygous mutant strains were obtained using the CRISPR/Cas9 system, respectively, and bioassay experiments showed that these two homozygous mutant strains resulted in increased resistance and decreased susceptibility to the Cry1Ac toxin, indicating the possibility that Pxpolycalin and PxABCC2 genes are involved in Cry1Ac resistance. Further studies are needed to determine how they are involved in the resistance of P. xylostella. These findings will advance our understanding of polycalin function and contribute to the development of strategies for managing insect resistance.

2. Results

2.1. Pxpolycalin Sequence Comparison between P. xylostella Strains

Full-length Pxpolycalin transcripts were amplified by PCR and sequenced with two pairs of specific primers using a midgut cDNA template generated from the Cry1Ac-susceptible strain (G88) and Cry1Ac-resistant strain (Cry1S1000). After sequencing, the results of gene cloning were spliced and an 8829 bp (OP381323) fragment was obtained and encoded a predicted 2942 aa protein. Between the susceptible and resistant strains, we found a total of three fixed amino acid variations, which were R/L1255L, R/Q2097Q, and A/T2942T (Figure 1A) between the two strains. Our study found that there were two types of amino acids at these three sites in eight randomly selected larvae of the G88 strain, but only one amino acid was selected and retained at the same site of the Cry1S1000 strain, and they were distributed in exons 22, 35 and 49 (Figure 1A). Domain analysis showed that the Pxpolycalin gene contained 14 ligand binding sites, 1 lipocalin site, and 15 lipocalin-like structure (Figure 1B), and the second point mutation (R/Q2097Q) was on the ligand binding site. In addition, using sequence amplification and sequencing techniques, we amplified gDNA fragments specific for Pxpolycalin and PxABCC2 genes in G88 and Cry1S1000 strains (Figure 2 and Figure S1).

2.2. Phylogenetic Analysis of Pxpolycalin in P. xylostella

The amino acid sequence encoded by Pxpolycalin was used to construct a phylogenetic tree with polycalin proteins of 16 other insect species. Referring to the bootstrap of 1000 replications, Pxpolycalin clustered with the existing polycalin orthologues in lepidoptera but was more distantly related to insects such as H. armigera, S. exigua, and Mamestra configurata (Figure 3). In addition, it can be found from Figure 3 that Pxpolycalin was the most distantly related to Anopheles Sinensis of Diptera and they belong to two distinct clades entirely. Based on this, we hypothesized that the polycalin of P. xylostella, similar to the polycalin of other Lepidopteran insects, might also be the receptor protein of the Bt Cry toxin.

2.3. Spatio-Temporal Expression Patterns of the Pxpolycalin Gene in G88 and Cry1S1000 Strains

The qRT-PCR (qPCR) was conducted to explore the relative expression patterns of the Pxpolycalin gene in the midgut of the third instar larvae, different developmental stages, and different larva tissues with specific primers in the conserved region. The results showed a higher relative expression level in the larvae midgut of the G88-susceptible strain than in the Cry1S1000-resistant strain (Figure 4), implicating a potential connection between the Pxpolycalin gene and the resistance to Bt toxins. The developmental stages expression profile showed that the Pxpolycalin gene was expressed in almost all developmental stages collected, among which the susceptible strain had the highest expression at the third instar, while the resistant strain at the second instar and both strains had the lowest expression at the pupal stage, followed by the adults. In contrast, the expression level of this gene in the larval stage was about twice that in the adult stage, and the fold difference was higher in the resistant strain (Figure 5A,C). Similarly, analysis of expression patterns in different larval tissues showed that the Pxpolycalin gene was highly expressed mainly in the midgut, but almost unexpressed or expressed very little in other tissues, such as integument, head, malpighian tubules, and silk glands, especially in resistant strains (Figure 5B,D).

2.4. Induction of PxABCC2 and Pxpolycalin by Cry1Ac Toxin in G88 Strain

Transcription levels of PxABCC2 and Pxpolycalin genes in the G88 susceptible strain increased significantly from 6 to 36 h and reached a peak at 36 h after Cry1Ac toxin treatment. Among these, a transient reduction in transcript levels exists for both genes due to induction treatment of the Cry1Ac toxin. These results indicated that feeding on Cry1Ac toxin could inhibit the expression of PxABCC2 and Pxpolycalin genes transitorily, which further supports that these two genes may be involved in resistance to the Bt Cry1Ac toxin in P. xylostella (Figure 6).

2.5. Genetic Linkage Analysis of the Pxpolycalin and PxABCC2 Genes

Since that we identified a 3 bp deletion and 1 bp insertion in the Cry1S1000 strain (Figure 2 and Figure S1), to test the linkage between the Pxpolycalin and Cry1Ac resistance, we designed specific primers to amplify the gDNA fragment containing the mutation to distinguish the susceptible-allele (SPoSPo) and resistant-allele (RPoRPo) genotypes. Using specific primers, we also amplified the gDNA of the PxABCC2 gene by PCR in both strains. Their lengths (479 bp/552 bp) were significantly different, which allowed us to identify susceptible (SA2SA2) and resistant (RA2RA2) strains by genotypes. F1 progeny produced by crossing male-resistant with female-susceptible strains was then backcrossed with resistant strain to produce backcross families a and b. Although the genotypes of RPoRPo:RPoSPo were detected in a near 1:1 in the without-Cry1Ac-selected backcross families a and b, genotype RPoSPo was also detected in the Cry1Ac-selected group (Table 1), suggesting that the Pxpolycalin gene mutation was not linked to Cry1Ac resistance. Genotyping of 24 without-Cry1Ac-selected adults from the backcross family a and b revealed that the ratio of RA2RA2:RA2SA2 among them was close to a 1:1 random separation ratio, including 14:10 (Fisher’s exact test, χ2 = 11.46, df = 1, p < 0.001) for backcross family a and 15:9 (Fisher’s exact test, χ2 = 12.86, df = 1, p < 0.000) for backcross family b (Table S1), indicating that there is co-segregation between the PxABCC2 gene mutation and Cry1Ac resistance, that is, there is a genetic linkage relationship.
Similarly, we also investigated the co-segregation between Pxpolycalin and PxABCC2 genes’ expression levels and Cry1Ac resistance by genetic linkage. Firstly, F1 progeny and backcross family a/b were obtained and selected on an artificial diet with or without a diagnostic dose of the Cry1Ac toxin. The expression level of the Pxpolycalin gene was not significantly co-segregated in both backcross families, with-Cry1Ac-selected and without-Cry1Ac-selected (Figure S2A), suggesting that the Pxpolycalin gene expression level was also not linked to Cry1Ac resistance. The qPCR results showed that the expression level of PxABCC2 in F1 larvae was similar to that of the G88 susceptible strain, indicating that the resistance of Cry1S1000 was recessive. However, the expression levels of backcross families a and b with-Cry1Ac-selected or without-Cry1Ac-selected showed two distinct groups. Among the two backcross families, one group had a significantly reduced expression level similar to Cry1S1000, while the other group had an 8:12 (Fisher’s exact test, χ2 = 10.00, df = 1, p < 0.05) separation ratio (Figure S2B), indicating a tight genetic linkage between PxABCC2 and Cry1Ac resistance in P. xylostella.

2.6. Mutagenesis of Pxpolycalin and PxABCC2 Mediated by CRISPR/Cas9

To knock out Pxpolycalin and PxABCC2, a mixture of sgRNA and Cas9 protein was injected into fresh eggs laid in less than 15 min from the G88 strain, in which the homozygous mutant of PxABCC2 (A3KO28) (Figure S3) was derived from the work of Liu et al., [31], and the PxABCC2 mutant strain has been stored in the laboratory since 2020. For Pxpolycalin, only one homozygous mutant strain with a 16 bp insertion and 21 bp deletion in exon 2 was generated (PoKO21KI16) (Figure 7).

2.7. Effect of Pxpolycalin and PxABCC2 Mutations on the Susceptibility of Cry1Ac Toxin in P. xylostella

To determine the susceptibility of Pxpolycalin and PxABCC2 genes mutations to Cry1Ac toxin, we used two concentrations (0.50 and 0.25 μg/mL) to bioassay two single homozygous mutant strains (PoKO21KI16 and A3KO28). The results indicated that mutations in these two genes led to different degrees of resistance to Cry1Ac toxin in P. xylostella larvae. Specifically, the mortality rate of the A3KO28 strain (14.00 ± 2.00%) was significantly lower than that of the PoKO21KI16 strain (77.55 ± 5.00%), and the mortality of both strains was significantly lower than that of wild type (G88) (Figure 8). The bioassay results suggest that Pxpolycalin and PxABCC2 genes may play a role in the resistance of P. xylostella to the Cry1Ac toxin.

3. Discussion

The mechanism of action of Bt Cry toxins and the resistance mechanism of insects to Bt are both very complex processes. At present, the two commonly accepted models are sequential binding model [7,52,53] and the signal transduction model [7,8,54], among which the binding of Bt toxins to the receptor in insect midgut is undoubtedly considered to be the key to its action. Up to now, several insect midgut proteins, such as cadherin [8,20,55], aminopeptidase N [18,56,57], alkaline phosphatase [27,58] and ABC transporter [29,32,59,60,61], have been reported to act as receptors for Bt toxins in the process of Bt action. The polycalin protein involved in this study has been shown to bind to Cry1Ac [43,51] and Cry2Aa [44] toxins in vitro in previous studies, which indicates that it may also act as a receptor protein similar to other known receptors. Since the binding of the protein to the toxin does not prove that the protein is the receptor protein of the toxin [51], the role of the polycalin protein in the resistance of P. xylostella to Bt remains to be further studied.
Studies have shown that structural mutations of receptor proteins or changes in gene expression levels can be the cause of insect resistance to Bt. For example, Xiao et al. [29] showed that the wrong cleavage of HaABCC2 was related to the resistance of H. armigera to Bt toxins. The study of Liu et al. [31] also found that there were more ABCC2 transcripts in the Cry1S1000 resistance of P. xylostella, and the double mutation of PxABCC2 and PxABCC3 led to a high level of resistance to the Cry1Ac toxin in P. xylostella larvae. In addition, some studies have shown that changes in the expression of ABCH1 and ABCG genes are related to Bt resistance [9,62]. In this study, we found a few amino acid variants in susceptible and resistant strains, and it is still unknown whether they play a role in Bt resistance. Subsequently, the relationship between this amino acid sites and Bt resistance can be verified by site-directed mutagensis. In addition, we also found fixed variants in the intron portion of the Pxpolycalin gene and the PxABCC2 gene between G88-susceptible and Cry1S1000-resistant strains, providing us with a simple method to distinguish susceptible and resistant strains by PCR amplification. In previous studies [31], we have confirmed that the PxABCC2 gene of the Cry1S1000 resistant strain has multiple alternative splicing patterns, among which different mutation types lead to the premature translation termination of the PxABCC2 protein. Therefore, we speculate that the transcription error may lead to the generation of resistance. Unfortunately, no significant changes in sequence length were found in the eight individuals of resistant strain amplified by us. Whether the differences in intron length of the Pxpolycalin gene contribute to the development of resistance or whether the Pxpolycalin gene is involved in Bt resistance in some other way needs to be further studied.
The expression level of the Pxpolycalin gene in the susceptible strain was significantly higher than that in the resistant strain. In addition, after treating P. xylostella larvae with the Cry1Ac toxin, it was found that the expression level of the Pxpolycalin gene was transiently inhibited by the Cry1Ac toxin in a short period, but the expression level of the Pxpolycalin gene increased with the increase of larval instar. In this regard, the Pxpolycalin gene has the characteristics of being a potential receptor for the Bt Cry1Ac toxin.
The overexpression and inhibition of receptor proteins are commonly used to study the role of Bt toxins binding proteins in the mode of action of Bt toxins. For example, overexpression of the PxABCC2 gene in Drosophila melanogaster results in increased susceptibility to the Bt Cry1Ac toxin [63]. Overexpression of the SlABCC2 gene in Sf9 cells also increased the toxicity of Cry1Ca toxin to cells [33]. The overexpression of ABCG10, ABCH3, and ABCH4 in Aphis craccivora promoted the tolerance to imidacloprid [61]. In addition, downregulation of the PxABCB1 gene expression significantly reduced the susceptibility of P. xylostella larvae to the Cry1Ac toxin [64]. The susceptibility of Leptinotarsa decemlineata larvae to the Cry3Aa toxin was reduced by silencing the expression of the ABC transporter using RNAi technology [65]. Silencing of CsABCC2 also significantly reduced the susceptibility of the Cry1C toxin [66]. Furthermore, the knockdown of the APN gene also reduced the susceptibility to Cry1Ab, Cry1Ac, and Cry1Ca toxins [18]. Silencing the expression of the HzALP2 gene in Helicoverpa zea larvae can improve the survival rate of larvae in a diet containing the Cry1Ac toxin [27]. CRISPR/Cas9-mediated mutation of ABC transporter ABCA2 induces different degrees of resistance to the Cry2Ab toxin in Trichoplusia ni [67] and Pectinophora gossypiella [68]. A homozygous mutation of the OfCad gene generated by CRISPR/Cas9 caused the Ostrinia furnacalis to exhibit moderate and low levels of resistance to Cry1Ac and Cry1Aa toxins, respectively [69]. It has also been shown that simultaneous knockdown and knockout of HaABCB6 can increase the susceptibility of H. armigery larvae to gossypol [70].
The polycalin protein has been shown to bind Bt toxins in vitro in several studies [43,44,51], including P. xylostella [51]. Studies have shown that when H. armigera larvae were fed with polycalin antibody and Cry2Aa or Cry1Ac toxins at the same time, the mortality rate of the larvae was significantly lower than that of the group fed Cry2Aa [44] and Cry1Ac [43] toxins alone. Meanwhile, the mortality of P. xylostella larvae was also reduced after feeding on the toxin containing the polycalin antibody and Cry1Ac toxin [51]. The most common type of resistance to the Bt toxin in Lepidopteran pests is “mode 1”. “Mode 1” resistance must have a high level of resistance to at least one Cry1Ac toxin, be recessive, reduce midgut mucosal binding to at least one Cry1A toxin, and have little or no chance of cross-resistance to Cry1C. However, previous studies have shown that polycalin can bind to both Cry1 and Cry2 toxins. In addition, we found that neither the Pxpolycalin gene nor its transcript level were associated with Cry1Ac resistance, but only the PxABCC2 gene and its transcript level were associated with Cry1Ac resistance, suggesting that polycalin is not a traditional Bt toxins receptor and may play a role in Bt resistance in insects in another way.
Although Pxpolycalin has been confirmed to bind Bt toxins in vitro, CRISPR/Cas9-based in vivo knockout technology is undoubtedly the most direct evidence to prove whether it plays a role in Bt Cry1Ac resistance. ABCC2 is a widely reported Bt toxins receptor that has been reported to function in a variety of insects. Recent studies have shown that homozygous strains with simultaneous mutations in several Bt toxins receptors obtained by genetic hybridization can develop strong resistance. However, a double mutant strain (Po-C2KO) based on the existing Pxpolycalin (PoKO21KI16) and PxABCC2 (A3KO28) homozygous mutant strains did not show the same synergistic effect (Data Unpublished). Specifically, when treated with 0.5 μg/mL Cry1Ac toxin, the susceptibility of the Pxpolycalin and PxABCC2 genes mutation to Cry1Ac toxin decreased by 22.50% and 86.00%, respectively, compared to the control group (G88); while the susceptibility to Cry1Ac was increased in the strain with those two genes double mutation compared to the strain with just a single PxABCC2 mutation. It seems that the Pxpolycalin gene does not function as a receptor in the Bt resistance of P. xylostella, but through other pathways, which need to be further investigated.
In conclusion, by qPCR analysis of the transcript levels in the midgut of Cry1Ac-susceptible and -resistant strains, we found that the transcript levels of the Pxpolycalin gene were significantly higher in the G88 strain than in the Cry1S1000 strain, and the results of the temporal and spatial expression pattern analysis of this gene in the two strains also showed that the Pxpolycalin gene is highly expressed mainly in the larval stage and midgut tissues. In addition, after feeding on an artificial diet containing the Cry1Ac toxin, the expression level of the Pxpolycalin gene of P. xylostella larvae did not change significantly in a short term and then showed an increasing trend with the increase of larval instar. The results of genetic linkage analysis showed that the Pxpolycalin gene and its transcript level were not linked to Cry1Ac resistance, whereas both the PxABCC2 gene and its transcript levels were linked to Cry1Ac resistance. A single mutation in the Pxpolycalin or PxABCC2 genes mediated by the CRISPR/Cas9 system resulted in decreased susceptibility of P. xylostella larvae to Cry1Ac toxin. Specifically, when treated with 0.50 μg/mL Cry1Ac toxin, compared with the control strain G88, the mortality of the homozygous strain with a single mutation of the two genes decreased by 1.29 times and 7.14 times, respectively. In total, our results provide new insights into the potential role of Pxpolycalin and PxABCC2 proteins in Cry1Ac resistance, where PxABCC2 may function as a Bt receptor and Pxpolycalin through other pathways, which helps to enrich and refine the resistance mechanism of insects to Bt toxins.

4. Materials and Methods

4.1. Insect Strain and Rearing

The G88 susceptible strain and Cry1S1000 resistant strain [31] of P. xylostella were provided by Dr. Anthony M. Shelton in 2016 [71]. G88 was susceptible to the Cry1Ac toxin and Cry1S1000 was resistant to the Cry1Ac toxin. The larvae were fed an artificial diet at a photoperiod of 14 light: 10 dark, 26 ± 1 °C temperature, and 60 ± 5% relative humidity. The adults were given 10% honey water for supplemental nutrition during mating.

4.2. Bt toxins and Bioassays

The protoxin Cry1Ac used in this experiment was produced by Btk strain HD-73. Specific purification methods refer to the previous study [72], and the concentration of Cry1Ac was redetermined by the Bradford method (Solarbio, Beijing, China) before each use of the toxin. An artificial diet overlay assay [31] was used to determine the susceptibility of both mutant and wildtype strains of P. xylostella. Bioassays were performed on five replicates for seven different concentrations of the Cry1Ac toxin, with an insecticide-free control.

4.3. Identification of Sequence Differences between G88 and Cry1S1000 Strains

Based on the predicted Pxpolycalin gene sequence of the P. xylostella genome database website (http://59.79.254.1/DBM/index.php; accessed on 1 July 2021; Px005969) and the Pxpolycalin gene sequence in NCBI (MF138149), specific primers were designed and the adult cDNA of P. xylostella was used as a template for PCR amplification. Specifically, eight adults from each strain were randomly collected for total RNA extraction. For specific extraction methods, refer to the manual’s instructions ((Eastep Super Total RNA Extraction Kit) Promega, Shanghai, China). FastKing gDNA Dispelling RT SuperMix (TianGen, Beijing, China) was used to synthesize cDNA for subsequent PCR amplification with the reverse transcription program as follows: 42 °C for 15 min and 95 °C for 3 min. Two pairs of specific primers (Poly1F: 5′-CGATTAGTGGTGGCATGGGTG-3′, Poly1R: 5′-CTGCACGTTGTTCAGATCCTGG-3′; Poly2F: 5′-GGGAAACTCAGACAAGCTATTGGG-3′; and Poly2R: 5′-CTAAGCAAATACTCTTTGCATGAGCG-3′) were used to amplify the whole length of Pxpolycalin in P. xylostella by PCR.

4.4. Construction of Phylogenetic Tree

The amino acid sequence encoded by Pxpolycalin was compared with other insect proteins on the NCBI website, and the phylogenetic tree was constructed by neighbor-joining (NJ) with 1,000 bootstrap replications using the MEGA 7.0 software.

4.5. Spatio-Temporal Expression Patterns of polycalin in P. xylostella

Samples of G88 susceptible and Cry1S1000 resistant strains at different developmental stages (egg, 1st to 4th instar larva, pupa, and male and female adult) and different tissues (midgut, epidermis, head, malpighian tubule, and silk gland) were collected uniformly, and the samples of different tissues were anatomized in PBS. After all the samples were collected, the total RNA was extracted and reversely transcribed into cDNA. Specific primers (qpolycalin-F: 5′-TGGACAGCGTGTCGTATTGCC-3′, qpolycalin-R: 5′-GGAGTGGAAGAGACGTCATAGAAGG-3′) were used to identify the differential expression of Pxpolycalin in different developmental stages and tissues [73], and statistically significant differences were analyzed with one-way ANOVA (Tukey’s test for multiple comparisons). The qRT-PCR was conducted on CFX96 (BioRad, Hercules, CA, USA) with a volume of 20 μL (mix 10 μL, 0.4 μL of each primer, RNase free water 7.2 μL, cDNA 2 μL), and the running procedure was as follows: 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 50 s.

4.6. Cry1Ac Treatment

To investigate whether the transcription level of the Pxpolycalin gene can be induced by the Cry1Ac toxin, their transcript levels in 3rd larvae following exposure to an LC10 (0.10 μg/mL) dose of the Cry1Ac toxin were determined. According to the present research, the induction of the Pxpolycalin gene in response to the Cry1Ac toxin dissolved in PBS was determined by treating the early 3rd instar of the G88 strain. Five time points (6 h, 12 h, 24 h, 36 h, 48 h) after the Cry1Ac treatment were used to examine the effect on the Pxpolycalin gene. Larvae treated with PBS were used as the control. At each time point, four × 10 surviving larvae treated with Cry1Ac toxin or PBS were collected, removed quickly to liquid nitrogen, and stored at −80 °C until RNA extraction.

4.7. Genetic Linkage Analysis

The G88 and Cry1S1000 strains were used for genetic linkage analysis and the hybridization strategy is shown in Figure 9. In simple terms, the hybrid F1 generation produced by the mating of the male Cry1S1000 adult [67,74] and female G88 adult was backcrossed with the Cry1S1000 resistant strain. Half of the backcross family a and b were treated with 0.5 μg/mL [31] Cry1Ac toxin, and the other half together with the surviving larvae/adults from the treated group were sampled directly. For linkage analysis between the expression levels of Pxpolycalin and Cry1Ac resistance, we tested Pxpolycalin transcript levels in each larva from F1, backcrossed a and b of the Cry1Ac toxin both treated and untreated by qPCR, as described above. For linkage analysis between the Pxpolycalin gene and Cry1Ac resistance, a 340-bp/338-bp gDNA fragment of Pxpolycalin was amplified from each adult of the backcross family a and b by PCR cloning with a pair of gene-specific primers (gPolycalin-F: 5′-TGGCTAGCGATGATAACAGTGC-3′, gPolycalin-R: 5′-CTGCACGTTGTTCAGATCCTGG-3′); (gABCC2-F: 5′-CATGGCTACTGCTACTACG-3′, gABCC2-R: 5′-CTTTCCAATGAAACCAAC-3′) and the amplicons were subsequently sequenced to distinguish the resistant- and susceptible-allele types.

4.8. Preparation of sgRNA and Cas9 Protein

According to the principle of 5′-N20NGG-3′ (with the PAM underlined), the recognition site of sgRNA was designed on the exon 2 of the Pxpolycalin gene, and the potential off-target effect was analyzed by Cas-OFFinder (http://www.rgenome.net/cas-offinder/; accessed on 16 May 2022). KOD-401 (TOYOBO, Osaka, Japan) was used for PCR amplification in vitro, and the reaction system was 200 μL: 4 μL KOD-Plus-Neo, 20 μL 10 × PCR Buffer, 20 μL 2 mM dNTPs, 12 μL 25 mM MgSO4, 6 μL upstream and downstream primers (sgRNA-F: 5′- TAATACGACTCACTATAGGCACCCCCAGTGCGAGTGAGCGTTTTAGAGCTAG-3′, sgRNA-R: 5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA-3′), and 132 μL ddH2O. The reaction procedure is as follows: 98 °C for 2 min, 35 cycles at 98 °C for 10 s, 55 °C for 30 s, and 68 °C for 30 s. At 68 °C, the PCR amplification products were extended for the final 5 min. Finally, the PCR amplification products were recycled with the gel extraction kit (Omega, Morgan Hill, GA, USA), and the recycled products were the sgRNA in vitro transcription template. In vitro transcription of sgRNA was performed using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA), in which 250 ng of template was used, and DNase I was added after the reaction to remove the DNA template. Then, the method of phenol: chloroform: isopentyl alcohol was used to purify sgRNA. After the quality of the purified RNA was confirmed by electrophoresis, it was stored at −80 °C, and the concentration was redetermined before each use. The Cas9 protein used in this experiment was purchased from the GeneScript Corporation (GeneScript, Nanjing, China).

4.9. Microinjection of P. xylostella Embryos and Screening of Homozygous Strains

The mixture containing 200 ng/μL Cas9 protein and 300 ng/μL sgRNA was injected into fresh eggs produced within 15 min using the IM 300 Microinjector (Narishige, Tokyo, Japan) mounted on the SZX16 Stereo Microscope (Olympus, Tokyo, Japan). The surviving G0 generation was screened for mutant lines according to the homozygous mutant line screening strategy as shown in Figure 10, that is, the injected adults of the G0 generation were crossed with the G88 strain, and G0 adult gDNA was extracted using TIANamp Genomic DNA Kit (Tiangen, Beijing, China) after spawning, and the mutant type was detected by sequencing (Polycalin-f: 5′-TTCACATCTACAACATGGAACGAGG-3′, Polycalin-r: 5′-CATTGCTCGTGAGTTTAGTAGG-3′). The offspring of the same mutation type was further selected to obtain the homozygous mutant line.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/toxins15040273/s1, Figure S1. RA2 mutation of PxABCC2 from the Cry1S1000 strain. Alignment of gDNA sequences of the SA2 allele and the RA2 allele. Sequences highlighted in orange are the exons 6 and 7; Figure S2. Analysis of the linkage between the resistance to Cry1Ac and reduced Pxpolycalin (A) and PxABCC2 (B) expression levels in the Cry1S1000 strain of P. xylostella. Expression levels of PxABCC2 and Pxpolycalin in individual midgut from larvae of the F1, without Cry1Ac-selected (untreated) and with Cry1Ac-selected (treated) backcross families (backcross family a and b) are shown relative to levels in the susceptible (G88) strain; Figure S3. Mutagenesis of PxABCC2 induced by CRISPR/Cas9. Partial sequences from the G88 and homozygous PxABCC2 mutant showing the indels at the target sequence (ABCC2-sg2) in exon 3 of PxABCC2; Table S1. Genetic linkage of the RA2 allele with Cry1Ac resistance.

Author Contributions

Conceptualization, L.X., M.Y. and S.Y. (Shijun You); Data curation, L.X., Z.Z. and S.Y. (Shijun You); Formal analysis, L.X., Z.L. (Zhaoxia Liu), J.L., S.Y. (Shuyuan Yao), X.C., L.S., Z.Z., Y.L., Q.H. and Y.Z.; Funding acquisition, S.Y. (Shijun You); Investigation, L.X., Z.L. (Zhaoxia Liu), Z.L. (Zeyun Li), X.C., L.S. and Z.Z.; Methodology, Z.L. (Zhaoxia Liu), J.L., S.Y. (Shuyuan Yao), Z.L. (Zeyun Li), X.C., L.S., Z.Z., Y.L., Q.H., Y.Z. and Z.Y.; Project administration, M.Y., Z.Y. and S.Y. (Shijun You); Resources, L.X., Z.L. (Zhaoxia Liu), J.L., S.Y. (Shuyuan Yao), Z.L. (Zeyun Li) and Y.L.; Software, L.X., Z.L. (Zhaoxia Liu), J.L., S.Y. (Shuyuan Yao), Z.L. (Zeyun Li), X.C., L.S., Z.Z., Q.H. and Y.Z.; Supervision, Y.L., M.Y., Z.Y. and S.Y. (Shijun You); Validation, L.X., J.L., S.Y. (Shuyuan Yao), Z.L. (Zeyun Li), X.C., L.S., Z.Z., Y.L., Q.H. and Y.Z.; Visualization, L.X., M.Y., Z.Y. and S.Y. (Shijun You); Writing—original draft, L.X., Z.L. (Zhaoxia Liu), J.L., S.Y. (Shuyuan Yao), Z.L. (Zeyun Li), X.C., L.S., Z.Z., Y.L., Q.H., Y.Z., M.Y., Z.Y. and S.Y. (Shijun You); Writing—review and editing, L.X., M.Y., Z.Y. and S.Y. (Shijun You). All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the central government-guided local science and technology development projects (2022L3087), National Natural Science Foundation of China (No. 31972271), the Fujian Natural Science Fund for Distinguished Young Scholars (2022J06013), the Outstanding Young Scientific Research Talents Program of Fujian Agriculture and Forestry University (xjq201905).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Sequence data of Pxpolycalin have been deposited in the National Center for Biotechnology Information. All other relevant data are included in the main text and Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Usta, C. Microorganisms in Biological Pest Control—A Review (Bacterial Toxin Application and Effect of Environmental Factors); Silva-Opps, M., Ed.; InTech: Rijeka, Croatia, 1976; pp. 515–518. [Google Scholar]
  2. Palma, L.; Muñoz, D.; Berry, C.; Murillo, J.; Caballero, P. Bacillus thuringiensis toxins: An overview of their biocidal activity. Toxins 2014, 6, 3296–3325. [Google Scholar] [CrossRef] [Green Version]
  3. Tabashnik, B.E.; Carriere, Y. Surge in insect resistance to transgenic crops and prospects for sustainability. Nat. Biotechnol. 2017, 35, 926–935. [Google Scholar] [CrossRef] [PubMed]
  4. Bravo, A.; Likitvivatanavong, S.; Gill, S.S.; Soberon, M. Bacillus thuringiensis: A story of a successful bioinsecticide. Insect Biochem. Mol. Biol. 2011, 41, 423–431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Tabashnik, B.E.; Cushing, N.L.; Finson, N.; Johnson, M.W. Field development of resistance to Bacillus thuringiensis in diamondback moth (Lepidoptera: Plutellidae). J. Econ. Entomol. 1990, 83, 1671–1676. [Google Scholar] [CrossRef]
  6. Bravo, A.; Gill, S.S.; Soberon, M. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 2007, 49, 423–435. [Google Scholar] [CrossRef] [Green Version]
  7. Melo, A.L.; Soccol, V.T.; Soccol, C.R. Bacillus thuringiensis: Mechanism of action, resistance, and new applications: A review. Crit. Rev. Biotechnol. 2016, 36, 317–326. [Google Scholar] [CrossRef]
  8. Zhang, X.; Candas, M.; Griko, N.B.; Rose-Young, L.; Bulla, L.A. Cytotoxicity of Bacillus thuringiensis Cry1Ab toxin depends on specific binding of the toxin to the cadherin receptor BT-R1 expressed in insect cells. Cell Death Differ. 2005, 12, 1407–1416. [Google Scholar] [CrossRef] [Green Version]
  9. Guo, Z.; Kang, S.; Chen, D.F.; Wu, Q.J.; Wang, S.; Xie, W.; Zhu, X.G.; Baxter, S.W.; Zhou, X.; Jurat-Fuentes, J.L.; et al. MAPK signaling pathway alters expression of midgut ALP and ABCC genes and causes resistance to Bacillus thuringiensis Cry1Ac toxin in diamondback moth. PLoS Genet. 2015, 11, e1005124. [Google Scholar] [CrossRef] [Green Version]
  10. Guo, Z.; Kang, S.; Sun, D.; Gong, L.J.; Zhou, J.L.; Qin, J.Y.; Guo, L.; Zhu, L.H.; Bai, Y.; Ye, F.; et al. MAPK-dependent hormonal signaling plasticity contributes to overcoming Bacillus thuringiensis toxin action in an insect host. Nat. Commun. 2020, 11, 3003. [Google Scholar] [CrossRef]
  11. Guo, L.; Cheng, Z.Q.; Qin, J.Y.; Sun, D.; Wang, S.L.; Wu, Q.J.; Crickmore, N.; Zhou, X.G.; Bravo, A.; Soberon, M.; et al. MAPK-mediated transcription factor GATAd contributes to Cry1Ac resistance in diamondback moth by reducing PxmALP expression. PLoS Genet. 2022, 18, e1010037. [Google Scholar] [CrossRef]
  12. Sun, D.; Zhu, L.; Guo, L.; Wang, S.; Wu, Q.; Crickmore, N.; Zhou, X.; Bravo, A.; Soberon, M.; Guo, Z.; et al. A versatile contribution of both aminopeptidases N and ABC transporters to Bt Cry1Ac toxicity in the diamondback moth. BMC Biol. 2022, 20, 33. [Google Scholar] [CrossRef]
  13. Jha, S.; Rollins, M.G.; Fuchs, G.; Procter, D.J.; Hall, E.A.; Cozzolino, K.; Sarnow, P.; Savas, J.N.; Walsh, D. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase. Nature 2017, 546, 651–655. [Google Scholar] [CrossRef] [Green Version]
  14. Nakanishi, K.; Yaoi, K.; Nagino, Y.; Hara, H.; Kitami, M.; Atsumi, S.; Miura, N.; Sato, R. Aminopeptidase N isoforms from the midgut of Bombyx mori and Plutella xylostella—Their classification and the factors that determine their binding specificity to Bacillus thuringiensis Cry1A toxin. FEBS Lett. 2002, 519, 215–220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Wei, J.; Zhang, M.; Liang, G.; Wu, K.; Guo, Y.; Ni, X.; Li, X. APN1 is a functional receptor of Cry1Ac but not Cry2Ab in Helicoverpa zea. Sci. Rep. 2016, 6, 19179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Qiu, L.; Fan, J.; Zhang, B.; Liu, L.; Wang, X.; Lei, C.; Lin, Y.; Ma, W. RNA interference knockdown of aminopeptidase N genes decrease the susceptibility of Chilo suppressalis larvae to Cry1Ab/Cry1Ac and Cry1Ca-expressing transgenic rice. J. Invertebr. Pathol. 2017, 145, 9–12. [Google Scholar] [CrossRef] [PubMed]
  17. Wang, J.; Yang, X.; He, H.; Chen, J.; Liu, Y.; Huang, W.; Ou, L.; Yang, Z.; Guan, X.; Zhang, L.; et al. Knockout of two Cry-binding aminopeptidase N isoforms does not change susceptibility of Aedes aegypti larvae to Bacillus thuringiensis subsp. israelensis Cry4Ba and Cry11Aa toxins. Insects 2021, 12, 223. [Google Scholar] [CrossRef] [PubMed]
  18. Sun, Y.; Yang, P.; Jin, H.; Liu, H.; Zhou, H.; Qiu, L.; Lin, Y.; Ma, W. Knockdown of the aminopeptidase N genes decreases susceptibility of Chilo suppressalis larvae to Cry1Ab/Cry1Ac and Cry1Ca. Pestic. Biochem. Physiol. 2020, 162, 36–42. [Google Scholar] [CrossRef] [PubMed]
  19. Hara, H.; Atsumi, S.; Yaoi, K.; Nakanishi, K.; Higurashi, S.; Miura, N.; Tabunoki, H.; Sato, R. A cadherin-like protein functions as a receptor for Bacillus thuringiensis Cry1Aa and Cry1Ac toxins on midgut epithelial cells of Bombyx mori larvae. FEBS Lett. 2003, 538, 29–34. [Google Scholar] [CrossRef] [Green Version]
  20. Morin, S.; Biggs, R.W.; Sisterson, M.S.; Shriver, L.; Ellers-Kirk, C.; Higginson, D.; Holley, D.; Gahan, L.J.; Heckel, D.G.; Carrière, Y.; et al. Three cadherin alleles associated with resistance to Bacillus thuringiensis in pink bollworm. Proc. Natl. Acad. Sci. USA 2003, 100, 5004–5009. [Google Scholar] [CrossRef] [Green Version]
  21. Peng, D.; Xu, X.; Ye, W.; Yu, Z.; Sun, M. Helicoverpa armigera cadherin fragment enhances Cry1Ac insecticidal activity by facilitating toxin-oligomer formation. Appl. Microbiol. Biotechnol. 2010, 85, 1033–1040. [Google Scholar] [CrossRef]
  22. Wang, L.; Ma, Y.; Guo, X.; Wan, P.; Liu, K.; Cong, S.; Wang, J.; Xu, D.; Xiao, Y.; Li, X.; et al. Pink bollworm resistance to Bt toxin Cry1Ac associated with an insertion in aadherin exon 20. Toxins 2019, 11, 186. [Google Scholar] [CrossRef] [Green Version]
  23. Hu, X.; Zhang, X.; Zhong, J.; Liu, Y.; Zhang, C.; Xie, Y.; Lin, M.; Xu, C.; Lu, L.; Zhu, Q.; et al. Expression of Cry1Ac toxin-binding region in Plutella xyllostella cadherin-like receptor and studying their interaction mode by molecular docking and site-directed mutagenesis. Int. J. Biol. Macromol. 2018, 111, 822–831. [Google Scholar] [CrossRef] [PubMed]
  24. Gao, M.; Hu, X.; Zhang, X.; Zhong, J.; Lu, L.; Liu, Y.; Dong, S.; Wang, Y.; Liu, X. Identification of a Cry1Fa binding site of cadherin in Plutella xylostella through fragment exchanging and molecular docking methods. Int. J. Biol. Macromol. 2019, 146, 62–69. [Google Scholar] [CrossRef] [PubMed]
  25. Hao, J.; Gao, M.; Hu, X.; Lu, L.; Zhang, X.; Liu, Y.; Zhong, J.; Liu, X. Synergistic selection of a Helicoverpa armigera cadherin fragment with Cry1Ac in different cells and insects. Int. J. Biol. Macromol. 2020, 164, 3667–3675. [Google Scholar] [CrossRef] [PubMed]
  26. Jurat-Fuentes, J.L.; Adang, M.J. Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae. Eur. J. Biochem. 2004, 271, 3127–3135. [Google Scholar] [CrossRef]
  27. Wei, J.; Zhang, M.; Liang, G.; Li, X. Alkaline phosphatase 2 is a functional receptor of Cry1Ac but not Cry2Ab in Helicoverpa zea. Insect Biochem. Mol. Biol. 2019, 28, 372–379. [Google Scholar] [CrossRef]
  28. Gahan, L.J.; Pauchet, Y.; Vogel, H.; Heckel, D.G. An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin. PLoS Genet. 2010, 6, e1001248. [Google Scholar] [CrossRef] [Green Version]
  29. Xiao, Y.T.; Zhang, T.; Liu, C.; Heckel, D.G.; Li, X.; Tabashnik, B.E.; Wu, K.M. Mis-splicing of the ABCC2 gene linked with Bt toxin resistance in Helicoverpa armigera. Sci. Rep. 2014, 4, 6184. [Google Scholar] [CrossRef] [Green Version]
  30. Guo, Z.J.; Kang, S.; Zhu, X.; Xia, J.X.; Wu, Q.; Wang, S.L.; Xie, W.; Zhang, Y.J. The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management. Sci. Rep. 2015, 5, 13728–13742. [Google Scholar] [CrossRef] [Green Version]
  31. Liu, Z.X.; Fu, S.; Ma, X.L.; Baxter, S.W.; Vasseur, L.; Xiong, L.; Huang, Y.P.; Yang, G.; You, S.J.; You, M.S. Resistance to Bacillus thuringiensis Cry1Ac toxin requires mutations in two Plutella xylostella ATP-binding cassette transporter paralogs. PLoS Pathog. 2020, 16, e1008697. [Google Scholar] [CrossRef]
  32. Xu, H.Q.; Ma, M.; Ma, Y.P.; Zhang, S.Y.; Li, W.J.; Wei, D.; Wang, J.J. Identification and expression characterization of ATP-binding cassette (ABC) transporter genes in melon fly. Insects 2021, 12, 270. [Google Scholar] [CrossRef]
  33. Yao, X.; Liu, C.; Duan, Y.; An, S.; Wei, J.; Liang, G. ABCC2 is a functional receptor of Bacillus thuringiensis Cry1Ca in Spodoptera litura. Int. J. Biol. Macromol. 2021, 194, 9–16. [Google Scholar] [CrossRef] [PubMed]
  34. Li, Z.; Mao, K.; Jin, R.; Cai, T.; Qin, Y.; Zhang, Y.; He, S.; Ma, K.; Wan, H.; Ren, X.; et al. miRNA novel 268 targeting NlABCG3 is involved in nitenpyram and clothianidin resistance in Nilaparvata lugens. Int. J. Biol. Macromol. 2022, 217, 615–623. [Google Scholar] [CrossRef] [PubMed]
  35. Shwe, S.M.; Prabu, S.; Jing, D.; He, K.; Wang, Z. Synergistic interaction of Cry1Ah and Vip3Aa19 proteins combination with midgut ATP-binding cassette subfamily C receptors of Conogethes punctiferalis (Guenee) (Lepidoptera: Crambidae). Int. J. Biol. Macromol. 2022, 213, 871–879. [Google Scholar] [CrossRef] [PubMed]
  36. Yang, J.; Chen, S.Y.; Xu, X.J.; Lin, G.F.; Lin, S.J.; Bai, J.L.; Song, Q.S.; You, M.S.; Xie, M. Novel-miR-310 mediated response mechanism to Cry1Ac protoxin in Plutella xylostella (L.). Int. J. Biol. Macromol. 2022, 219, 587–596. [Google Scholar] [CrossRef]
  37. Zhu, Q.; Hu, X.; Liu, Y.; Xie, Y.; Xu, C.; Lin, M.; Pooe, O.J.; Zhong, J.; Gao, M.; Lu, L.; et al. Identification of single domain antibodies with insect cytotoxicity using phage-display antibody library screening and Plutella xylostella ATP-binding cassette transporter subfamily C member 2 (ABCC2) -based insect cell expression system. Int. J. Biol. Macromol. 2022, 209, 586–596. [Google Scholar] [CrossRef] [PubMed]
  38. Heckel, D. Insecticide resistance after silent spring. Science 2012, 337, 1612–1614. [Google Scholar] [CrossRef] [Green Version]
  39. Dechklar, M.; Tiewsiri, K.; Angusuthanasombat, C.; Pootanakit, K. Functional expression in insect cells of glycosylphosphatidylinositol-linked alkaline phosphatase from Aedes aegypti larval midgut: A Bacillus thuringiensis Cry4Ba toxin receptor. Insect Biochem. Mol. Biol. 2011, 41, 159–166. [Google Scholar] [CrossRef]
  40. Xie, C.; Xiong, L.; Ye, M.; Shen, L.; Li, J.; Zhang, Z.; You, M.; You, S. Genome-wide analysis of V-ATPase genes in Plutella xylostella (L.) and the potential role of PxVHA-G1 in resistance to Bacillus thuringiensis Cry1Ac toxin. Int. J. Biol. Macromol. 2021, 194, 74–83. [Google Scholar] [CrossRef]
  41. Mauchamp, B.; Royer, C.; Garel, A.; Jalabert, A.; Da Rocha, M.; Grenier, A.M.; Labas, V.; Vinh, J.; Mita, K.; Kadono, K.; et al. Polycalin (chlorophyllid A binding protein): A novel, very large fluorescent lipocalin from the midgut of the domestic silkworm Bombyx mori L. Insect Biochem. Mol. Biol. 2006, 36, 623–633. [Google Scholar] [CrossRef]
  42. Angelucci, C.; Barrett-Wilt, G.A.; Hunt, D.F.; Akhurst, R.J.; East, P.D.; Gordon, K.H.; Campbell, P.M. Diversity of aminopeptidases, derived from four lepidopteran gene duplications, and polycalins expressed in the midgut of Helicoverpa armigera: Identification of proteins binding the delta-endotoxin, Cry1Ac of Bacillus thuringiensis. Insect Biochem. Mol. Biol. 2008, 38, 685–696. [Google Scholar] [CrossRef] [Green Version]
  43. Wang, B.J.; Wei, J.Z.; Wang, Y.A.; Chen, L.; Liang, G.M. Polycalin is involved in the toxicity and resistance to Cry1Ac toxin in Helicoverpa armigera (Hubner). Arch. Insect Biochem. Physiol. 2020, 104, e21661. [Google Scholar] [CrossRef]
  44. Wang, B.-J.; Wang, Y.-N.; Wei, J.-Z.; Liu, C.; Chen, L.; Khaing, M.M.; Liang, G.-M. Polycalin is involved in the action mechanism of Cry2Aa toxin in Helicoverpa armigera (Hübner). J. Integr. Agric. 2019, 18, 627–635. [Google Scholar] [CrossRef]
  45. Zhou, Z.; Wang, Z.; Liu, Y.; Liang, G.; Shu, C.; Song, F.; Zhou, X.; Bravo, A.; Soberón, M.; Zhang, J.J.M. Identification of ABCC2 as a binding protein of Cry1Ac on brush border membrane vesicles from Helicoverpa armigera by an improved pull-down assay. Microbiologyopen 2016, 5, 659–669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Pandian, G.; Ishikawa, T.; Togashi, M.; Shitomi, Y.; Haginoya, K.; Yamamoto, S.; Nishiumi, T.; Hori, H. Bombyx mori midgut membrane protein P252, which binds to Bacillus thuringiensis Cry1A, is a chlorophyllide-binding protein, and the resulting complex has antimicrobial activity. Appl. Environ. Microbiol. Rep. 2008, 74, 1324–1331. [Google Scholar] [CrossRef] [Green Version]
  47. Pandian, G.; Ishikawa, T.; Vaijayanthi, T.; Hossain, D.; Yamamoto, S.; Nishiumi, T.; Angsuthanasombat, C.; Haginoya, K.; Mitsui, T.; Hori, H. Formation of macromolecule complex with Bacillus thuringiensis Cry1A toxins and chlorophyllide binding 252-kDa lipocalin-like protein locating on Bombyx mori midgut membrane. J. Membr. Biol. 2010, 237, 125–136. [Google Scholar] [CrossRef]
  48. Lin, M.M.; Liu, Y.; Zhang, X.; Zhong, J.F.; Hu, X.D.; Xu, C.J.; Xie, Y.X.; Zhang, C.Z.; Liang, Y.; Liu, X.J.; et al. Anti-idiotypic single-chain variable fragment antibody partially mimic the functionally spatial structure of Cry2Aa toxin. Anal. Biochem. 2021, 625, 114222. [Google Scholar] [CrossRef] [PubMed]
  49. Qiu, L.; Zhang, B.Y.; Liu, L.; Ma, W.H.; Wang, X.P.; Lei, C.L.; Chen, L.Z. Proteomic analysis of Cry2Aa-binding proteins and their receptor function in Spodoptera exigua. Sci. Rep. 2017, 7, 40222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Zhan, E.L.; Du, X.; Zhao, A.P.; Sun, C.; Liu, T.X.; Li, Y.P. Gene cloning and expression of polycalin protein from Plutella xylostella (Lepidoptera: Plutellidae) and its binding characteristics with Cry1Ac toxin. Acta Entomol. Sin. 2017, 60, 1155–1167. [Google Scholar]
  51. Zhu, Q.; Gao, M.J.; Lu, L.N.; Liu, X.J. Synergism of Bacillus thuringiensis toxin Cry1Ac by a fragment of toxin-binding polycalin from Plutella xylostella. J. Agric. Food Chem. 2021, 69, 11816–11824. [Google Scholar] [CrossRef]
  52. Pardo-Lopez, L.; Soberon, M.; Bravo, A. Bacillus thuringiensis insecticidal three-domain Cry toxins: Mode of action, insect resistance and consequences for crop protection. FEMS Microbiol. Rev. 2013, 37, 3–22. [Google Scholar] [CrossRef] [Green Version]
  53. Gómez, I.; Sánchez, J.; Muñoz-Garay, C.; Matus, V.; Gill, S.S.; Soberón, M.; Bravo, A. Bacillus thuringiensis Cry1A toxins are versatile proteins with multiple modes of action: Two distinct pre-pores are involved in toxicity. Biochemical 2014, 459, 383–396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Zhang, X.; Candas, M.; Griko, N.B.; Taussig, R.; Bulla, L.A. A mechanism of cell death involving an adenylyl cyclase/PKA signaling pathway is induced by the Cry1Ab toxin of Bacillus thuringiensis. Proc. Natl. Acad. Sci. USA 2006, 103, 9897–9902. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Wang, L.; Xu, D.; Huang, Y.; Zhou, H.; Liu, W.; Cong, S.; Wang, J.; Li, W.; Wan, P. Mutation in the cadherin gene is a key factor for pink bollworm resistance to Bt cotton in China. Toxins 2022, 14, 23. [Google Scholar] [CrossRef] [PubMed]
  56. Yaoi, K.; Kadotani, T.; Kuwana, H.; Shinkawa, A.; Takahashi, T.; Iwahana, H.; Sato, R. Aminopeptidase N from Bombyx Mori as a candidate for the receptor of Bacillus thuringiensis Cry1Aa toxin. Eur. J. Biochem. 1997, 246, 652–657. [Google Scholar] [CrossRef] [Green Version]
  57. Sivakumar, S.; Rajagopal, R.; Venkatesh, G.R.; Srivastava, A.; Bhatnagar, R.K. Knockdown of aminopeptidase-N from Helicoverpa armigera larvae and in transfected Sf21 cells by RNA interference reveals its functional interaction with Bacillus thuringiensis insecticidal protein Cry1Ac. J. Biol. Chem. 2007, 282, 7312–7319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Ning, C.; Wu, K.; Liu, C.; Gao, Y.; Jurat-Fuentes, J.L.; Gao, X. Characterization of a Cry1Ac toxin-binding alkaline phosphatase in the midgut from Helicoverpa armigera (Hubner) larvae. J. Insect Physiol. 2010, 56, 666–672. [Google Scholar] [CrossRef]
  59. Tanaka, S.; Endo, H.; Adegawa, S.; Iizuka, A.; Imamura, K.; Kikuta, S.; Sato, R. Bombyx mori ABC transporter C2 structures responsible for the receptor function of Bacillus thuringiensis Cry1Aa toxin. Insect Biochem. Mol. Biol. 2017, 91, 44–54. [Google Scholar] [CrossRef]
  60. Martinez-Solis, M.; Pinos, D.; Endo, H.; Portugal, L.; Sato, R.; Ferre, J.; Herrero, S.; Hernandez-Martinez, P. Role of Bacillus thuringiensis Cry1A toxins domains in the binding to the ABCC2 receptor from Spodoptera exigua. Insect Biochem. Mol. Biol. 2018, 101, 47–56. [Google Scholar] [CrossRef]
  61. Yang, Y.; Duan, A.; Zhang, C.; Zhang, Y.; Wang, A.; Xue, C.; Wang, H.; Zhao, M.; Zhang, J. Overexpression of ATP-binding cassette transporters ABCG10, ABCH3 and ABCH4 in Aphis craccivora (Koch) facilitates its tolerance to imidacloprid. Pestic. Biochem. Physiol. 2022, 186, 105170. [Google Scholar] [CrossRef]
  62. Guo, Z.J.; Kang, S.; Zhu, X.; Xia, J.X.; Wu, Q.J.; Wang, S.L.; Xie, W.; Zhang, Y.J. Down-regulation of a novel ABC transporter gene (Pxwhite) is associated with Cry1Ac resistance in the diamondback moth, Plutella xylostella (L.). Insect Biochem. Mol. Biol. 2015, 59, 30–40. [Google Scholar] [CrossRef]
  63. Stevens, T.; Song, S.; Bruning, J.B.; Choo, A.; Baxter, S.W. Expressing a moth abcc2 gene in transgenic Drosophila causes susceptibility to Bt Cry1Ac without requiring a cadherin-like protein receptor. Insect Biochem. Mol. Biol. 2017, 80, 61–70. [Google Scholar] [CrossRef]
  64. Zhou, J.L.; Guo, Z.J.; Kang, S.; Qin, J.Y.; Gong, L.J.; Sun, D.; Guo, L.; Zhu, L.H.; Bai, Y.; Zhang, Z.Z.; et al. Reduced expression of the P-glycoprotein gene PxABCB1 is linked to resistance to Bacillus thuringiensis Cry1Ac toxin in Plutella xylostella (L.). Pest Manag. Sci. 2020, 76, 712–720. [Google Scholar] [CrossRef] [PubMed]
  65. Guney, G.; Cedden, D.; Hanniger, S.; Heckel, D.G.; Coutu, C.; Hegedus, D.D.; Mutlu, D.A.; Suludere, Z.; Sezen, K.; Guney, E.; et al. Silencing of an ABC transporter, but not a cadherin, decreases the susceptibility of Colorado potato beetle larvae to Bacillus thuringiensis ssp. tenebrionis Cry3Aa toxin. Arch. Insect Biochem. Physiol. 2021, 108, e21834. [Google Scholar] [CrossRef] [PubMed]
  66. Wang, H.; Zhang, C.; Chen, G.; Li, Y.; Yang, X.; Han, L.; Peng, Y. Downregulation of the CsABCC2 gene is associated with Cry1C resistance in the striped stem borer Chilo suppressalis. Pestic. Biochem. Physiol. 2022, 184, 105119. [Google Scholar] [CrossRef] [PubMed]
  67. Yang, X.; Chen, W.; Song, X.; Ma, X.; Cotto-Rivera, R.O.; Kain, W.; Chu, H.; Chen, Y.R.; Fei, Z.; Wang, P. Mutation of ABC transporter ABCA2 confers resistance to Bt toxin Cry2Ab in Trichoplusia ni. Insect Biochem. Mol. Biol. 2019, 112, 103209. [Google Scholar] [CrossRef] [PubMed]
  68. Fabrick, J.A.; LeRoy, D.M.; Mathew, L.G.; Wu, Y.; Unnithan, G.C.; Yelich, A.J.; Carriere, Y.; Li, X.; Tabashnik, B.E. CRISPR-mediated mutations in the ABC transporter gene ABCA2 confer pink bollworm resistance to Bt toxin Cry2Ab. Sci. Rep. 2021, 11, 10377. [Google Scholar] [CrossRef]
  69. Jin, W.; Zhai, Y.; Yang, Y.; Wu, Y.; Wang, X. Cadherin protein is involved in the action of Bacillus thuringiensis Cry1Ac toxin in Ostrinia furnacalis. Toxins 2021, 13, 658. [Google Scholar] [CrossRef]
  70. Jin, M.; Cheng, Y.; Guo, X.; Li, M.; Chakrabarty, S.; Liu, K.; Wu, K.; Xiao, Y. Down-regulation of lysosomal protein ABCB6 increases gossypol susceptibility in Helicoverpa armigera. Insect Biochem. Mol. Biol. 2020, 122, 103387. [Google Scholar] [CrossRef]
  71. Shelton, A.M.; Cooley, R.J.; Kroening, M.K.; Wilsey, W.T.; Eigenbrode, S.D. Comparative analysis of two rearing procedures for diamondback moth (Lepidoptera: Plutellidae). J. Entomol. Sci. 1991, 26, 17–26. [Google Scholar] [CrossRef]
  72. Xiong, L.; Liu, Z.X.; Shen, L.L.; Xie, C.; Ye, M.; Li, Z.Y.; Zhang, Z.; Li, J.G.; Dong, Y.; You, M.S.; et al. A novel reference for Bt-resistance mechanism in Plutella xylostella based on analysis of the midgut transcriptomes. Insects 2021, 12, 1091. [Google Scholar] [CrossRef] [PubMed]
  73. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR. Methods 2002, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  74. Heckel, D.G.; Gahan, L.J.; Liu, Y.B.; Tabashnik, B.E. Genetic mapping of resistance to Bacillus thuringiensis toxins in diamondback moth using biphasic linkage analysis. Proc. Natl. Acad. Sci. USA 1999, 96, 8373–8377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Toxins 15 00273 g001 550
Figure 1. Structure of Pxpolycalin gene in P. xylostella. (A) Genomic structure of the Pxpolycalin gene in P. xylostella. Green boxes indicate the exons, and the spaces between the two boxes indicate the introns. The figure is drawn to scale, and the corresponding scale bar is shown. The dotted boxes above exons 22, 35, and 49 are fixed site mutations between G88 and Cry1S1000 strains. (B) NCBI conserved domain database (CDD)-based annotation of the Pxpolycalin gene sequence.
Figure 1. Structure of Pxpolycalin gene in P. xylostella. (A) Genomic structure of the Pxpolycalin gene in P. xylostella. Green boxes indicate the exons, and the spaces between the two boxes indicate the introns. The figure is drawn to scale, and the corresponding scale bar is shown. The dotted boxes above exons 22, 35, and 49 are fixed site mutations between G88 and Cry1S1000 strains. (B) NCBI conserved domain database (CDD)-based annotation of the Pxpolycalin gene sequence.
Toxins 15 00273 g001
Toxins 15 00273 g002 550
Figure 2. RPo mutation of Pxpolycalin from the Cry1S1000 strain. (A) The difference in the genotype of Pxpolycalin between the G88 and Cry1S1000 strains based on PCR and sequencing. SPoSPo is the sequencing result of the G88 strain, RPoRPo is the sequencing result of the Cry1S1000 strain, and SPoRPo is the sequencing result of hybrid F1 between G88 and Cry1S1000 strains. (B) Alignment of gDNA sequences of the SPo allele and the RPo allele. Sequences highlighted in orange are exons 26 and 27.
Figure 2. RPo mutation of Pxpolycalin from the Cry1S1000 strain. (A) The difference in the genotype of Pxpolycalin between the G88 and Cry1S1000 strains based on PCR and sequencing. SPoSPo is the sequencing result of the G88 strain, RPoRPo is the sequencing result of the Cry1S1000 strain, and SPoRPo is the sequencing result of hybrid F1 between G88 and Cry1S1000 strains. (B) Alignment of gDNA sequences of the SPo allele and the RPo allele. Sequences highlighted in orange are exons 26 and 27.
Toxins 15 00273 g002
Toxins 15 00273 g003 550
Figure 3. Neighbor-joining tree based on the amino acid sequences of Pxpolycalin in P. xylostella and other insects. The scale bar indicates the phylogenetic distance (bootstrap = 1000). The polycalin protein of P. xylostella is represented by a red asterisk.
Figure 3. Neighbor-joining tree based on the amino acid sequences of Pxpolycalin in P. xylostella and other insects. The scale bar indicates the phylogenetic distance (bootstrap = 1000). The polycalin protein of P. xylostella is represented by a red asterisk.
Toxins 15 00273 g003
Toxins 15 00273 g004 550
Figure 4. Relative polycalin transcription detected by qRT-PCR in G88 susceptible and Cry1S1000 resistant larvae of P. xylostella. Asterisks (*) indicate significant difference for p < 0.05. The data were evaluated by Student’s t test using SPSS v.26.0.
Figure 4. Relative polycalin transcription detected by qRT-PCR in G88 susceptible and Cry1S1000 resistant larvae of P. xylostella. Asterisks (*) indicate significant difference for p < 0.05. The data were evaluated by Student’s t test using SPSS v.26.0.
Toxins 15 00273 g004
Toxins 15 00273 g005 550
Figure 5. Relative expression level of Pxpolycalin in different developmental stages and different tissues of P. xylostella. (A,B) Relative expression level of Pxpolycalin in G88 strain; (C,D) Relative expression level of Pxpolycalin in Cry1S1000 strain. E: egg; L1: 1st instar larvae; L2: 2nd instar larvae; L3: 3rd instar larvae; 4th instar larvae; PP: prepupae; P: pupae; AF: female adults; AM: male adults. MG: midgut; IN: integument; HD: head; MT: malpighian tubules; SG: silk gland. Expression level was calculated according to the value of the egg (E) or midgut (MG), which was given an arbitrary value of 1. Data was represented with three biological replicates and each replication was repeated three times. The bars were shown as mean ± SD. Different letters above the bars indicate significant differences in different development stages or different tissues. Statistically significant differences were analyzed with one-way ANOVA (Tukey’s test for multiple comparisons, p < 0.05).
Figure 5. Relative expression level of Pxpolycalin in different developmental stages and different tissues of P. xylostella. (A,B) Relative expression level of Pxpolycalin in G88 strain; (C,D) Relative expression level of Pxpolycalin in Cry1S1000 strain. E: egg; L1: 1st instar larvae; L2: 2nd instar larvae; L3: 3rd instar larvae; 4th instar larvae; PP: prepupae; P: pupae; AF: female adults; AM: male adults. MG: midgut; IN: integument; HD: head; MT: malpighian tubules; SG: silk gland. Expression level was calculated according to the value of the egg (E) or midgut (MG), which was given an arbitrary value of 1. Data was represented with three biological replicates and each replication was repeated three times. The bars were shown as mean ± SD. Different letters above the bars indicate significant differences in different development stages or different tissues. Statistically significant differences were analyzed with one-way ANOVA (Tukey’s test for multiple comparisons, p < 0.05).
Toxins 15 00273 g005
Toxins 15 00273 g006 550
Figure 6. Effect of LC10 of Cry1Ac on the relative expression of PxABCC2 (A) and Pxpolycalin (B) in the 3rd instar P. xylostella of the G88 strain. The results are shown as the mean ± SD. Asterisks above error bars represent significant differences (**, p < 0.01; ***, p < 0.001) using Student’s t-test.
Figure 6. Effect of LC10 of Cry1Ac on the relative expression of PxABCC2 (A) and Pxpolycalin (B) in the 3rd instar P. xylostella of the G88 strain. The results are shown as the mean ± SD. Asterisks above error bars represent significant differences (**, p < 0.01; ***, p < 0.001) using Student’s t-test.
Toxins 15 00273 g006
Toxins 15 00273 g007 550
Figure 7. Mutagenesis of Pxpolycalin induced by CRISPR/Cas9. Partial sequences from the G88 and homozygous Pxpolycalin mutant showing the indels at the target sequence (polycalin-sgRNA) in exon 2 of Pxpolycalin.
Figure 7. Mutagenesis of Pxpolycalin induced by CRISPR/Cas9. Partial sequences from the G88 and homozygous Pxpolycalin mutant showing the indels at the target sequence (polycalin-sgRNA) in exon 2 of Pxpolycalin.
Toxins 15 00273 g007
Toxins 15 00273 g008 550
Figure 8. Relative mortality of different types of mutant homozygous strains after Cry1Ac toxin treatment. G88 indicates the Cry1Ac-susceptible strain. PoKO21KI16 indicates the homozygous strain for the Pxpolycalin mutation. A3KO28 indicates the homozygous strain for the PxABCC2 mutation. The bars were shown as mean ± SD. Different letters above the bars indicate significant differences in different types of mutant homozygous strains. Statistically significant differences were analyzed with one-way ANOVA (Tukey’s test for multiple comparisons, p < 0.05).
Figure 8. Relative mortality of different types of mutant homozygous strains after Cry1Ac toxin treatment. G88 indicates the Cry1Ac-susceptible strain. PoKO21KI16 indicates the homozygous strain for the Pxpolycalin mutation. A3KO28 indicates the homozygous strain for the PxABCC2 mutation. The bars were shown as mean ± SD. Different letters above the bars indicate significant differences in different types of mutant homozygous strains. Statistically significant differences were analyzed with one-way ANOVA (Tukey’s test for multiple comparisons, p < 0.05).
Toxins 15 00273 g008
Toxins 15 00273 g009 550
Figure 9. Diagram showing the genetic linkage analysis strategy of Pxpolycalin with Cry1Ac resistance. A female G88 (susceptible) was crossed with a male Cry1S1000 (resistant) to produce F1 progeny. Next, the hybrid F1 was backcrossed with Cry1S1000. Half of the backcross family a and b were treated with 0.5 μg/mL Cry1Ac toxin, and the other half together with the surviving larvae/adults from the treated group were sampled directly.
Figure 9. Diagram showing the genetic linkage analysis strategy of Pxpolycalin with Cry1Ac resistance. A female G88 (susceptible) was crossed with a male Cry1S1000 (resistant) to produce F1 progeny. Next, the hybrid F1 was backcrossed with Cry1S1000. Half of the backcross family a and b were treated with 0.5 μg/mL Cry1Ac toxin, and the other half together with the surviving larvae/adults from the treated group were sampled directly.
Toxins 15 00273 g009
Toxins 15 00273 g010 550
Figure 10. The strategy of homozygous mutant line construction. The unmated adult of the G0 generation was hybridized with the G88 strain, and the gDNA of the adult G0 was extracted after oviposit. Then, the mutant was detected by PCR sequencing, and the offspring of the same mutation type was selected to obtain homozygous mutant line.
Figure 10. The strategy of homozygous mutant line construction. The unmated adult of the G0 generation was hybridized with the G88 strain, and the gDNA of the adult G0 was extracted after oviposit. Then, the mutant was detected by PCR sequencing, and the offspring of the same mutation type was selected to obtain homozygous mutant line.
Toxins 15 00273 g010
Table
Table 1. Genetic linkage of the RPo allele with Cry1Ac resistance.
Table 1. Genetic linkage of the RPo allele with Cry1Ac resistance.
GenerationN aGenotype b
RPoSPoRPoRPo
F1 (G88 ♀ × Cry1S1000 ♂)10100
Backcross family a with toxin treated1293
Backcross family a without toxin treated241113
Backcross family b with toxin treated1239
Backcross family b without toxin treated241212
a Total number of adults used for genotyping. b For the genetic linkage analysis, we used Fisher’s exact test. The observed genotype frequencies of Pxpolycalin on a diet treated with the Cry1Ac toxin were not significantly different from the expected genotype frequencies on the untreated diet (χ2 = 2.76, df = 1, p > 0.05 for Backcross family a; χ2 = 2.06, df = 1, p < 0.05 for Backcross family b).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xiong, L.; Liu, Z.; Li, J.; Yao, S.; Li, Z.; Chen, X.; Shen, L.; Zhang, Z.; Li, Y.; Hou, Q.; et al. Analysis of the Effect of Plutella xylostella Polycalin and ABCC2 Transporter on Cry1Ac Susceptibility by CRISPR/Cas9-Mediated Knockout. Toxins 2023, 15, 273. https://doi.org/10.3390/toxins15040273

AMA Style

Xiong L, Liu Z, Li J, Yao S, Li Z, Chen X, Shen L, Zhang Z, Li Y, Hou Q, et al. Analysis of the Effect of Plutella xylostella Polycalin and ABCC2 Transporter on Cry1Ac Susceptibility by CRISPR/Cas9-Mediated Knockout. Toxins. 2023; 15(4):273. https://doi.org/10.3390/toxins15040273

Chicago/Turabian Style

Xiong, Lei, Zhaoxia Liu, Jingge Li, Shuyuan Yao, Zeyun Li, Xuanhao Chen, Lingling Shen, Zhen Zhang, Yongbin Li, Qing Hou, and et al. 2023. "Analysis of the Effect of Plutella xylostella Polycalin and ABCC2 Transporter on Cry1Ac Susceptibility by CRISPR/Cas9-Mediated Knockout" Toxins 15, no. 4: 273. https://doi.org/10.3390/toxins15040273

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop