Renocardiac Effects of p-Cresyl Sulfate Administration in Acute Kidney Injury Induced by Unilateral Ischemia and Reperfusion Injury In Vivo
Abstract
:1. Introduction
2. Results
2.1. PCS Was Able to Induce Renal Damage and Cardiac Alterations with 20 mg/L Dose after 15 Days
2.2. Unilateral Ischemia and Reperfusion (IR) Damaged the Left Kidney Tissue; However, PCS Administration Did Not Enhance the Injury after 15 Days
2.3. Organic Anion Transporters (OATs) Are Modulated in the Injured Kidney by PCS Administration after Unilateral IR for 15 Days
2.4. PCS Combined with IR Prevented the Cardiac Hypertrophy Induced by Unilateral IR for 15 Days
2.5. PCS Administration Did Not Enhance Inflammation Induced by Unilateral IR for 15 Days
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Animal Procedures
5.2. Acute Kidney Injury Protocol of Unilateral Ischemia-Reperfusion (IR)
5.3. p-Cresyl Sulfate (PCS) Administration
5.4. Serum Measurements
5.5. Assessment of Cardiac and Renal Tropism
5.6. Gene Expression Analysis by Real-Time Polymerase Chain Reaction (RT-PCR)
5.7. Plasmatic Measurement
5.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AKI | Acute kidney injury |
ANOVA | Analysis of Variance |
BLAST | Basic Local Alignment Search Tool |
cDNA | Complementary DNA |
CKD | Chronic kidney disease |
DNA | Deoxyribonucleic acid |
EUTox | European Uremic Toxins Work Group |
HPLC | High-performance Liquid Chromatography |
HW/TL | Heart weight/tibia length |
IL-1β | Interleukin 1β |
IL-6 | Interleukin 6 |
i.p. | Intraperitoneal injection |
IR | Ischemia and reperfusion |
IS | Indoxyl sulfate |
KIM-1 | Kidney injury molecule 1 |
KW/TL | Kidney weight/tibia length |
LK/TL | Left kidney weight/tibia length |
mRNA | Messenger RNA |
NCBI | National Center for Biotechnology Information |
NGAL | Neutrophil Gelatinase-Associated Lipocalin |
OATs | Organic anion transporters |
PBUTs | Protein-bound uremic toxins |
PCS | p-cresyl sulfate |
PKC | Protein kinase C |
RAAS system | Renin–Angiotensin–Aldosterone System |
RK/TL | Right kidney weight/tibia length |
RNA | Ribonucleic acid |
SD | Standard deviation |
UTs | Uremic toxins |
References
- Meyer, T.W.; Hostetter, T.H. Uremia. N. Engl. J. Med. 2007, 357, 1316–1325. [Google Scholar] [CrossRef] [PubMed]
- Lim, Y.J.; Sidor, N.A.; Tonial, N.C.; Che, A.; Urquhart, B.L. Uremic Toxins in the Progression of Chronic Kidney Disease and Cardiovascular Disease: Mechanisms and Therapeutic Targets. Toxins 2021, 13, 142. [Google Scholar] [CrossRef] [PubMed]
- Glassock, R.J. Uremic Toxins: What Are They? An Integrated Overview of Pathobiology and Classification. J. Ren. Nutr. 2008, 18, 2–6. [Google Scholar] [CrossRef]
- Vanholder, R.; Pletinck, A.; Schepers, E.; Glorieux, G. Biochemical and Clinical Impact of Organic Uremic Retention Solutes: A Comprehensive Update. Toxins 2018, 10, 33. [Google Scholar] [CrossRef] [PubMed]
- Rosner, M.H.; Reis, T.; Husain-Syed, F.; Vanholder, R.; Hutchison, C.; Stenvinkel, P.; Blankestijn, P.J.; Cozzolino, M.; Juillard, L.; Kashani, K.; et al. Classification of Uremic Toxins and Their Role in Kidney Failure. Clin. J. Am. Soc. Nephrol. 2021, 16, 1918–1928. [Google Scholar] [CrossRef]
- Falconi, C.A.; Junho, C.V.D.C.; Fogaça-Ruiz, F.; Vernier, I.C.S.; Da Cunha, R.S.; Stinghen, A.E.M.; Carneiro-Ramos, M.S. Uremic Toxins: An Alarming Danger Concerning the Cardiovascular System. Front. Physiol. 2021, 12, 686249. [Google Scholar] [CrossRef]
- Gryp, T.; Vanholder, R.; Vaneechoutte, M.; Glorieux, G. p-Cresyl Sulfate. Toxins 2017, 9, 52. [Google Scholar] [CrossRef]
- Odutayo, A.; Wong, C.X.; Farkouh, M.; Altman, D.G.; Hopewell, S.; Emdin, C.A.; Hunn, B.H. AKI and Long-Term Risk for Cardiovascular Events and Mortality. J. Am. Soc. Nephrol. 2017, 28, 377–387. [Google Scholar] [CrossRef]
- Chen, G.; Zhang, F.; Wang, L.; Feng, Z. Isoflurane alleviates hypoxia/reoxygenation induced myocardial injury by reducing miR-744 mediated SIRT6. Toxicol. Mech. Methods 2022, 32, 235–242. [Google Scholar] [CrossRef]
- Pletinck, A.; Glorieux, G.; Schepers, E.; Cohen, G.; Gondouin, B.; Van Landschoot, M.; Eloot, S.; Rops, A.; Van De Voorde, J.; De Vriese, A.; et al. Protein-Bound Uremic Toxins Stimulate Crosstalk between Leukocytes and Vessel Wall. J. Am. Soc. Nephrol. 2013, 24, 1981–1994. [Google Scholar] [CrossRef]
- Han, H.; Zhu, J.; Zhu, Z.; Ni, J.; Du, R.; Dai, Y.; Chen, Y.; Wu, Z.; Lu, L.; Zhang, R. p-Cresyl Sulfate Aggravates Cardiac Dysfunction Associated With Chronic Kidney Disease by Enhancing Apoptosis of Cardiomyocytes. J. Am. Heart Assoc. 2015, 4, e001852. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, H.; Miyamoto, Y.; Honda, D.; Tanaka, H.; Wu, Q.; Endo, M.; Noguchi, T.; Kadowaki, D.; Ishima, Y.; Kotani, S.; et al. p-Cresyl sulfate causes renal tubular cell damage by inducing oxidative stress by activation of NADPH oxidase. Kidney Int. 2013, 83, 582–592. [Google Scholar] [CrossRef] [PubMed]
- Neirynck, N.; Vanholder, R.; Schepers, E.; Eloot, S.; Pletinck, A.; Glorieux, G. An update on uremic toxins. Int. Urol. Nephrol. 2013, 45, 139–150. [Google Scholar] [CrossRef] [PubMed]
- Meijers, B.K.I.; De Loor, H.; Bammens, B.; Verbeke, K.; Vanrenterghem, Y.; Evenepoel, P. p-Cresyl Sulfate and Indoxyl Sulfate in Hemodialysis Patients. Clin. J. Am. Soc. Nephrol. 2009, 4, 1932–1938. [Google Scholar] [CrossRef] [PubMed]
- Glorieux, G.; Vanholder, R.; Van Biesen, W.; Pletinck, A.; Schepers, E.; Neirynck, N.; Speeckaert, M.; De Bacquer, D.; Verbeke, F. Free p-cresyl sulfate shows the highest association with cardiovascular outcome in chronic kidney disease. Nephrol. Dial. Transplant. 2021, 36, 998–1005. [Google Scholar] [CrossRef]
- Di Paola, R.; De, A.; Izhar, R.; Abate, M.; Zappavigna, S.; Capasso, A.; Perna, A.F.; La Russa, A.; Capasso, G.; Caraglia, M.; et al. Possible Effects of Uremic Toxins p-Cresol, Indoxyl Sulfate, p-Cresyl Sulfate on the Development and Progression of Colon Cancer in Patients with Chronic Renal Failure. Genes 2023, 14, 1257. [Google Scholar] [CrossRef]
- Trentin-Sonoda, M.; Da Silva, R.C.; Kmit, F.V.; Abrahão, M.V.; Monnerat Cahli, G.; Brasil, G.V.; Muzi-Filho, H.; Silva, P.A.; Tovar-Moll, F.F.; Vieyra, A.; et al. Knockout of Toll-Like Receptors 2 and 4 Prevents Renal Ischemia-Reperfusion-Induced Cardiac Hypertrophy in Mice. PLoS ONE 2015, 10, e0139350. [Google Scholar] [CrossRef]
- Junho, C.V.C.; González-Lafuente, L.; Neres-Santos, R.S.; Navarro-García, J.A.; Rodríguez-Sánchez, E.; Ruiz-Hurtado, G.; Carneiro-Ramos, M.S. Klotho relieves inflammation and exerts a cardioprotective effect during renal ischemia/reperfusion-induced cardiorenal syndrome. Biomed. Pharmacother. 2022, 153, 113515. [Google Scholar] [CrossRef]
- Nepomuceno, G.; Junho, C.V.C.; Carneiro-Ramos, M.S.; Da Silva Martinho, H. Tyrosine and Tryptophan vibrational bands as markers of kidney injury: A renocardiac syndrome induced by renal ischemia and reperfusion study. Sci. Rep. 2021, 11, 15036. [Google Scholar] [CrossRef]
- Wu, W.; Bush, K.T.; Nigam, S.K. Key Role for the Organic Anion Transporters, OAT1 and OAT3, in the in vivo Handling of Uremic Toxins and Solutes. Sci. Rep. 2017, 7, 4939. [Google Scholar] [CrossRef]
- Bush, K.T.; Singh, P.; Nigam, S.K. Gut-derived uremic toxin handling in vivo requires OAT-mediated tubular secretion in chronic kidney disease. JCI Insight 2020, 5, e133817. [Google Scholar] [CrossRef] [PubMed]
- Reyes, M.; Benet, L.Z. Effects of Uremic Toxins on Transport and Metabolism of Different Biopharmaceutics Drug Disposition Classification System Xenobiotics. J. Pharm. Sci. 2011, 100, 3831–3842. [Google Scholar] [CrossRef] [PubMed]
- Goffredo, G.; Barone, R.; Di Terlizzi, V.; Correale, M.; Brunetti, N.D.; Iacoviello, M. Biomarkers in Cardiorenal Syndrome. J. Clin. Med. 2021, 10, 3433. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.-Y.; Hsu, H.-H.; Wu, M.-S. p-Cresol sulfate and indoxyl sulfate induce similar cellular inflammatory gene expressions in cultured proximal renal tubular cells. Nephrol. Dial. Transplant. 2013, 28, 70–78. [Google Scholar] [CrossRef]
- Ismail, O.Z.; Zhang, X.; Wei, J.; Haig, A.; Denker, B.M.; Suri, R.S.; Sener, A.; Gunaratnam, L. Kidney Injury Molecule-1 Protects against Gα12 Activation and Tissue Damage in Renal Ischemia-Reperfusion Injury. Am. J. Pathol. 2015, 185, 1207–1215. [Google Scholar] [CrossRef]
- Ismail, O.Z.; Zhang, X.; Bonventre, J.V.; Gunaratnam, L. G protein α12 (Gα12) is a negative regulator of kidney injury molecule-1-mediated efferocytosis. Am. J. Physiol. Ren. Physiol. 2016, 310, F607–F620. [Google Scholar] [CrossRef]
- Marquez-Exposito, L.; Tejedor-Santamaria, L.; Santos-Sanchez, L.; Valentijn, F.A.; Cantero-Navarro, E.; Rayego-Mateos, S.; Rodrigues-Diez, R.R.; Tejera-Muñoz, A.; Marchant, V.; Sanz, A.B.; et al. Acute Kidney Injury is Aggravated in Aged Mice by the Exacerbation of Proinflammatory Processes. Front. Pharmacol. 2021, 12, 662020. [Google Scholar] [CrossRef]
- Neres-Santos, R.S.; Junho, C.V.C.; Panico, K.; Caio-Silva, W.; Pieretti, J.C.; Tamashiro, J.A.; Seabra, A.B.; Ribeiro, C.A.J.; Carneiro-Ramos, M.S. Mitochondrial Dysfunction in Cardiorenal Syndrome 3: Renocardiac Effect of Vitamin C. Cells 2021, 10, 3029. [Google Scholar] [CrossRef]
- Hung, A.M.; Ellis, C.D.; Shintani, A.; Booker, C.; Ikizler, T.A. IL-1β Receptor Antagonist Reduces Inflammation in Hemodialysis Patients. J. Am. Soc. Nephrol. 2011, 22, 437–442. [Google Scholar] [CrossRef]
- Castillo-Rodriguez, E.; Fernandez-Prado, R.; Martin-Cleary, C.; Pizarro-Sánchez, M.S.; Sanchez-Niño, M.D.; Sanz, A.B.; Fernandez-Fernandez, B.; Ortiz, A. Kidney Injury Marker 1 and Neutrophil Gelatinase-Associated Lipocalin in Chronic Kidney Disease. Nephron 2017, 136, 263–267. [Google Scholar] [CrossRef]
- Wang, L.; Sweet, D.H. Renal Organic Anion Transporters (SLC22 Family): Expression, Regulation, Roles in Toxicity, and Impact on Injury and Disease. AAPS J. 2013, 15, 53–69. [Google Scholar] [CrossRef] [PubMed]
- Matsuzaki, T.; Watanabe, H.; Yoshitome, K.; Morisaki, T.; Hamada, A.; Nonoguchi, H.; Kohda, Y.; Tomita, K.; Inui, K.; Saito, H. Downregulation of organic anion transporters in rat kidney under ischemia/reperfusion-induced qacute renal failure. Kidney Int. 2007, 71, 539–547. [Google Scholar] [CrossRef] [PubMed]
- Matsuzaka, Y.; Yashiro, R. Therapeutic Strategy of Mesenchymal-Stem-Cell-Derived Extracellular Vesicles as Regenerative Medicine. Int. J. Mol. Sci. 2022, 23, 6480. [Google Scholar] [CrossRef] [PubMed]
- Jin, L.; Kikuchi, R.; Saji, T.; Kusuhara, H.; Sugiyama, Y. Regulation of Tissue-Specific Expression of Renal Organic Anion Transporters by Hepatocyte Nuclear Factor 1 α/β and DNA Methylation. J. Pharmacol. Exp. Ther. 2012, 340, 648–655. [Google Scholar] [CrossRef]
- Cunha, R.S.D.; Azevedo, C.A.B.; Falconi, C.A.; Ruiz, F.F.; Liabeuf, S.; Carneiro-Ramos, M.S.; Stinghen, A.E.M. The Interplay between Uremic Toxins and Albumin, Membrane Transporters and Drug Interaction. Toxins 2022, 14, 177. [Google Scholar] [CrossRef]
- Cirino-Silva, R.; Kmit, F.V.; Trentin-Sonoda, M.; Nakama, K.K.; Panico, K.; Alvim, J.M.; Dreyer, T.R.; Martinho-Silva, H.; Carneiro-Ramos, M.S. Renal ischemia/reperfusion-induced cardiac hypertrophy in mice: Cardiac morphological and morphometric characterization. JRSM Cardiovasc. Dis. 2017, 6, 204800401668944. [Google Scholar] [CrossRef] [PubMed]
- Junho, C.V.C.; González-Lafuente, L.; Navarro-García, J.A.; Rodríguez-Sánchez, E.; Carneiro-Ramos, M.S.; Ruiz-Hurtado, G. Unilateral Acute Renal Ischemia-Reperfusion Injury Induces Cardiac Dysfunction through Intracellular Calcium Mishandling. Int. J. Mol. Sci. 2022, 23, 2266. [Google Scholar] [CrossRef]
- Lekawanvijit, S. Role of Gut-Derived Protein-Bound Uremic Toxins in Cardiorenal Syndrome and Potential Treatment Modalities. Circ. J. 2015, 79, 2088–2097. [Google Scholar] [CrossRef]
- Lekawanvijit, S.; Kompa, A.R.; Zhang, Y.; Wang, B.H.; Kelly, D.J.; Krum, H. Myocardial infarction impairs renal function, induces renal interstitial fibrosis, and increases renal KIM-1 expression: Implications for cardiorenal syndrome. Am. J. Physiol. Heart Circ. Physiol. 2012, 302, H1884–H1893. [Google Scholar] [CrossRef]
- Cho, E.; Kim, M.; Ko, Y.S.; Lee, H.Y.; Song, M.; Kim, M.G.; Kim, H.-K.; Cho, W.-Y.; Jo, S.-K. Role of inflammation in the pathogenesis of cardiorenal syndrome in a rat myocardial infarction model. Nephrol. Dial. Transplant. 2013, 28, 2766–2778. [Google Scholar] [CrossRef]
- Lee, S.A.; Cozzi, M.; Bush, E.L.; Rabb, H. Distant Organ Dysfunction in Acute Kidney Injury: A Review. Am. J. Kidney Dis. 2018, 72, 846–856. [Google Scholar] [CrossRef] [PubMed]
- Alarcon, M.M.L.; Trentin-Sonoda, M.; Panico, K.; Schleier, Y.; Duque, T.; Moreno-Loaiza, O.; De Yurre, A.R.; Ferreira, F.; Caio-Silva, W.; Coury, P.R.; et al. Cardiac arrhythmias after renal I/R depend on IL-1β. J. Mol. Cell. Cardiol. 2019, 131, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Wu, I.-W.; Hsu, K.-H.; Lee, C.-C.; Sun, C.-Y.; Hsu, H.-J.; Tsai, C.-J.; Tzen, C.-Y.; Wang, Y.-C.; Lin, C.-Y.; Wu, M.-S. p-Cresyl sulphate and indoxyl sulphate predict progression of chronic kidney disease. Nephrol. Dial. Transplant. 2011, 26, 938–947. [Google Scholar] [CrossRef]
- Liabeuf, S.; Barreto, D.V.; Barreto, F.C.; Meert, N.; Glorieux, G.; Schepers, E.; Temmar, M.; Choukroun, G.; Vanholder, R.; Massy, Z.A.; et al. Free p-cresylsulphate is a predictor of mortality in patients at different stages of chronic kidney disease. Nephrol. Dial. Transplant. 2010, 25, 1183–1191. [Google Scholar] [CrossRef] [PubMed]
- Kellum, J.A.; Romagnani, P.; Ashuntantang, G.; Ronco, C.; Zarbock, A.; Anders, H.-J. Acute kidney injury. Nat. Rev. Dis. Primers 2021, 7, 52. [Google Scholar] [CrossRef]
- Favretto, G.; Souza, L.M.; Gregório, P.C.; Cunha, R.S.; Maciel, R.A.P.; Sassaki, G.L.; Toledo, M.G.; Pecoits-Filho, R.; Souza, W.M.; Stinghen, A.E.M. Role of Organic Anion Transporters in the Uptake of Protein-Bound Uremic Toxins by Human Endothelial Cells and Monocyte Chemoattractant Protein-1 Expression. J. Vasc. Res. 2017, 54, 170–179. [Google Scholar] [CrossRef]
- Nigam, S.K. The SLC22 Transporter Family: A Paradigm for the Impact of Drug Transporters on Metabolic Pathways, Signaling, and Disease. Annu. Rev. Pharmacol. Toxicol. 2018, 58, 663–687. [Google Scholar] [CrossRef]
- Meert, N.; Schepers, E.; Glorieux, G.; Van Landschoot, M.; Goeman, J.L.; Waterloos, M.-A.; Dhondt, A.; Van Der Eycken, J.; Vanholder, R. Novel method for simultaneous determination of p-cresylsulphate and p-cresylglucuronide: Clinical data and pathophysiological implications. Nephrol. Dial. Transplant. 2012, 27, 2388–2396. [Google Scholar] [CrossRef]
Parameter | Vehicle (5) | PCS 20 mg/L (5) | PCS 40 mg/L (4) | PCS 60 mg/L (4) |
---|---|---|---|---|
BW (g) | 25.85 ± 2.13 | 20.35 ± 1.63 *** | 25.47 ± 0.93 | 26.33 ± 1.36 |
HW (g) | 0.1332 ± 0.015 | 0.1172 ± 0.008 | 0.1105 ± 0.007 | 0.1173 ± 0.015 |
LK (g) | 0.1514 ± 0.019 | 0.1240 ± 0.011 * | 0.1155 ± 0.008 * | 0.0111 ± 0.022 |
RK (g) | 0.1556 ± 0.014 | 0.1288 ± 0.008 ** | 0.1315 ± 0.01 * | 0.1303 ± 0.014 * |
TL (mm) | 15.46 ± 0.20 | 15.45 ± 0.33 | 15.44 ± 0.24 | 15.55 ± 0.32 |
Parameter | Non-Treated | +PCS | ||
---|---|---|---|---|
Sham (6) | IR (6) | Sham (7) | IR (7) | |
BW (g) | 24.49 ± 3 | 24.25 ± 1.34 | 24.14 ± 1.27 | 23.47 ± 1.23 |
HW (g) | 0.1414 ± 0.021 | 0.466 ± 0.173 * | 0.1350 ± 0.010 | 0.1246 ± 0.009 |
LK (g) | 0.1612 ± 0.016 | 0.1267 ± 0.02 * | 0.1364 ± 0.014 | 0.1267 ± 0.002 |
RK (g) | 0.1612 ± 0.028 | 0.1619 ± 0.027 | 0.1498 ± 0.017 | 0.1591 ± 0.003 |
TL (mm) | 16.72 ± 0.31 | 19.97 ± 0.53 | 16.71 ± 0.19 | 16.40 ± 0.51 |
Gene | Sequence Forward | Sequence Reverse |
---|---|---|
Cyclophilin A | AGCATACAGGTCCTGGCATC | AGCTGTCCACAGTCGGAAAT |
Cystatin C | GCGTACCACAGCCGCGCCAT | TGGGGCTGGTCATGGAAAGGA |
KIM-1 | TGGCACTGTGACATCCTCAGA | GCAACGGACATGCCAACATA |
NGAL | CACCACGGACTACAACCAGTTCGC | TCAGTTGTCAATGCATTGGTCGGTG |
OAT1 | CCATCGTGACTGAGTGGAAC | TGTCCGCCAGGTAGCCAAAC |
OAT3 | CTTCAGAAATGCAGCTCTTG | ACCTGTTTGCCTGAGGACTG |
α-actin | GGCAAGATGAGAGTGCACAA | CGGAGAATGATGGTCCAGAT |
IL-6 | CTCTGCAAGAGACTTCCATCC | CTCTGTGAAGTCTCCTCTCCG |
IL1-β | AGTTGACGGACCCCAAAAGA | GCTCTTGTTGATGTGCTGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Falconi, C.A.; Fogaça-Ruiz, F.; da Silva, J.V.; Neres-Santos, R.S.; Sanz, C.L.; Nakao, L.S.; Stinghen, A.E.M.; Junho, C.V.C.; Carneiro-Ramos, M.S. Renocardiac Effects of p-Cresyl Sulfate Administration in Acute Kidney Injury Induced by Unilateral Ischemia and Reperfusion Injury In Vivo. Toxins 2023, 15, 649. https://doi.org/10.3390/toxins15110649
Falconi CA, Fogaça-Ruiz F, da Silva JV, Neres-Santos RS, Sanz CL, Nakao LS, Stinghen AEM, Junho CVC, Carneiro-Ramos MS. Renocardiac Effects of p-Cresyl Sulfate Administration in Acute Kidney Injury Induced by Unilateral Ischemia and Reperfusion Injury In Vivo. Toxins. 2023; 15(11):649. https://doi.org/10.3390/toxins15110649
Chicago/Turabian StyleFalconi, Carlos Alexandre, Fernanda Fogaça-Ruiz, Jéssica Verônica da Silva, Raquel Silva Neres-Santos, Carmen Lucía Sanz, Lia Sumie Nakao, Andréa Emília Marques Stinghen, Carolina Victoria Cruz Junho, and Marcela Sorelli Carneiro-Ramos. 2023. "Renocardiac Effects of p-Cresyl Sulfate Administration in Acute Kidney Injury Induced by Unilateral Ischemia and Reperfusion Injury In Vivo" Toxins 15, no. 11: 649. https://doi.org/10.3390/toxins15110649