Combined Water Extracts from Oxidation-Treated Leaves and Branches of Hovenia dulcis Has Anti-Hangover and Liver Protective Effects in Binge Alcohol Intake of Male Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparations of Extracts and Characterization
2.3. Determination of Total Phenolic and Flavonoid Contents
2.4. Animals and Treatments
2.5. Righting Reflex Test
2.6. Biochemical Assays
2.7. Measurement of the GSH/GSSG Ratio and Catalase Activity in the Liver
2.8. Immunohistochemistry
2.9. RT-PCR Analysis
2.10. Statistics
3. Results
3.1. Water Extract of Oxidation-Treated Leaves from H. dulcis Contains More Antioxidants Than Nontreated Raw Leaves and Has an Anti-Hangover Effect
3.2. Water Extract of H. dulcis Branches Contains Enriched Catechin Flavonoids
3.3. Mixture of Oxidation-Treated Leaves and Branches Extract Shows an Anti-Hangover Effect
3.4. Combined Formulation of Oxidation-Treated Leaves and Branches Extract Prevents Liver from Binge Alcohol-Induced Liver Injury
3.5. OLB Extract Protects the Liver from Oxidative/Nitrosative Damages Induced by Alcohol
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
Collectively
References
- Khanal, T.; Choi, J.H.; Hwang, Y.P.; Chung, Y.C.; Jeong, H.G. Protective effects of saponins from the root of Platycodon grandiflorum against fatty liver in chronic ethanol feeding via the activation of AMP-dependent protein kinase. Food Chem. Toxicol. 2009, 47, 2749–2754. [Google Scholar] [CrossRef]
- Wang, L.L.; Li, Y.; Zhou, S.F. Prediction of deleterious non-synonymous single nucleotide polymorphisms of genes related to ethanol-induced toxicity. Toxicol. Lett. 2009, 187, 99–114. [Google Scholar] [CrossRef] [PubMed]
- Je, J.; Kim, H.; Park, E.J.; Kim, S.R.; Dusabimana, T.; Jeong, K.; Yun, S.P.; Kim, H.J.; Cho, K.M.; Park, S.W. Fermentation of Sprouted Ginseng (Panax ginseng) Increases Flavonoid and Phenolic Contents to Attenuate Alcoholic Hangover and Acute Liver Injury in Mice. Am. J. Chin. Med. 2021, 49, 131–146. [Google Scholar] [CrossRef]
- Hyun, T.K.; Eom, S.H.; Yu, C.Y.; Roitsch, T. Hovenia dulcis—An Asian Traditional Herb. Planta Med. 2010, 76, 943–949. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.Y.; Kim, J.H.; Kim, G.; Kim, C.K.; Choi, M.S. Effect of fermented Hovenia dulcis Thunb fruit water extract onbiomarker for liver injury and body weight changes in rats given oral administration of ethanol. Korean J. Food Preserv. 2014, 21, 412–420. [Google Scholar] [CrossRef] [Green Version]
- Wiese, J.G.; Shlipak, M.G.; Browner, W.S. The alcohol hangover. Ann. Intern. Med. 2000, 132, 897–902. [Google Scholar] [CrossRef] [Green Version]
- Kauhanen, J.; Kaplan, G.A.; Goldberg, D.E.; Salonen, J.T. Beer binging and mortality: Results from the Kuopio ischaemic heart disease risk factor study, a prospective population based study. BMJ 1997, 315, 846–851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Molina, P.E.; Nelson, S. Binge Drinking’s Effects on the Body. Alcohol Res. 2018, 39, 99–109. [Google Scholar]
- DiPadova, C.; Worner, T.M.; Julkunen, R.J.; Lieber, C.S. Effects of fasting and chronic alcohol consumption on the first-pass metabolism of ethanol. Gastroenterology 1987, 92, 1169–1173. [Google Scholar] [CrossRef]
- Lee, S.L.; Chau, G.Y.; Yao, C.T.; Wu, C.W.; Yin, S.J. Functional assessment of human alcohol dehydrogenase family in ethanol metabolism: Significance of first-pass metabolism. Alcohol. Clin. Exp. Res. 2006, 30, 1132–1142. [Google Scholar] [CrossRef] [PubMed]
- Shukla, S.D.; Lim, R.W. Epigenetic effects of ethanol on the liver and gastrointestinal system. Alcohol Res. 2013, 35, 47–55. [Google Scholar] [PubMed]
- Lee, M.H.; Kwak, J.H.; Jeon, G.; Lee, J.W.; Seo, J.H.; Lee, H.S.; Lee, J.H. Red ginseng relieves the effects of alcohol consumption and hangover symptoms in healthy men: A randomized crossover study. Food Funct. 2014, 5, 528–534. [Google Scholar] [CrossRef] [PubMed]
- Pittler, M.H.; White, A.R.; Stevinson, C.; Ernst, E. Effectiveness of artichoke extract in preventing alcohol-induced hangovers: A randomized controlled trial. CMAJ 2003, 169, 1269–1273. [Google Scholar] [PubMed]
- Wiese, J.; McPherson, S.; Odden, M.C.; Shlipak, M.G. Effect of Opuntia ficus indica on symptoms of the alcohol hangover. Arch. Intern. Med. 2004, 164, 1334–1340. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Kim, Y.J.; Jeong, H.Y.; Kim, J.Y.; Choi, E.K.; Chae, S.W.; Kwon, O. A standardized extract of the fruit of Hovenia dulcis alleviated alcohol-induced hangover in healthy subjects with heterozygous ALDH2: A randomized, controlled, crossover trial. J. Ethnopharmacol. 2017, 209, 167–174. [Google Scholar] [CrossRef] [PubMed]
- Sung-Mun, K.; Sung-Hee, K.; Jin-Yeul, M.; Jin-Hyun, K. A Study on the Extraction and Efficacy of Bioactive Compound from Hovenia dulcis. Korean Soc. Biotechnol. Bioeng. 2006, 21, 11–15. [Google Scholar]
- Cho, J.Y.; Hyun, S.H.; Moon, J.H.; Park, K.H. Isolation and Structural Determination of a Novel Flavonol Triglycoside and 7 Compounds from the Leaves of Oriental Raisin tree (Hovenia dulcis) and Their Antioxidative Activity. Food Sci. Biotechnol. 2013, 22, 115–123. [Google Scholar] [CrossRef]
- Kim, H.J.; Cho, K.M.; Lee, K.S. Method for producing Hovenia Dulcis Extract with Enhanced Specific Flavonoid and Polyphenolic Compound Content. Korea Patent 10-1911401, 27 April 2017. [Google Scholar]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef] [Green Version]
- He, J.; Xu, L.; Yang, L.; Sun, C. Anti-oxidative effects of catechins and theaflavins on glutamate-induced HT22 cell damage. R. Soc. Chem. 2019, 9, 21418–21428. [Google Scholar] [CrossRef] [Green Version]
- Yee, E.M.H.; Brandl, M.B.; Pasquier, E.; Cirillo, G.; Kimpton, K.; Kavallaris, M.; Kumar, N.; Vittorio, O. Dextran-Catechin inhibits angiogenesis by disrupting copper homeostasis in endothelial cells. Sci. Rep. 2017, 7, 7638. [Google Scholar] [CrossRef] [Green Version]
- Park, J.H.; Kim, S.J.; Hwang, I.; Bae, K.C.; Bae, J.H.; Song, D.K. Green Tea Extract Co-administered with a Polymer Effectively Prevents Alcoholic Liver Damage by Prolonged Inhibition of Alcohol Absorption in Mice. Alcohol Alcohol. 2013, 48, 59–67. [Google Scholar] [CrossRef] [Green Version]
- Yiu, H.H.; Graham, A.L.; Stengel, R.F. Dynamics of a cytokine storm. PLoS ONE 2012, 7, e45027. [Google Scholar] [CrossRef]
- Vogt, B.L.; Richie, J.P. Glutathione depletion and recovery after acute ethanol administration in the aging mouse. Biochem. Pharmacol. 2007, 73, 1613–1621. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.M.; Dey, A. Regulation of Glutathione in Health and Disease with Special Emphasis on Chronic Alcoholism and Hyperglycaemia Mediated Liver Injury: A Brief Perspective. Springer Sci. Rev. 2014, 2, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Galicia-Moreno, M.; Rosique-Oramas, D.; Medina-Avila, Z.; Álvarez-Torres, T.; Falcón, D.; La Tijera, F.H.-D.; Béjar, Y.L.; Cordero-Pérez, P.; Muñoz-Espinosa, L.; Pérez-Hernández, J.L.; et al. Behavior of Oxidative Stress Markers in Alcoholic Liver Cirrhosis Patients. Oxidative Med. Cell. Longev. 2016, 2016, 1–10. [Google Scholar] [CrossRef]
- Vasiliou, V.; Ziegler, T.L.; Bludeau, P.; Petersen, D.R.; Gonzalez, F.J.; Deitrich, R.A. CYP2E1 and catalase influence ethanol sensitivity in the central nervous system. Pharm. Genom. 2006, 16, 51–58. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhang, T.; Kusumanchi, P.; Han, S.; Yang, Z.; Liangpunsakul, S. Alcohol Metabolizing Enzymes, Microsomal Ethanol Oxidizing System, Cytochrome P450 2E1, Catalase, and Aldehyde Dehydrogenase in Alcohol-Associated Liver Disease. Biomedicines 2020, 8, 50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lieber, C.S. Biochemical factors in alcoholic liver disease. Semin. Liver Dis. 1993, 13, 136–153. [Google Scholar] [CrossRef] [PubMed]
- Comporti, M.; Signorini, C.; Leoncini, S.; Gardi, C.; Ciccoli, L.; Giardini, A.; Vecchio, D.; Arezzini, B. Ethanol-induced oxidative stress: Basic knowledge. Genes Nutr. 2010, 5, 101–109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilkinson, P.K.; Sedman, A.J.; Sakmar, E.; Kay, D.R.; Wagner, J.G. Pharmacokinetics of ethanol after oral administration in the fasting state. J. Pharmacokinet. Biopharm. 1977, 5, 207–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Handler, J.A.; Thurman, R.G. Hepatic ethanol metabolism is mediated predominantly by catalase-H2O2 in the fasted state. FEBS Lett. 1988, 238, 139–141. [Google Scholar] [CrossRef] [Green Version]
- Villalobos-Garcia, D.; Hernandez-Munoz, R. Catalase increases ethanol oxidation through the purine catabolism in rat liver. Biochem. Pharmacol. 2017, 137, 107–112. [Google Scholar] [CrossRef]
- Knight, T.R.; Kurtz, A.; Bajt, M.L.; Hinson, J.A.; Jaeschke, H. Vascular and hepatocellular peroxynitrite formation during acetaminophen toxicity: Role of mitochondrial oxidant stress. Toxicol. Sci. 2001, 62, 212–220. [Google Scholar] [CrossRef] [Green Version]
- Barone, R.; Rappa, F.; Macaluso, F.; Caruso Bavisotto, C.; Sangiorgi, C.; Di Paola, G.; Tomasello, G.; Di Felice, V.; Marciano, V.; Farina, F.; et al. Alcoholic Liver Disease: A Mouse Model Reveals Protection by Lactobacillus fermentum. Clin. Transl. Gastroenterol. 2016, 7, e138. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Lindemeyer, A.K.; Gonzalez, C.; Shao, X.S.M.; Spigelman, I.; Olsen, R.W.; Liang, J. Dihydromyricetin As a Novel Anti-Alcohol Intoxication Medication. J. Neurosci. 2012, 32, 390–401. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.C.; Zhu, P.L.; Jiang, C.X.; Ma, L.P.; Zhang, Z.J.; Zeng, X.X. Preliminary characterization, antioxidant activity in vitro and hepatoprotective effect on acute alcohol-induced liver injury in mice of polysaccharides from the peduncles of Hovenia dulcis. Food Chem. Toxicol. 2012, 50, 2964–2970. [Google Scholar] [CrossRef]
- Park, J.Y.; Moon, J.Y.; Park, S.D.; Park, W.H.; Kim, H.; Kim, J.E. Fruits extracts of Hovenia dulcis Thunb. suppresses lipopolysaccharide-stimulated inflammatory responses through nuclear factor-kappaB pathway in Raw 264.7 cells. Asian Pac. J. Trop. Med. 2016, 9, 357–365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, B.H.; Hsieh, C.H.; Tsai, S.Y.; Wang, C.Y.; Wang, C.C. Anticancer effects of epigallocatechin-3-gallate nanoemulsion on lung cancer cells through the activation of AMP-activated protein kinase signaling pathway. Sci. Rep. 2020, 10, 5163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakata, R.; Nakamura, T.; Torimura, T.; Ueno, T.; Sata, M. Green tea with high-density catechins improves liver function and fat infiltration in non-alcoholic fatty liver disease (NAFLD) patients: A double-blind placebo-controlled study. Int. J. Mol. Med. 2013, 32, 989–994. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mika, M.; Kostogrys, R.B.; Franczyk-Zarow, M.; Wikiera, A.; Maslak, E. Anti-atherosclerotic activity of catechins depends on their stereoisomerism. Atherosclerosis 2015, 240, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Nagai, I.; Gao, Y.; Matsushima, Y.; Kawai, Y.; Sayama, K. Effects of catechins and caffeine on the development of atherosclerosis in mice. Biosci. Biotechnol. Biochem. 2017, 81, 1948–1955. [Google Scholar] [CrossRef] [Green Version]
- Xing, L.; Zhang, H.; Qi, R.; Tsao, R.; Mine, Y. Recent Advances in the Understanding of the Health Benefits and Molecular Mechanisms Associated with Green Tea Polyphenols. J. Agric. Food Chem. 2019, 67, 1029–1043. [Google Scholar] [CrossRef]
- Xu, R.; Yang, K.; Li, S.; Dai, M.; Chen, G. Effect of green tea consumption on blood lipids: A systematic review and meta-analysis of randomized controlled trials. Nutr. J. 2020, 19, 48. [Google Scholar] [CrossRef]
- Hodgson, A.B.; Randell, R.K.; Jeukendrup, A.E. The Effect of Green Tea Extract on Fat Oxidation at Rest and during Exercise: Evidence of Efficacy and Proposed Mechanisms. Adv. Nutr. 2013, 4, 129–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gu, Z.Z.; Nakamura, T.; Lipton, S.A. Redox Reactions Induced by Nitrosative Stress Mediate Protein Misfolding and Mitochondrial Dysfunction in Neurodegenerative Diseases. Mol. Neurobiol. 2010, 41, 55–72. [Google Scholar] [CrossRef] [Green Version]
- Daiber, A.; Daub, S.; Bachschmid, M.; Schildknecht, S.; Oelze, M.; Steven, S.; Schmidt, P.; Megner, A.; Wada, M.; Tanabe, T.; et al. Protein Tyrosine Nitration and Thiol Oxidation by Peroxynitrite-Strategies to Prevent These Oxidative Modifications. Int. J. Mol. Sci. 2013, 14, 7542–7570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zakhari, S. Overview: How is alcohol metabolized by the body? Alcohol Res. Health 2006, 29, 245–254. [Google Scholar] [PubMed]
- Albano, E. Alcohol, oxidative stress and free radical damage. Proc. Nutr. Soc. 2006, 65, 278–290. [Google Scholar] [CrossRef] [Green Version]
- Hernandez, J.A.; Lopez-Sanchez, R.C.; Rendon-Ramirez, A. Lipids and Oxidative Stress Associated with Ethanol-Induced Neurological Damage. Oxidative Med. Cell. Longev. 2016, 2016, 1543809. [Google Scholar] [CrossRef] [Green Version]
- Wilson, D.F.; Matschinsky, F.M. Ethanol metabolism: The good, the bad, and the ugly. Med. Hypotheses 2020, 140, 109638. [Google Scholar] [CrossRef]
Gene Name | Abbreviation | Primer Sequence (5′ to 3′) |
---|---|---|
Alcohol dehydrogenase 1 | ADH1 | F; GCCGAAGCGATCTGCTAAT |
R; AGGTGCTGGTGCTGATAAAG | ||
Cytochrome p450 enzyme 2E1 | CYP2E1 | F; CACAGCCAAGAACCCATGTA |
R; CATGAGAATCAGGAGCCCATATC | ||
Aldehyde dehydrogenase 2 | ALDH2 | F; GTCTTCACAAAGGACCTGGATA |
R; GCCACTCCCTGACATCTTATAG | ||
Superoxide dismutase 2 | SOD2 | F; CCACCGAGGAGAAGTACCACGAG |
R; CACACCGGAGACCAAATGATGTAC | ||
Glutathione peroxidase 1 | Gpx1 | F; CCACCGAGGAGAAGTACCACGAG |
R; CTCCTTATTGAAGCCAAGCCAGCC | ||
Cyclooxygenase 2 | Cox2 | F; TTTTCAGGCTTCACCCTAGATGA |
R; GAAGAATGTTATGTTTACTCCTACGAATATG | ||
Tumor necrosis factor-α | TNF-α | F; CATATACCTGGGAGGAGTCT |
R; GAGCAATGACTCCAAAGTAG | ||
Monocyte chemoattractant protein-1 | MCP1 | F; ACCTTTGAATGTGAAGTTGA |
R; CTACAGAAGTGCTTGAGGTG | ||
Glyceraldehyde 3-phosphate dehydrogenase | GAPDH | F; GTGGCAAAGTGGAGATTGTTG |
R; TTGACTGTGCCGTTGAATTTG |
(+)-Catechin | Taxifolin | Quercetin | Chlorogenic Acid | Ferulic Acid | |
---|---|---|---|---|---|
OL (µg/g) | 56.2 ± 5.2 | 3.45 ± 0.5 | 54.7 ± 4.2 | 21.1 ± 4.2 | 44.5 ± 3.8 |
BE (µg/g) | 268.9 ± 21.3 | 4.7 ± 0.8 | ND | ND | 35.7 ± 8.0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Je, J.; Song, M.; Baek, J.H.; Kang, J.S.; Chung, H.J.; Lee, K.; Park, S.W.; Kim, H.J. Combined Water Extracts from Oxidation-Treated Leaves and Branches of Hovenia dulcis Has Anti-Hangover and Liver Protective Effects in Binge Alcohol Intake of Male Mice. Nutrients 2021, 13, 4404. https://doi.org/10.3390/nu13124404
Je J, Song M, Baek JH, Kang JS, Chung HJ, Lee K, Park SW, Kim HJ. Combined Water Extracts from Oxidation-Treated Leaves and Branches of Hovenia dulcis Has Anti-Hangover and Liver Protective Effects in Binge Alcohol Intake of Male Mice. Nutrients. 2021; 13(12):4404. https://doi.org/10.3390/nu13124404
Chicago/Turabian StyleJe, Jihyun, Miyoung Song, Ji Hyeong Baek, Jae Soon Kang, Hye Jin Chung, Kwonsu Lee, Sang Won Park, and Hyun Joon Kim. 2021. "Combined Water Extracts from Oxidation-Treated Leaves and Branches of Hovenia dulcis Has Anti-Hangover and Liver Protective Effects in Binge Alcohol Intake of Male Mice" Nutrients 13, no. 12: 4404. https://doi.org/10.3390/nu13124404