Next Article in Journal
Influence of Short-Term Hyperenergetic, High-Fat Feeding on Appetite, Appetite-Related Hormones, and Food Reward in Healthy Men
Previous Article in Journal
Antiviral Functional Foods and Exercise Lifestyle Prevention of Coronavirus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 12
Issue 9
10.3390/nu12092634
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats

by
Juste Maneikyte
1,2,
Augustinas Bausys
1,2,3,
Bettina Leber
1,
Nicole Feldbacher
1,
Gerald Hoefler
4,
Dagmar Kolb-Lenz
5,6,
Kestutis Strupas
2,
Philipp Stiegler
1 and
Peter Schemmer
1,*
1
General, Visceral and Transplant Surgery, Department of Surgery, Medical University of Graz, 8036 Graz, Austria
2
Faculty of Medicine, Vilnius University, 03101 Vilnius, Lithuania
3
National Cancer Institute, 08406 Vilnius, Lithuania
4
Diagnostic and Research Institute of Pathology, Medical University of Graz, 8010 Graz, Austria
5
Institute of Cell Biology, Histology and Embryology, Medical University Graz, 8010 Graz, Austria
6
Center for Medical Research, Core Facility Ultrastructure Analysis, Medical University Graz, 8010 Graz, Austria
*
Author to whom correspondence should be addressed.
Nutrients 2020, 12(9), 2634; https://doi.org/10.3390/nu12092634
Submission received: 8 June 2020 / Revised: 23 August 2020 / Accepted: 26 August 2020 / Published: 28 August 2020
(This article belongs to the Section Nutrition and Metabolism)
Browse Figures
Versions Notes

Abstract

:
Introduction: FOLFOX chemotherapy (CTx) is used for the treatment of colorectal liver metastasis (CRLM). Side effects include rare cardiotoxicity, which may limit the application of FOLFOX. Currently, there is no effective strategy to prevent FOLFOX-induced cardiotoxicity. Glycine has been shown to protect livers from CTx-induced injury and oxidative stress, and it reduces platelet aggregation and improves microperfusion. This study tested the hypothesis of glycine being cardioprotective in a rat model of FOLFOX in combination with CRLM. Materials and Methods: The effect of glycine was tested in vitro on human cardiac myocytes (HCMs). To test glycine in vivo Wag/Rij rats with induced CRLM were treated with FOLFOX ±5% dietary glycine. Left ventricle ejection fraction (LVEF), myocardial fibrosis, and apoptosis, also heart fatty acid binding protein (h-FABP) and brain natriuretic peptide levels were monitored. PCR analysis for Collagen type I, II, and brain natriuretic peptide (BNP) in the heart muscle was performed. Results: In vitro glycine had no effect on HCM cell viability. Treatment with FOLFOX resulted in a significant increase of h-FABP levels, increased myocardial fibrosis, and apoptosis as well as increased expression of type I Collagen. Furthermore, FOLFOX caused a decrease of LVEF by 10% (p = 0.028). Dietary glycine prevented FOLFOX-induced myocardial injury by preserving the LVEF and reducing the levels of fibrosis (p = 0.012) and apoptosis (p = 0.015) in vivo. Conclusions: Data presented here demonstrate for the first time that dietary glycine protects the heart against FOLFOX-induced injury during treatment for CRLM.

1. Introduction

Colorectal cancer (CRC) is the third most common cancer worldwide [1]. More than half of those patients develop liver metastasis requiring chemotherapy (CTx) in the neoadjuvant, adjuvant, or palliative setting [2,3]. FOLFOX, which consists of 5-fluorouracil (5-FU), leucovorin, and oxaliplatin (OX) is proven to be effective for colorectal cancer liver metastasis (CRLM) treatment [4]. However, the use of these cytotoxic agents is associated with numerous side effects including cardiotoxicity, which is a severe and even potentially lethal complication [5]. The reported incidence of 5-FU-induced cardiotoxicity varies between 1% and 68% for various solid cancers [6,7,8], with a rate of 8.5% in a specific colorectal cancer patients cohort [9]. The exact pathophysiologic mechanisms for FOLFOX-induced cardiotoxicity are not fully clarified but both agents—5-FU and OX—are known to be cardiotoxic, and several mechanisms including coronary thrombosis, arteritis, and vasospasm have been proposed [10]. Some studies show direct 5-FU-mediated cytotoxic effects on the endothelium resulting in the release of vasoactive substances and development of a prothrombogenic status [11] or direct toxic effects of 5-FU on cardiomyocytes, interaction with the coagulation system, and autoimmune responses [10]. The exact mechanisms for platinum-based drugs’ cardiotoxicity remains unknown as well [12]. Currently, few hypotheses exist including the secondary toxic effect due to nephrotoxicity, the potential negative effect on the sinoatrial node, or direct damage by reactive oxygen species [12,13]. Additionally, the incidence of cardiotoxicity seems to increase when 5-FU and OX are combined [14,15]. As FOLFOX-induced cardiotoxicity can cause irreversible damage to the myocardium, preventive strategies are mandatory.
Glycine is a simple amino acid with known biological activity. Experimental studies show that glycine reduces human and rat platelet aggregation in vitro [16], improves microcirculation [17], has antioxidative effects [18,19] as well as anti-inflammatory, immunomodulatory, and direct cytoprotective properties [20]. Moreover, glycine was shown to have anti-tumorigenic properties in a previously described animal model of CRLM induced by CC531 cells [21].
Therefore, we hypothesized, that glycine may work as a cardioprotective substance against FOLFOX-induced cardiotoxicity in vitro and in vivo. This study aimed to demonstrate the cardioprotective potential of glycine on rats suffering from CRLM and treated with a single cycle of FOLFOX CTx.

2. Materials and Methods

2.1. Cell Culture

2.1.1. Cell Line

Human cardiac myocytes (HCMs, Promo Cell, Heidelberg, Germany) were cultivated at humified atmosphere at 37 °C, 5% CO2 using ready-to-use Myocyte Growth Medium (Promo Cell, Heidelberg, Germany). The culture medium was renewed every second or third day, and cells were re-seeded whenever 90% confluence was reached.
A rat colorectal cancer cell line (CC531) (Cell Lines Service, Eppelheim, Germany) was cultivated at 37 °C, 5% CO2 using RPMI-1640 medium supplemented with 10% fetal bovine serum (GE Healthcare Life Sciences, Logan, UT, USA), 1% penicillin/streptomycin, 1% L-glutamine, and 25 mM HEPES as described previously [21]. The culture medium was renewed every second or third day, and cells were re-seeded whenever 90% confluence was reached.

2.1.2. Cell Proliferation and Viability Assay

To determine the effect of glycine on HCMs, 1.5 × 104 cells per well were seeded in 96-well plates and grown for 24 hours at standard conditions in glycine-free media. Subsequently, conditioning by supplementation of media with various concentrations of glycine (Control (0), 0.05, 0.1, 0.25, 0.5, 1, 2, 4, and 8 mmol/L; Carl Roth, Karlsruhe, Germany) for 48 hours was done. After incubation, cell viability was measured by the 3-(4,5-dimethylthiazol-2-yl)5-diphenyltetrazolium bromide (MTT; Sigma Aldrich, St. Louis, MO, USA) assay according to the manufacturer’s guidelines. Briefly, MTT (Sigma Aldrich, St. Louis, MO, USA) solution was added to the cells and incubated for 2 hours at 37 °C. After discarding the supernatant, the precipitated formazan crystals were dissolved in dimethyl sulfoxide (Sigma Aldrich, St. Louis, MO, USA), and the optical density was measured after 30 minutes at 570 nm by a SPECTROstar microplate reader (BMG Labtech, Ortenberg, Germany). Cell viability was calculated as the percentage of vehicle control. All experiments were performed in duplicates and repeated three times.

2.2. Animal Experiments

All animal experiments were performed in accordance with 3Rs, principles of laboratory animal care, and the Austrian national laws. Republic of Austria federal ministry of education, science, and research approval (BMWFW-66.010/0130-WF/V/3b/2017) was obtained before this study was conducted. Seven-week-old male Wag/Rij rats (weight 150–220 g) were purchased from Charles River (Wilmington, MA, USA) and kept in the animal facility of the Medical University of Graz under standard laboratory conditions. A 12:12 h light:dark cycle was maintained. All the animals had access to water and food ad libitum. Weighing and blood drawing were done on the first experimental day and days 6, 14, 17, and 21. All study-related procedures were performed at approximately the same daytime to avoid bias caused by natural circadian rhythms.

2.3. Experimental Protocol

The study design is shown in Figure 1. Forty-four animals were randomized into 6 groups. On the first day of the study, regular rat chow was replaced by study diets. Half of the animals (n = 22) received a 5% glycine-enriched diet (glycine diet: modified C1000 diet 15% casein plus 5% glycine; Altromin Spezialfutter, Lage, Germany). The other animals (n = 22) received a 20% casein diet for isonitrogenous balance as a control diet (control diet: 20% casein; Altromin Spezialfutter, Lage, Germany) since casein is a standard control for dietary glycine as described previously [22]. After 6 days, CRC liver metastasis was induced by injecting CC531 cells into the right liver lobe as described below. Sham animals (n = 8) underwent the same procedures, with an injection of cell-free PBS. Eight days after tumor implantation, a heart ultrasound to evaluate heart function was performed as described below. Immediately after imaging, animals received one cycle of FOLFOX CTx, which consisted of 200 mg/m2 calcium folinate (Sandoz, Holzkirchen, Germany), 85 mg/m2 OX (Fresenius Kabi, Bad Homburg, Germany), and 1000 mg/m2 5-FU (Sandoz, Holzkirchen, Germany) injected intraperitoneal. Twenty-four hours after the first dose, the second dose of 200 mg/m2 calcium folinate and 1000 mg/m2 5-FU was applied in the same way. The doses were calculated according to the animals’ skin surface as described elsewhere [22]. Control animals received an equivalent volume of saline. Seven days after the FOLFOX application, the heart ultrasound was repeated immediately before animals were sacrificed for organ and blood collection.

2.4. Tumor Implantation

For tumor implantation, anesthesia was induced by isoflurane (2%, 2 L/min) and fentanyl (5 µg/kg, i.m.) application. Animals were placed in a supine position on an automatically regulated heating pad to maintain a body temperature of 37 °C during the procedure. Under continuous isoflurane (2%, 2 L/min) inhalation, a right subcostal incision was performed. The right liver lobe was mobilized, and 100 µL (5 × 106 cells) of cell suspension in PBS was injected under the liver capsule. The laparotomy was closed by two layers of interrupted stitches (Vicryl 4-0, Ethicon, Somerville, NJ, USA). The skin was adapted and glued with tissue glue (Mayer-Haake, Ober-Mörlen, Germany). The procedure-related pain was managed with a single subcutaneous injection of carprofen (4 mg/kg) and by addition of ibuprofen (0.4 mg/mL) to the drinking water for 4–5 days.

2.5. Heart Ultrasound

Inhalational anesthesia was induced with isoflurane (2%, 2 L/min) and maintained during the procedure. Heart ultrasound was performed using the VisualSonics Vevo 770® High-Resolution Imaging System (VisualSonics Inc., Toronto, Canada). Left parasternal short-axis views of the left ventricle (LV) at the level of papillary muscles were used to define the internal diameters of the LV. Left ventricular end-diastolic diameter (LVEDD) and left ventricular end-systolic diameter (LVESD) were determined from the obtained M-mode pictures. The ejection fraction was calculated by the Teichholz formula as described elsewhere [23].

2.6. Blood Sample Analysis

Venous blood samples were collected from the subclavian vein under isoflurane anesthesia. Complete blood count (CBC) was measured using V-Sight hematology analyzer (A. Menarini Pharma GmbH, Vienna, Austria).
A commercially available enzyme-linked immunosorbent assay (ELISA) kit was used to measure concentrations of heart fatty acid-binding protein (h-FABP) (Cusabio Biotech, Newark, NJ, USA) and brain natriuretic peptide (BNP) (Abcam, Cambridge, United Kingdom) in plasma samples collected on the last experimental day. Tests were performed according to the manufacturer’s instruction.

2.7. Histology and Immunohistochemistry

Collagen in hearts was stained using chromotrope aniline blue (CAB) staining in a routine pathology lab in Medical University of Graz on sections from formalin-fixed, paraffin-embedded (FFPE) specimens. Stained slides were scanned using the Apperio AT (Wetzlar, Germany) slide scanner and viewed using the Aperio ImageScope ver.12.3.2.8013 software (Leica Biosystems, Wetzlar, Germany). Quantification of CAB staining was performed in 5 randomly selected areas in each heart. Snapshots at 100× magnification were taken and analyzed using the ImageJ software (U.S. National Institutes of Health, Bethesda, MD, USA), giving a quantification based on the image color analysis. The fibrosis index was calculated as percentage of blue color per picture.
For immunohistochemistry, 3 µm sections of FFPE heart samples were used. To evaluate apoptosis anti-caspase 3 antibody (Abcam, Cambridge, UK; dilution 1:200, rabbit polyclonal) was used in combination with the UltraVision LP Detection System HRP Polymer (Thermo Fisher Scientific, Waltham, MA, USA) and DAB chromogen (Dako, Via Real Carpinteria, CA, USA). For positive control, rat thymus tissue was stained. For negative control, primary antibodies were omitted. Stained slides were scanned and viewed using the same optical system and software as mentioned above.
Quantification of Caspase 3 was performed in 5 randomly selected heart areas from each slide. Snapshots at 100× magnification were taken and analyzed using ImageJ software. For Caspase 3 analysis, IHC and Classic Watershed plugins were used. The apoptotic index was calculated as the ratio of positively stained nuclei to the total number of nuclei per view.

2.8. Electron Microscopy

For electron microscopy, heart tissue was fixed in 2.5% (wt/vol) glutaraldehyde and 2% (wt/vol) paraformaldehyde in 0.1 mol/L phosphate buffer, pH 7.4, for 2 h, postfixed in 1% (wt/vol) osmium tetroxide for 2 h at room temperature. After dehydration (graded series of ethanol), tissue was infiltrated (ethanol and agar 100 epoxy resin, pure agar 100 epoxy resin) and placed in agar 100 epoxy resin (8 h), transferred into embedding molds, and polymerized (48 h, 60 °C).
Ultrathin sections (70 nm) were prepared by a UC 7 Ultramicrotome (Leica Microsystems, Vienna, Austria) and stained with lead citrate for 5 min and platin blue for 15 min. Images were taken using a Tecnai G2 20 transmission electron microscope (FEI, Eindhoven, Netherlands) with a Gatan UltraScan 1000 charge-coupled device (CCD) camera at −20 °C (acquisition software Digital Micrograph; Gatan, Munich, Germany). The acceleration voltage was 120 kV.

2.9. Quantitative Polymerase Chain Reaction

2.9.1. RNA Isolation and Reverse Transcription

Heart tissue samples were snap-frozen and stored in liquid nitrogen until nucleic acid extraction. Then, 50–100 mg of tissue was homogenized in 1 mL TRIzol reagent in combination with a MagNA Lyser (Roche Diagnostics GmbH, Mannheim, Germany). Isolation of RNA was done according to the protocol provided by the manufacturer. Quality and quantity were determined by Nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). Two micrograms of RNA was used for reverse transcription (High-Capacity cDNA RT Kit; Thermo Fisher Scientific, Waltham, MA, USA) according to the protocol provided by the manufacturer in a final volume of 20 µL.

2.9.2. Real-Time PCR

Real-time PCR amplification and melting analysis were performed based on an already published method [24] using a BioRad CFX96 TouchTM System (Bio-Rad Laboratories Ges.m.b.H., Vienna, Austria). cDNA corresponding to an equivalent of 5 ng RNA was added to a reaction mix containing Promega GoTaq® qPCR Master Mix (Promega, Madison WI, USA) containing 1 µM of each primer in a final reaction volume of 10 μL. The PCR reaction mixture was subjected to an initial denaturation at 95 °C for 10 seconds, followed by 45 cycles of denaturation at 95 °C for 10 seconds, annealing at 58 °C at 20 seconds and elongation at 72 °C for 30 seconds followed by a melting curve (60 to 95 °C). For detailed information of primers used see Table 1.
Gene expression was determined using the Bio-Rad CFX Manager 3.1 (Bio-Rad Laboratories Ges.m.b.H., Vienna, Austria) using the Cq regression method embedded in the program. All PCR reactions were done in duplicates. Data were normalized to the housekeeping gene (ACTB) and fold change was calculated as the ratio of the target gene expression in the experimental groups.

2.10. Statistical Analysis

Statistical analysis was performed using SPSS v.20.0 (SPSS Inc., Chicago, IL, USA). Data are presented as median and quartiles (Q1, Q3) unless stated differently. Differences between groups were analyzed using non-parametric tests, i.e., Mann–Whitney U test or Kruskal–Wallis test. Two-tailed Spearman test was used for continuous data correlation. All statistical tests were wo-sided. p-Values < 0.05 were considered statistically significant.

2.11. Ethics Approval and Consent to Participate

All animal experiments were performed in accordance with the principles of laboratory animal care and national laws. The study protocol was approved by the Austrian ministry for science, research, and economy (No. BMWFW-66.010/0130-WF/V/3b/2017; August 2017).

3. Results

3.1. Cell Experiments

Various concentrations of glycine did not have any significant impact on the viability of HCM cells (Figure 2).

3.2. Animal Experiments

3.2.1. General Health Conditions and Body Weight

Forty-three (97.7%) animals survived the whole experimental protocol. Animals were not affected by study-related procedures, other than FOLFOX, which resulted in diarrhea and weight loss. The median weight of animals on day 21 in FOLFOX groups with glycine or casein was 90% and 93% of baseline weight, respectively. In comparison, groups without FOLFOX weighted 123–129% of baseline weight, p < 0.05.

3.2.2. Complete Blood Count

Hemoglobin (HGB) and red blood cell (RBC) levels remained stable throughout the whole study period in all study groups. FOLFOX induced a significant decrease in white blood cells (WBCs), which progressed until severe leukopenia (Table 2). Glycine did not affect HGB, RBC, or WBC levels.

3.2.3. Glycine Concentration in Serum

Animals treated with glycine diet had almost fivefold higher plasma glycine concentration compared to animals who received casein diet (955 (400; 1250) µmol/L vs. 190 (126; 285) µmol/L, p = 0.001).

3.2.4. BNP and h-FABP Concentrations in Serum

BNP levels were not different between the study groups. FOLFOX significantly increased the h-FABP level to 1904 (1265; 5514) pg/mL compared to 728 (499; 900) pg/mL in corresponding control (p = 0.01) (Figure 3). Glycine reduced the increase of h-FABP after FOLFOX by 35%, however, the difference failed to be significant.

3.2.5. Heart Ultrasound

Baseline values of LVEF measured before FOLFOX in different groups varied between 76% and 82%, p = 0.207. After FOLFOX application, LVEF significantly decreased from 82% (78; 85) to 72% (65; 81), p = 0.028 in the group treated with casein diet. In contrast, glycine prevented a decrease in LVEF after FOLFOX (Figure 4).
CRLM alone had no effect on LVEF (Figure 4). The decrease of LVEF in groups treated with FOLFOX significantly correlated with the serum h-FABP level (R = 0.572, p = 0.033) and fibrosis index in the myocardium (R = 0.731, p = 0.005). Although, apoptotic index in the myocardium, as well as BNP, type I and II collagen gene expression levels, showed no significant correlation with the decrease of LVEF.

3.2.6. Fibrosis Index in the Myocardium

Figure 5 shows the fibrosis index in each study group measured by CAB staining. The highest myocardial fibrosis index of 5.1% (4.5; 7.0) was in the group treated with Casein–FOLFOX. Glycine prevented increased fibrosis following FOLFOX, while the fibrosis index was reduced by 33%, p = 0.012. Moreover, the fibrosis index in the Glycine–FOLFOX group was not significantly different from that of the groups without CTx.

3.2.7. Apoptotic Index in the Myocardium

FOLFOX induced the increase of apoptosis in the myocardium (Figure 6). Glycine prevented the FOLFOX-induced increase of apoptosis, while the apoptotic index was reduced by 3.5-fold, p = 0.015.

3.2.8. Electron Microscopy of Heart Tissue

Representative transmission electron microscopy images are shown in Figure 7. The groups without FOLFOX (Casein–Sham, Glycine–Sham, Casein–Control, and Glycine–Control) all showed normal architecture of the heart (Figure 7A). In the Casein–FOLFOX group, collagen fibers within the heart muscle and lysosomes within the endothelial cells were observed (Figure 7B), whereas those changes were absent in the Glycine–FOLFOX group (Figure 7C).

3.2.9. qPCR of Heart Tissue

The expression of type I collagen was upregulated in the FOLFOX groups compared to that in corresponding controls (p < 0.05). Although, there was no differences between Casein–FOLFOX and Glycine–FOLFOX groups (Figure 8A). Type II collagen (Figure 8B) and BNP (Figure 8C) gene expression was not different between the study groups.

4. Discussion

This study investigated the potential cardioprotective effect of the non-toxic amino acid, glycine, in a CRLM FOLFOX CTx rat model. The results demonstrate that glycine is involved in processes that have a significant cardioprotective effect by reducing the level of FOLFOX-induced fibrosis and apoptosis in the myocardial tissue and preserving LVEF.
The pyrimidine antimetabolite (5-FU) or its orally administered prodrug, capecitabine, is widely used in the treatment of breast, bladder, prostate, and various gastrointestinal cancers, including CRC [25]. However, the use and effectiveness are limited by cardiotoxicity, which most commonly occurs already after the first cycle of administration [26]. Moreover, the incidence of cardiotoxicity seems to be even higher when fluoropyrimidines are used in combination with OX [14,15] as used in the FOLFOX CTx scheme and in the presented experimental model. The pathogenesis of 5-FU-induced cardiotoxicity is still not fully clarified [27,28], and there are even less data on OX-induced cardiotoxicity [12]. The existing theories for 5-FU cardiotoxicity include vasoconstriction, endothelial injury leading to a procoagulant state, and direct myocardial cell toxicity [28,29,30,31]. Several previous preclinical studies suggested that fluoropyrimidines may induce direct cardiomyocyte injury via oxidative stress, the release of free radicals, and induction of nuclear alteration, cytoplasmic vacuolization, membrane injury, and autophagy [32,33,34]. All these changes finally trigger cell apoptosis and result in cardiotoxicity [28]. Moreover, the platinum-based agents may also cause direct, reactive oxygen species-mediated injury of the heart [12]. In this study, which supports the direct cardiomyocyte toxicity by FOLFOX, a more than threefold higher rate of apoptotic cells, increased expression of type I collagen gene in heart tissue, and myocardial fibrosis were detected after FOLFOX application. Besides the FOLFOX-induced pathologic changes in the myocardial tissue, impaired LV function was detected and the decrease of LVEF after FOLFOX correlated to h-FABP level and myocardial fibrosis. These results are in accordance with several recent preclinical studies, which also showed an increased level of apoptosis, myocardial fibrosis, and decreased LVEF after treatment with anthracycline-based chemotherapy [35,36,37,38] and with the series of reports that showed reduced LVEF following 5-FU-based chemotherapy in humans [39,40,41,42,43].
Interestingly, the myocardial injury marker, h-FABP level, was markedly elevated after FOLFOX CTx irrespective of diet but was noticeably lower in animals who received glycine. On the one hand, ElGhandour et al. [44] studied h-FABP in 40 patients treated with 6 cycles of anthracycline-based CTx and concluded that h-FABP may serve as a reliable and early marker of CTx-induced cardiotoxicity. On the other hand, another study investigating the potential of h-FABP to predict 5-FU-caused cardiotoxicity failed to show similar results [45]. h-FABP is a specific [46] and early marker of myocardial injury, which should appear in the circulation within 90 minutes after myocardial damage [45,47] and should return to normal values within 24–36 hours [48]. Therefore, it was surprising to find a significantly increased h-FABP level at 7 days after 5-FU-based CTx in this study. The delayed cardiotoxicity of 5-FU-based chemotherapy might be explained by the biotransformation of 5-FU to fluoroacetate (FAC) and a-fluoro-f-hydroxypropionic acid (FHPA) in vivo [49]. FAC is a highly cardiotoxic poison [50] and FHPA is cardiotoxic at higher doses [49]. It is known, that FAC and α-fluoro-β-alanine hydrochloride (FABL), which is a precursor of FHPA, accumulate in the organism [51,52] and therefore the onset of cardiotoxicity may be delayed until the sufficient cumulative dose of cardiotoxic metabolites accumulates.
Some authors discuss that glycine may have cardiotoxic side effects itself [53,54,55]. Although, the heart seems to be a key target for glycine-induced toxicity at certain dosages that cannot be obtained when using a glycine-enriched diet [53,56,57]. Furthermore, glycine was tested in several clinical trials and none of them revealed relevant toxicity of the amino acid [56,57]. In the in vitro part of this study, the effect of glycine on cardiomyocytes’ growth and viability was evaluated and it could be shown that glycine at concentrations up to 8 mM did not have a negative effect on cardiomyocytes growth and viability. Taken together, it seems that glycine can be cardiotoxic at very high concentrations but is non-cardiotoxic and even has a cardioprotective effect against FOLFOX-induced cardiotoxicity when used in concentrations applied in the course of this experiment.
Data shown in this study state that glycine could be beneficial in cardioprotection in a CRLM FOLFOX CTx rat model. Exact pathomechanisms have to be evaluated and may comprise different modes of actions. First, glycine reduces human and rat platelet aggregation in vitro [16] and improves microcirculation [17]. Second, several recently published in vivo studies reported antioxidative features of glycine [18,19]. Since the proposed mechanisms of 5-FU-induced cardiotoxicity include vasoconstriction, endothelial injury leading to a procoagulant state, and direct myocardial cell toxicity [28,29,30,31], which was supported by the present study results, it seems that glycine may have a protective effect against all of these pathophysiologic mechanisms. Further, this study demonstrated that glycine reduces the chemotherapy-induced myocardial fibrosis, and such findings were consistent with several previous studies that showed anti-fibrotic properties of glycine in preclinical models of liver diseases [58,59] and Duchenne muscular dystrophy [60]. Since fibrosis is a key component in the pathogenesis of cardiac dysfunction and reduced ejection fraction [61], the prevention of it by glycine may play a central role in the protection of cardiac function. Moreover, besides a cardioprotective effect, glycine has other properties that are beneficial in CRLM treatment. Dietary glycine has a hepatoprotective effect against FOLFOX chemotherapy-induced liver injury [22]. Further, glycine has anti-tumorigenic properties, which were demonstrated in several experimental studies [62,63] including this experimental model as published previously [21].
Taking the results of this study together with the previously gained knowledge, it seems that glycine is a promising substance in limiting FOLFOX-induced cardiotoxicity. Further studies are needed in order to characterize the exact pathomechanisms of glycine as a chemo additive substance to FOLFOX CTx.

5. Conclusions

The non-toxic amino acid, glycine, showed promising cardioprotective properties in FOLFOX-based CTx in CRLM treatment. However, randomized controlled trials are needed to prove the positive effects of glycine in a human setting, bringing the promising results of this study from bench to bedside in FOLFOX-treated patients suffering from CRLM.

Author Contributions

P.S. (Peter Schemmer), P.S. (Philipp Stiegler), and K.S. contributed to the conception or design of the work. P.S. (Peter Schemmer) and P.S. (Philipp Stiegler) contributed to the provision of resources; J.M., A.B., B.L., N.F., D.K.-L., and G.H. contributed to the acquisition of data. J.M., A.B., and B.L. contributed to the analysis and interpretation of data. J.M. and A.B. prepared the manuscript. B.L., K.S., P.S. (Peter Schemmer) and P.S. (Philipp Stiegler) revised the manuscript. All authors read and approved the final manuscript.

Funding

This research received no external funding.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

BNPbrain natriuretic peptide
CABchromotrope aniline blue
CBCcomplete blood count
CCDcharge-coupled device
CRCcolorectal cancer
CRLMcolorectal liver metastasis
CTxchemotherapy
ELISAenzyme-linked immunosorbent assay
FABLα-fluoro-β-alanine hydrochloride
FACfluoroacetate
FHPAa-fluoro-f-hydroxypropionic acid
HCMhuman cardiac myocyte
HGBhemoglobin
h-FABPheart fatty acid binding protein
LVleft ventricle
LVEDDleft ventricular end-diastolic diameter
LVEFleft ventricle ejection fraction
LVESDleft ventricular end-systolic diameter
OXoxaliplatin
RBCred blood cell
WBCwhite blood cell
5-FU5-fluorouracil

References

  1. Wu, X.; Pu, X.; Melkonian, S.C.; Spitz, M.R. Cancer epidemiology. In Holland-Frei Cancer Medicine; American Cancer Society: Atlanta, GA, USA, 2017; pp. 1–9. ISBN 978-1-119-00082-2. [Google Scholar]
  2. Luo, D.; Liu, Q.; Yu, W.; Ma, Y.; Zhu, J.; Lian, P.; Cai, S.; Li, Q.; Li, X. Prognostic value of distant metastasis sites and surgery in stage IV colorectal cancer: A population-based study. Int. J. Colorectal Dis. 2018, 33, 1241–1249. [Google Scholar] [CrossRef]
  3. Yoo, P.S.; Lopez-Soler, R.I.; Longo, W.E.; Cha, C.H. Liver resection for metastatic colorectal cancer in the age of neoadjuvant chemotherapy and bevacizumab. Clin. Colorectal Cancer 2006, 6, 202–207. [Google Scholar] [CrossRef]
  4. Mohelnikova-Duchonova, B.; Melichar, B.; Soucek, P. FOLFOX/FOLFIRI pharmacogenetics: The call for a personalized approach in colorectal cancer therapy. World J. Gastroenterol. 2014, 20, 10316–10330. [Google Scholar] [CrossRef] [PubMed]
  5. De Forni, M.; Malet-Martino, M.C.; Jaillais, P.; E Shubinski, R.; Bachaud, J.M.; Lemaire, L.; Canal, P.; Chevreau, C.; Carrie, D.; Soulié, P. Cardiotoxicity of high-dose continuous infusion fluorouracil: A prospective clinical study. J. Clin. Oncol. 1992, 10, 1795–1801. [Google Scholar] [CrossRef] [PubMed]
  6. Yeh, E.T.; Bickford, C.L. Cardiovascular complications of cancer therapy. J. Am. Coll. Cardiol. 2009, 53, 2231–2247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Labianca, R.; Beretta, G.; Clerici, M.; Fraschini, P.; Luporini, G. Cardiac toxicity of 5-fluorouracil: A study on 1083 patients. Tumori J. 1982, 68, 505–510. [Google Scholar] [CrossRef]
  8. Rezkalla, S.; A Kloner, R.; Ensley, J.; Al-Sarraf, M.; Revels, S.; Olivenstein, A.; Bhasin, S.; Kerpel-Fronious, S.; Turi, Z.G. Continuous ambulatory ECG monitoring during fluorouracil therapy: A prospective study. J. Clin. Oncol. 1989, 7, 509–514. [Google Scholar] [CrossRef]
  9. Jensen, S.A.; Hasbak, P.; Mortensen, J.; Sørensen, J.B. Fluorouracil induces myocardial ischemia with increases of plasma brain natriuretic peptide and lactic acid but without dysfunction of left ventricle. J. Clin. Oncol. 2010, 28, 5280–5286. [Google Scholar] [CrossRef]
  10. Madeddu, C.; Deidda, M.; Piras, A.; Cadeddu, C.; Demurtas, L.; Puzzoni, M.; Piscopo, G.; Scartozzi, M.; Mercuro, G. Pathophysiology of cardiotoxicity induced by nonanthracycline chemotherapy. J. Cardiovasc. Med. 2016, 17, S12–S18. [Google Scholar] [CrossRef]
  11. El Azim, B.H.A. Biochemical studies of captopril against 5-Flurouracil induced heart Toxicity in rats. Int. J. Adv. Res. 2015, 3, 247–261. [Google Scholar]
  12. Oun, R.; Moussa, Y.; Wheate, N.J. The side effects of platinum-based chemotherapy drugs: A review for chemists. Dalton Trans. 2018, 47, 6645–6653. [Google Scholar] [CrossRef] [PubMed]
  13. Oun, R.; Rowan, E.G. Cisplatin induced arrhythmia; electrolyte imbalance or disturbance of the SA node? Eur. J. Pharmacol. 2017, 811, 125–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Morrow, P.K.; Hoff, P.M. Does the addition of oxaliplatin increase the risk of capecitabine-induced cardiotoxicity? Nat. Rev. Clin. Oncol. 2006, 3, 76–77. [Google Scholar] [CrossRef] [PubMed]
  15. Kwakman, J.J.M.; Simkens, L.H.; Mol, L.; Kok, W.E.; Koopman, M.; Punt, C.J.A. Incidence of capecitabine-related cardiotoxicity in different treatment schedules of metastatic colorectal cancer: A retrospective analysis of the CAIRO studies of the Dutch Colorectal Cancer Group. Eur. J. Cancer 2017, 76, 93–99. [Google Scholar] [CrossRef]
  16. Schemmer, P.; Zhong, Z.; Galli, U.; Wheeler, M.D.; Xiangli, L.; Bradford, B.U.; Conzelmann, L.O.; Forman, D.; Boyer, J.; Thurman, R.G. Glycine reduces platelet aggregation. Amino Acids 2012, 44, 925–931. [Google Scholar] [CrossRef] [Green Version]
  17. Zhong, Z.; Jones, S.; Thurman, R.G. Glycine minimizes reperfusion injury in a low-flow, reflow liver perfusion model in the rat. Am. J. Physiol. Liver Physiol. 1996, 270, G332–G338. [Google Scholar] [CrossRef]
  18. Ruiz-Ramirez, A.; Ortiz-Balderas, E.; Cardozo-Saldana, G.; Díaz-Díaz, E.; El-Hafidi, M. Glycine restores glutathione and protects against oxidative stress in vascular tissue from sucrose-fed rats. Clin. Sci. 2014, 126, 19–29. [Google Scholar] [CrossRef]
  19. Wang, W.; Wu, Z.; Lin, G.; Hu, S.; Wang, B.; Dai, Z.; Wu, G. Glycine stimulates protein synthesis and inhibits oxidative stress in pig small intestinal epithelial cells. J. Nutr. 2014, 144, 1540–1548. [Google Scholar] [CrossRef] [Green Version]
  20. Zhong, Z.; Wheeler, M.D.; Li, X.; Froh, M.; Schemmer, P.; Yin, M.; Bunzendaul, H.; Bradford, B.; Lemasters, J.J. L-glycine: A novel antiinflammatory, immunomodulatory, and cytoprotective agent. Curr. Opin. Clin. Nutr. Metab. Care 2003, 6, 229–240. [Google Scholar] [CrossRef]
  21. Maneikyte, J.; Bausys, A.; Leber, B.; Horvath, A.; Feldbacher, N.; Hoefler, G.; Strupas, K.; Stiegler, P.; Schemmer, P. Dietary glycine decreases both tumor volume and vascularization in a combined colorectal liver metastasis and chemotherapy model. Int. J. Boil. Sci. 2019, 15, 1582–1590. [Google Scholar] [CrossRef] [Green Version]
  22. Mikalauskas, S.; Mikalauskiene, L.; Bruns, H.; Nickkholgh, A.; Hoffmann, K.; Longerich, T.; Strupas, K.; Büchler, M.W.; Schemmer, P. Dietary glycine protects from chemotherapy-induced hepatotoxicity. Amino Acids 2011, 40, 1139–1150. [Google Scholar] [CrossRef] [PubMed]
  23. Říha, H.; Papoušek, F.; Neckář, J.; Pirk, J.; Ošťádal, B. Effects of isoflurane concentration on basic echocardiographic parameters of the left ventricle in rats. Physiol. Res. 2012, 61, 419–423. [Google Scholar] [CrossRef] [PubMed]
  24. Stiegler, P.; Sereinigg, M.; Puntschart, M.A.; Bradatsch, A.; Seifert-Held, T.; Wiederstein-Grasser, I.; Leber, B.; Stadelmeyer, E.; Dandachi, N.; Zelzer, S.; et al. Oxidative stress and apoptosis in a pig model of brain death (BD) and living donation (LD). J. Transl. Med. 2013, 11, 244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Dalzell, J.R.; Samuel, L. The spectrum of 5-fluorouracil cardiotoxicity. Anti-Cancer Drugs 2009, 20, 79–80. [Google Scholar] [CrossRef]
  26. Sara, J.D.; Kaur, J.; Khodadadi, R.; Rehman, M.; Lobo, R.; Chakrabarti, S.; Herrmann, J.; Lerman, A.; Grothey, A. 5-fluorouracil and cardiotoxicity: A review. Ther. Adv. Med. Oncol. 2018, 10, 1758835918780140. [Google Scholar] [CrossRef] [Green Version]
  27. Jansen, M.C.; Bueno-De-Mesquita, H.B.; Räsänen, L.; Fidanza, F.; Menotti, A.; Nissinen, A.; Feskens, E.J.; Kok, F.J.; Kromhout, D. Consumption of plant foods and stomach cancer mortality in the seven countries study. Is grain consumption a risk factor? Nutr. Cancer 1999, 34, 49–55. [Google Scholar] [CrossRef]
  28. Depetris, I.; Marino, D.; Bonzano, A.; Cagnazzo, C.; Filippi, R.; Aglietta, M.; Leone, F. Fluoropyrimidine-induced cardiotoxicity. Crit. Rev. Oncol. 2018, 124, 1–10. [Google Scholar] [CrossRef]
  29. Mosseri, M.; Fingert, H.J.; Varticovski, L.; Chokshi, S.; Isner, J.M. In vitro evidence that myocardial ischemia resulting from 5-fluorouracil chemotherapy is due to protein kinase C-mediated vasoconstriction of vascular smooth muscle. Cancer Res. 1993, 53, 3028–3033. [Google Scholar]
  30. Porta, C.; Moroni, M.; Ferrari, S.; Nastasi, G. Endothelin-1 and 5-fluorouracil-induced cardiotoxicity. Neoplasma 1998, 45, 81–82. [Google Scholar]
  31. Jensen, S.A.; Sørensen, J.B. 5-Fluorouracil-based therapy induces endovascular injury having potential significance to development of clinically overt cardiotoxicity. Cancer Chemother. Pharmacol. 2011, 69, 57–64. [Google Scholar] [CrossRef]
  32. Lamberti, M.; Porto, S.; Marra, M.; Zappavigna, S.; Grimaldi, A.; Feola, D.; Pesce, D.; Naviglio, S.; Spina, A.; Sannolo, N.; et al. 5-Fluorouracil induces apoptosis in rat cardiocytes through intracellular oxidative stress. J. Exp. Clin. Cancer Res. 2012, 31, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Lamberti, M.; Porto, S.; Zappavigna, S.; Addeo, E.; Marra, M.; Miraglia, N.; Sannolo, N.; Vanacore, D.; Stiuso, P.; Caraglia, M. A mechanistic study on the cardiotoxicity of 5-fluorouracil in vitro and clinical and occupational perspectives. Toxicol. Lett. 2014, 227, 151–156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Focaccetti, C.; Bruno, A.; Magnani, E.; Bartolini, D.; Principi, E.; Dallaglio, K.; Bucci, E.O.; Finzi, G.; Sessa, F.; Noonan, D.M.; et al. Effects of 5-fluorouracil on morphology, cell cycle, proliferation, apoptosis, autophagy and ros production in endothelial cells and cardiomyocytes. PLoS ONE 2015, 10, e0115686. [Google Scholar] [CrossRef] [PubMed]
  35. Salata, C.; Ferreira-Machado, S.C.; De Andrade, C.B.V.; Mencalha, A.; Mandarim-De-Lacerda, C.A.; De Almeida, C.E. Apoptosis induction of cardiomyocytes and subsequent fibrosis after irradiation and neoadjuvant chemotherapy. Int. J. Radiat. Biol. 2014, 90, 284–290. [Google Scholar] [CrossRef]
  36. Levick, S.P.; Soto-Pantoja, D.R.; Bi, J.; Hundley, W.G.; Widiapradja, A.; Manteufel, E.J.; Bradshaw, T.W.; Meléndez, G.C. Doxorubicin-induced myocardial fibrosis involves the neurokinin-1 receptor and direct effects on cardiac fibroblasts. Heart Lung Circ. 2018, 28, 1598–1605. [Google Scholar] [CrossRef]
  37. Sun, X.-P.; Wan, L.-L.; Yang, Q.; Huo, Y.; Han, Y.-L.; Guo, C. Scutellarin protects against doxorubicin-induced acute cardiotoxicity and regulates its accumulation in the heart. Arch. Pharmacal Res. 2017, 40, 875–883. [Google Scholar] [CrossRef] [Green Version]
  38. Razmaraii, N.; Babaei, H.; Nayebi, A.M.; Assadnassab, G.; Helan, J.A.; Azarmi, Y. Crocin treatment prevents doxorubicin-induced cardiotoxicity in rats. Life Sci. 2016, 157, 145–151. [Google Scholar] [CrossRef]
  39. Mishra, T.; Shokr, M.; Ahmed, A.; Afonso, L. Acute reversible left ventricular systolic dysfunction associated with 5-fluorouracil therapy: A rare and increasingly recognised cardiotoxicity of a commonly used drug. BMJ Case Rep. 2019, 12, e230499. [Google Scholar] [CrossRef]
  40. Fakhri, Y.; Dalsgaard, M.; Nielsen, D.; Madsen, P.L. 5-Fluorouracil-induced acute reversible heart failure not explained by coronary spasms, myocarditis or takotsubo: Lessons from MRI. BMJ Case Rep. 2016, 2016, bcr2015213783. [Google Scholar] [CrossRef]
  41. Y-Hassan, S.; Tornvall, P.; Törnerud, M.; Henareh, L. Capecitabine caused cardiogenic shock through induction of global takotsubo syndrome. Cardiovasc. Revascularization Med. 2013, 14, 57–61. [Google Scholar] [CrossRef]
  42. Sulpher, J.; Dattilo, F.; Dent, S.F.; Turek, M.; Reaume, M.N.; Johnson, C. Acute cardiogenic shock induced by infusional 5-fluorouracil. Case Rep. Oncol. Med. 2014, 2014, 819396. [Google Scholar] [CrossRef] [PubMed]
  43. Iskandar, M.; Quasem, W.; El-Omar, M. 5-Fluorouracil cardiotoxicity: Reversible left ventricular systolic dysfunction with early detection. BMJ Case Rep. 2015, 2015, bcr2015209347. [Google Scholar] [CrossRef] [Green Version]
  44. Elghandour, A.; El Sorady, M.; Azab, S.; Elrahman, M. Human heart-type fatty acid-binding protein as an early diagnostic marker of doxorubicin cardiac toxicity. Hematol. Rev. 2009, 1, 6. [Google Scholar] [CrossRef] [Green Version]
  45. Turan, T.; Çağrı, A.A.; Kul, S.; Cengiz, E.; Boyacı, F.; Erkan, H.; Akyüz, A.R.; Celik, S.; Ağaç, M.T.; Gokdeniz, T.; et al. Usefulness of heart-type fatty acid-binding protein and myocardial performance index for early detection of 5-fluorouracil cardiotoxicity. Angiology 2017, 68, 52–58. [Google Scholar] [CrossRef] [PubMed]
  46. Ye, X.-D.; He, Y.; Wang, S.; Wong, G.T.; Irwin, M.G.; Xia, Z. Heart-type fatty acid binding protein (H-FABP) as a biomarker for acute myocardial injury and long-term post-ischemic prognosis. Acta Pharmacol. Sin. 2018, 39, 1155–1163. [Google Scholar] [CrossRef] [PubMed]
  47. Haltern, G.; Peiniger, S.; Bufe, A.; Reiss, G.; Gülker, H.; Scheffold, T. Comparison of usefulness of heart-type fatty acid binding protein versus cardiac troponin T for diagnosis of acute myocardial infarction. Am. J. Cardiol. 2010, 105, 1–9. [Google Scholar] [CrossRef]
  48. Horacek, J.M.; Vašatová, M.; Pudil, R.; Tichy, M.; Zak, P.; Jakl, M.; Jebavy, L.; Malý, J. Biomarkers for the early detection of anthracycline-induced cardiotoxicity: Current status. Biomed. Pap. Med Fac. Palacky Univ. Olomouc 2014, 158, 511–517. [Google Scholar] [CrossRef] [Green Version]
  49. Arellano, M.; Malet-Martino, M.; Martino, R.; Gires, P. The anti-cancer drug 5-fluorouracil is metabolized by the isolated perfused rat liver and in rats into highly toxic fluoroacetate. Br. J. Cancer 1998, 77, 79–86. [Google Scholar] [CrossRef] [Green Version]
  50. Reis-Mendes, A.F.; Sousa, E.; Bastos, M.D.L.; Costa, V.M. The role of the metabolism of anticancer drugs in their induced-cardiotoxicity. Curr. Drug Metab. 2015, 17, 75–90. [Google Scholar] [CrossRef]
  51. Meldrum, G.K.; Bignell, J.T.; Rowley, I. The use of sodium fluoroacetate (compound 1080) for the control of the rabbit in Tasmania. Aust. Vet. J. 1957, 33, 186–196. [Google Scholar] [CrossRef]
  52. Zhang, R.W.; Soong, S.J.; Liu, T.P.; Barnes, S.; Diasio, S.B. Pharmacokinetics and tissue distribution of 2-fluoro-beta-alanine in rats. Potential relevance to toxicity pattern of 5-fluorouracil. Drug Metab. Dispos. 1992, 20, 113–119. [Google Scholar] [PubMed]
  53. Hahn, R.G. Glycine is toxic. Acta Anaesthesiol. Scand. 2006, 50, 261–262. [Google Scholar] [CrossRef] [PubMed]
  54. Zhang, W.; Andersson, B.S.; Hahn, R.G. Effect of irrigating fluids and prostate tissue extracts on isolated cardiomyocytes. Urology 1995, 46, 821–824. [Google Scholar] [CrossRef]
  55. Olsson, J.; Hahn, R.G. Glycine toxicity after high-dose i.v. infusion of 1.5% glycine in the mouse. Br. J. Anaesth. 1999, 82, 250–254. [Google Scholar] [CrossRef]
  56. Luntz, S.P.; Unnebrink, K.; Seibert-Grafe, M.; Bunzendahl, H.; Kraus, T.W.; Büchler, M.W.; Klar, E.; Schemmer, P. HEGPOL: Randomized, placebo controlled, multicenter, double-blind clinical trial to investigate hepatoprotective effects of glycine in the postoperative phase of liver transplantation [ISRCTN69350312]. BMC Surg. 2005, 5, 18. [Google Scholar] [CrossRef] [Green Version]
  57. Evins, A.E.; Fitzgerald, S.M.; Wine, L.; Rosselli, R.; Goff, D.C. Placebo-controlled trial of glycine added to clozapine in schizophrenia. Am. J. Psychiatry 2000, 157, 826–828. [Google Scholar] [CrossRef]
  58. Rivera, C.A.; Bradford, B.U.; Hunt, K.J.; Adachi, Y.; Schrum, L.W.; Koop, D.R.; Burchardt, E.-R.; Rippe, R.A.; Thurman, R.G. Attenuation of CCl4-induced hepatic fibrosis by GdCl3 treatment or dietary glycine. Am. J. Physiol. Gastrointest. Liver Physiol. 2001, 281, G200–G207. [Google Scholar] [CrossRef] [Green Version]
  59. Senthilkumar, R.; Nalini, N. Glycine prevents hepatic fibrosis by preventing the accumulation of collagen in rats with alcoholic liver injury. Pol. J. Pharmacol. 2004, 56, 121–128. [Google Scholar]
  60. Ham, D.J.; Gardner, A.; Kennedy, T.L.; Trieu, J.; Naim, T.; Chee, A.; Alves, F.M.; Caldow, M.K.; Lynch, G.S.; Koopman, R. Glycine administration attenuates progression of dystrophic pathology in prednisolone-treated dystrophin/utrophin null mice. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef] [Green Version]
  61. Hinderer, S.; Schenke-Layland, K. Cardiac fibrosis—A short review of causes and therapeutic strategies. Adv. Drug Deliv. Rev. 2019, 146, 77–82. [Google Scholar] [CrossRef]
  62. Rose, M.L.; Madren, J.; Bunzendahl, H.; Thurman, R.G. Dietary glycine inhibits the growth of B16 melanoma tumors in mice. Carcinogenesis 1999, 20, 793–798. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Bruns, H.; Kazanavicius, D.; Schultze, D.; Al Saeedi, M.; Yamanaka, K.; Strupas, K.; Schemmer, P. Glycine inhibits angiogenesis in colorectal cancer: Role of endothelial cells. Amino Acids 2016, 48, 2549–2558. [Google Scholar] [CrossRef] [PubMed]
Nutrients 12 02634 g001 550
Figure 1. Flowchart of the animal experiment. FOLFOX—chemotherapy regimen containing calcium folinate, oxaliplatin, and 5-fluorouracil; BW—body weight; CRLM—colorectal cancer liver metastasis; i.p. —intraperitoneally.
Figure 1. Flowchart of the animal experiment. FOLFOX—chemotherapy regimen containing calcium folinate, oxaliplatin, and 5-fluorouracil; BW—body weight; CRLM—colorectal cancer liver metastasis; i.p. —intraperitoneally.
Nutrients 12 02634 g001
Nutrients 12 02634 g002 550
Figure 2. Glycine effect on HCM cell growth and proliferation by MTT (3-(4,5-dimethylthiazol-2-yl)5-diphenyltetrazolium bromide) assay. HCM cells viability after incubation with various concentrations of glycine measured by MTT assay and presented as the percentage of the controls.
Figure 2. Glycine effect on HCM cell growth and proliferation by MTT (3-(4,5-dimethylthiazol-2-yl)5-diphenyltetrazolium bromide) assay. HCM cells viability after incubation with various concentrations of glycine measured by MTT assay and presented as the percentage of the controls.
Nutrients 12 02634 g002
Nutrients 12 02634 g003 550
Figure 3. Serum levels of heart fatty acid binding protein (h-FABP) on the last experimental day. h-FABP level measured on the last experimental day was different between the study groups. * p < 0.05. The Casein–FOLFOX group had a significantly higher h-FABP level compared to groups that had not received chemotherapy (Glycine–Control; Casein–Control; Glycine–Sham; Casein–Sham). Although, the difference between Casein–FOLFOX and Glycine–FOLFOX groups was not significant.
Figure 3. Serum levels of heart fatty acid binding protein (h-FABP) on the last experimental day. h-FABP level measured on the last experimental day was different between the study groups. * p < 0.05. The Casein–FOLFOX group had a significantly higher h-FABP level compared to groups that had not received chemotherapy (Glycine–Control; Casein–Control; Glycine–Sham; Casein–Sham). Although, the difference between Casein–FOLFOX and Glycine–FOLFOX groups was not significant.
Nutrients 12 02634 g003
Nutrients 12 02634 g004 550
Figure 4. Left ventricle ejection fraction (LVEF) before and after chemotherapy in different diet groups. (A) Left ventricle ejection fraction (LVEF) before and after chemotherapy in the study groups; * p < 0.05. (B) Representative view from heart ultrasound. Left: Heart in parasternal short-axis view; Right: M-mode, left ventricular internal diameters.
Figure 4. Left ventricle ejection fraction (LVEF) before and after chemotherapy in different diet groups. (A) Left ventricle ejection fraction (LVEF) before and after chemotherapy in the study groups; * p < 0.05. (B) Representative view from heart ultrasound. Left: Heart in parasternal short-axis view; Right: M-mode, left ventricular internal diameters.
Nutrients 12 02634 g004
Nutrients 12 02634 g005 550
Figure 5. Fibrosis index measured by chromotrope aniline blue staining. Representative pictures at 100× magnification of chromotrope aniline blue stain for fibrous tissue in the myocardium of animals treated with FOLFOX and glycine (A) and FOLFOX alone (B). The amount of fibrosis between the study groups was different (C). * The fibrosis index in the group treated with FOLFOX alone was significantly higher compared to that of all other study groups, p < 0.05.
Figure 5. Fibrosis index measured by chromotrope aniline blue staining. Representative pictures at 100× magnification of chromotrope aniline blue stain for fibrous tissue in the myocardium of animals treated with FOLFOX and glycine (A) and FOLFOX alone (B). The amount of fibrosis between the study groups was different (C). * The fibrosis index in the group treated with FOLFOX alone was significantly higher compared to that of all other study groups, p < 0.05.
Nutrients 12 02634 g005
Nutrients 12 02634 g006 550
Figure 6. The apoptotic index measured by immunohistochemistry with anti-Caspase 3 antibody. Representative pictures at 100× magnification of anti-Caspase 3 staining for fibrous tissue in the myocardium of animals treated with FOLFOX and glycine (A) and FOLFOX alone (B). The apoptotic cell rate was significantly higher in the FOLFOX-alone group compared to that in the group treated with FOLFOX with glycine, * p < 0.05 (C).
Figure 6. The apoptotic index measured by immunohistochemistry with anti-Caspase 3 antibody. Representative pictures at 100× magnification of anti-Caspase 3 staining for fibrous tissue in the myocardium of animals treated with FOLFOX and glycine (A) and FOLFOX alone (B). The apoptotic cell rate was significantly higher in the FOLFOX-alone group compared to that in the group treated with FOLFOX with glycine, * p < 0.05 (C).
Nutrients 12 02634 g006
Nutrients 12 02634 g007 550
Figure 7. Transmission electron microscopy scans of heart samples. Representative pictures of hearts scanned by electron microscopy in (A) groups without FOLFOX (Casein–Sham, Glycine–Sham, Casein–Control, Glycine–Control) at magnification 7000×; (B) Casein–FOLFOX; and (C) Glycine–FOLFOX groups at magnification 12,000×. FOLFOX induced a significant increase of the collagen fibers in the heart muscle, and lysosomes within the endothelial cells were observed in the Casein–FOLFOX group. Glycine prevented FOLFOX-induced ultrastructural changes. MF—myofibrils; M—mitochondria; N—nucleus, L—lysosomes; Lec—lysosomes within endothelial cells; asterisk—lysosomes containing dark granules and other lipids; v—vessels; CF—collagen fibers.
Figure 7. Transmission electron microscopy scans of heart samples. Representative pictures of hearts scanned by electron microscopy in (A) groups without FOLFOX (Casein–Sham, Glycine–Sham, Casein–Control, Glycine–Control) at magnification 7000×; (B) Casein–FOLFOX; and (C) Glycine–FOLFOX groups at magnification 12,000×. FOLFOX induced a significant increase of the collagen fibers in the heart muscle, and lysosomes within the endothelial cells were observed in the Casein–FOLFOX group. Glycine prevented FOLFOX-induced ultrastructural changes. MF—myofibrils; M—mitochondria; N—nucleus, L—lysosomes; Lec—lysosomes within endothelial cells; asterisk—lysosomes containing dark granules and other lipids; v—vessels; CF—collagen fibers.
Nutrients 12 02634 g007
Nutrients 12 02634 g008 550
Figure 8. Type I and II collagen and brain natriuretic peptide (BNP) gene expression in the heart muscle by qPCR. Type I collagen gene expression was significantly increased in FOLFOX groups (Casein–FOLFOX; Glycine–FOLFOX) compared to that in corresponding controls (Casein–Control; Glycine–Control), * p < 0.05. Although, there was no difference between Casein–FOLFOX and Glycine–FOLFOX groups (A). Type II collagen (B) and BNP (C) expression was not different between the study groups.
Figure 8. Type I and II collagen and brain natriuretic peptide (BNP) gene expression in the heart muscle by qPCR. Type I collagen gene expression was significantly increased in FOLFOX groups (Casein–FOLFOX; Glycine–FOLFOX) compared to that in corresponding controls (Casein–Control; Glycine–Control), * p < 0.05. Although, there was no difference between Casein–FOLFOX and Glycine–FOLFOX groups (A). Type II collagen (B) and BNP (C) expression was not different between the study groups.
Nutrients 12 02634 g008
Table
Table 1. Genes used for quantification and primer information.
Table 1. Genes used for quantification and primer information.
Account NumberForward (5′->3′)Reverse (5′->3′)Product Length
COL1A1 (Collagen1)
NM_053304.1CAACCTCAAGAAGTCCCTGCAGGTGAATCGACTGTTGCCT77 bp
COL2A1 (Collagen 2)
NM_012929.1CAGTCGCTGGTGCTGCTGCCCTAATTTTCGGGCATCC76 bp
BNP (Brain natriuretic peptide)
NM_031545.1TTTCCTTAATCTGTCGCCGCTGGATTGTTCTGGAGACTGGCT73 bp
ACTB (beta-Actin)
NM_031144.3GCAGGAGTACGATGAGTCCGACGCAGCTCAGTAACAGTCC74 bp
Table
Table 2. Median white blood cell count at different time points of the study.
Table 2. Median white blood cell count at different time points of the study.
GroupDay 6
(×109/L)		Day 14
(×109/L)		Day 17
(×109/L)		Day 21
(×109/L)
Glycine–FOLFOX11.1 (9.0; 12.4)11.5 (9.5; 13.0)4.6 (4.1; 5.2)0.5 (0.3; 0.9)
Casein–FOLFOX10.4 (9.6; 11.6)11.6 (4.8; 12.7)4.5 (3.5; 5.0)0.4 (0.2; 0.6)
Glycine–Control11.7 (10.6; 12.2)11.6 (10.4; 15.8)14.4 (12.4; 16.7)8.4 (7.3; 9.3)
Casein–Control11.0 (10.7; 11.9)14.8 (10.5; 17.1)14.9 (10.6; 17.4)8.9 (7.3; 9.6)
Glycine–Sham10.1 (9.7; 12.3)9.6 (8.7; 11.2)13.1 (12.8; 14.1)6.8 (6.1; 7.7)
Casein–Sham10.7 (8.0; 10.7)10.2 (9.7; 10.4)16.6 (13.7; 23.3)7.0 (3.3; 8.4)

Share and Cite

MDPI and ACS Style

Maneikyte, J.; Bausys, A.; Leber, B.; Feldbacher, N.; Hoefler, G.; Kolb-Lenz, D.; Strupas, K.; Stiegler, P.; Schemmer, P. Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats. Nutrients 2020, 12, 2634. https://doi.org/10.3390/nu12092634

AMA Style

Maneikyte J, Bausys A, Leber B, Feldbacher N, Hoefler G, Kolb-Lenz D, Strupas K, Stiegler P, Schemmer P. Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats. Nutrients. 2020; 12(9):2634. https://doi.org/10.3390/nu12092634

Chicago/Turabian Style

Maneikyte, Juste, Augustinas Bausys, Bettina Leber, Nicole Feldbacher, Gerald Hoefler, Dagmar Kolb-Lenz, Kestutis Strupas, Philipp Stiegler, and Peter Schemmer. 2020. "Dietary Glycine Prevents FOLFOX Chemotherapy-Induced Heart Injury: A Colorectal Cancer Liver Metastasis Treatment Model in Rats" Nutrients 12, no. 9: 2634. https://doi.org/10.3390/nu12092634

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop