Astragaloside IV Regulates cGAS-STING Signaling Pathway to Alleviate Immunosuppression Caused by PRRSV Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Cell Culture and Treatment
2.2.1. In Vitro Cytotoxicity Assay
2.2.2. In Vitro Infection Inhibition Assay
2.2.3. Preparation of Positive Standard
2.3. ELISA
2.4. qRT-PCR
2.5. Western Blot
2.6. Statistical Analysis
3. Results
3.1. Maximum Nontoxic Concentration Determination
3.2. Virus Inhibition Assay
3.3. Effect of AS-IV on Innate Immune Function after PRRSV Infection
3.4. AS-IV Regulates the cGAS-STING Signaling Pathway after PRRSV Infection
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shi, C.; Liu, Y.; Ding, Y.; Zhang, Y.; Zhang, J. PRRSV receptors and their roles in virus infection. Arch. Microbiol. 2015, 197, 503–512. [Google Scholar] [CrossRef] [PubMed]
- Brinton, M.A.; Gulyaeva, A.A.; Balasuriya, U.B.R.; Dunowska, M.; Faaberg, K.S.; Goldberg, T.; Leung, F.C.C.; Nauwynck, H.J.; Snijder, E.J.; Stadejek, T.; et al. ICTV Virus Taxonomy Profile: Arteriviridae 2021. J. Gen. Virol. 2021, 102, 001632. [Google Scholar] [CrossRef]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Yu, Y.; Cai, X.; Zhou, E.M.; Zimmerman, J.J. Effects of PRRSV Infection on the Porcine Thymus. Trends Microbiol. 2020, 28, 212–223. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Wang, G.; Liu, Y.; Shi, W.; Han, Z.; Wu, J.; Jiang, C.; Wang, S.; Hu, S.; Wen, H.; et al. Characterization of thymus atrophy in piglets infected with highly pathogenic porcine reproductive and respiratory syndrome virus. Vet. Microbiol. 2012, 160, 455–462. [Google Scholar] [CrossRef] [PubMed]
- An, T.Q.; Li, J.N.; Su, C.M.; Yoo, D. Molecular and Cellular Mechanisms for PRRSV Pathogenesis and Host Response to Infection. Virus. Res. 2020, 286, 197980. [Google Scholar] [CrossRef] [PubMed]
- Amadori, M.; Listorti, V.; Razzuoli, E. Reappraisal of PRRS Immune Control Strategies: The Way Forward. Pathogens 2021, 10, 1073. [Google Scholar] [CrossRef]
- Cui, W.; Wang, C.; Luo, Q.; Xing, T.; Shen, J.; Wang, W. Toxoplasma gondii ROP16I Deletion: The Exacerbated Impact on Adverse Pregnant Outcomes in Mice. Front. Microbiol. 2020, 10, 3151. [Google Scholar] [CrossRef]
- Osna, N.A. Hepatitis C virus and ethanol alter antigen presentation in liver cells. World J. Gastroenterol. 2009, 15, 1201–1208. [Google Scholar] [CrossRef] [Green Version]
- Rees, J.S.; Cheung, L.C.C.; Hamaia, S.W.; Davies, G.; Sandercock, A.; Lilley, K.S.; Tigue, N.; Jackson, A.P. Identification of the cis molecular neighbours of the immune checkpoint protein B7 H4 in the breast cancer cell line SK BR 3 by proteomic proximity labelling. Int. J. Oncol. 2020, 57, 87–99. [Google Scholar] [CrossRef]
- Blackwell, J.M.; Searle, S. Genetic regulation of macrophage activation: Understanding the function of Nramp1 (=Ity/Lsh/Bcg). Immunol. Lett. 1999, 65, 73–80. [Google Scholar] [CrossRef] [PubMed]
- Lawson, P.R.; Reid, K.B. The roles of surfactant proteins A and D in innate immunity. Immunol. Rev. 2000, 173, 66–78. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wu, C.; Gao, L.; Du, G.; Qin, X. Astragaloside IV derived from Astragalus membranaceus: A research review on the pharmacological effects. Adv. Pharmacol. 2020, 87, 89–112. [Google Scholar] [PubMed]
- Xu, F.; Cui, W.Q.; Wei, Y.; Cui, J.; Qiu, J.; Hu, L.L.; Gong, W.Y.; Dong, J.C.; Liu, B.J. Astragaloside IV inhibits lung cancer progression and metastasis by modulating macrophage polarization through AMPK signaling. J. Exp. Clin. Cancer Res. 2018, 37, 207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zang, Y.; Wan, J.; Zhang, Z.; Huang, S.; Liu, X.; Zhang, W. An updated role of astragaloside IV in heart failure. Biomed. Pharmacother. 2020, 126, 110012. [Google Scholar] [CrossRef]
- Xia, M.L.; Xie, X.H.; Ding, J.H.; Du, R.H.; Hu, G. Astragaloside IV inhibits astrocyte senescence: Implication in Parkinson’s disease. J. Neuroinflamm. 2020, 17, 105. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.; Dai, Z.; Tang, W.; Liu, C.; Tang, B. Astragaloside IV Alleviates Cerebral Ischemia-Reperfusion Injury through NLRP3 Inflammasome-Mediated Pyroptosis Inhibition via Activating Nrf2. Oxid. Med. Cell Longev. 2021, 2021, 9925561. [Google Scholar] [CrossRef]
- Shi, H.; Zhou, P.; Gao, G.; Liu, P.P.; Wang, S.S.; Song, R.; Zou, Y.Y.; Yin, G.; Wang, L. Astragaloside IV prevents acute myocardial infarction by inhibiting the TLR4/MyD88/NF-κB signaling pathway. J. Food Biochem. 2021, 45, e13757. [Google Scholar] [CrossRef]
- Chen, N.; Xia, P.; Li, S.; Zhang, T.; Wang, T.T.; Zhu, J. RNA sensors of the innate immune system and their detection of pathogens. IUBMB Life 2017, 69, 297–304. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.; Zhang, Y.; Sun, S.; Luo, J.; Jiang, S.; Zhang, J.; Liu, X.; Shao, Q.; Cao, Q.; Zheng, W.; et al. The Innate Immune DNA Sensing cGAS-STING Signaling Pathway Mediates Anti-PRRSV Function. Viruses 2021, 13, 1829. [Google Scholar] [CrossRef]
- Decout, A.; Katz, J.D.; Venkatraman, S.; Ablasser, A. The cGAS-STING pathway as a therapeutic target in inflammatory diseases. Nat. Rev. Immunol. 2021, 21, 548–569. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.N.; Li, L.W.; Gao, F.; Jiang, Y.F.; Yuan, W.Z.; Li, G.X.; Yu, L.X.; Zhou, Y.J.; Tong, G.Z.; Zhao, K. cGAS Restricts PRRSV Replication by Sensing the mtDNA to Increase the cGAMP Activity. Front. Immunol. 2022, 13, 887054. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Xue, B.; Li, Y.; Wang, X.; Li, R.; Zeng, X.; Yang, M.; Xu, X.; Ye, T.; Bao, L.; Huang, Y. TaqMan-MGB probe quantitative PCR assays to genotype and quantify three mtDNA mutations of Leber hereditary optic neuropathy. Sci. Rep. 2020, 10, 12264. [Google Scholar] [CrossRef]
- Cao, Z.X.; Zhao, F.R.; Jia, K.; Sun, W.W.; Yan, M.F.; Guo, S.H.; Jiao, P.R.; Qi, W.B.; Zhang, G.H. Effect of compounds on the purification and antibody preparation of the extracellular domain fragment of the receptor CD163. Virol. J. 2011, 8, 144. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Wang, X.; Mu, L.; Ding, Z. Immune responses in pigs induced by recombinant DNA vaccine co-expressing swine IL-18 and membrane protein of porcine reproductive and respiratory syndrome virus. Int. J. Mol. Sci. 2012, 13, 5715–5728. [Google Scholar] [CrossRef] [Green Version]
- Erttmann, S.F.; Swacha, P.; Aung, K.M.; Brindefalk, B.; Jiang, H.; Härtlova, A.; Uhlin, B.E.; Wai, S.N.; Gekara, N.O. The gut microbiota prime systemic antiviral immunity via the cGAS-STING-IFN-I axis. Immunity 2022, 55, 847–861.e10. [Google Scholar] [CrossRef]
- Feng, Y.; Guo, X.; Tian, H.; He, Y.; Li, Y.; Jiang, X.; Zheng, H.; Xiao, S. Induction of HOXA3 by Porcine Reproductive and Respiratory Syndrome Virus Inhibits Type I Interferon Response through Negative Regulation of HO-1 Transcription. J. Virol. 2022, 96, e0186321. [Google Scholar] [CrossRef]
- Fleming, D.S.; Miller, L.C.; Tian, Y.; Li, Y.; Ma, W.; Sang, Y. Impact of Porcine Arterivirus, Influenza B, and Their Coinfection on Antiviral Response in the Porcine Lung. Pathogens 2020, 9, 934. [Google Scholar] [CrossRef]
- Xia, H.; Cao, Z.; Xie, X.; Zhang, X.; Chen, J.Y.-C.; Wang, H.; Menachery, V.D.; Rajsbaum, R.; Shi, P.-Y. Evasion of Type I Interferon by SARS-CoV-2. Cell Rep. 2020, 33, 108234. [Google Scholar] [CrossRef]
- Ge, Z.; Ding, S. Regulation of cGAS/STING signaling and corresponding immune escape strategies of viruses. Front. Cell Infect. Microbiol. 2022, 12, 954581. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, Y.; Jin, X.F.; Zhou, X.H.; Dong, X.H.; Yu, W.T.; Gao, W.J. The Role of Astragaloside IV against Cerebral Ischemia/Reperfusion Injury: Suppression of Apoptosis via Promotion of P62-LC3-Autophagy. Molecules 2019, 24, 1838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darwich, L.; Díaz, I.; Mateu, E. Certainties, doubts and hypotheses in porcine reproductive and respiratory syndrome virus immunobiology. Virus. Res. 2010, 154, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Murtaugh, M.P.; Xiao, Z.; Zuckermann, F. Immunological responses of swine to porcine reproductive and respiratory syndrome virus infection. Viral. Immunol. 2002, 15, 533–547. [Google Scholar] [CrossRef]
- Zeng, N.; Wang, C.; Liu, S.; Miao, Q.; Zhou, L.; Ge, X.; Han, J.; Guo, X.; Yang, H. Transcriptome Analysis Reveals Dynamic Gene Expression Profiles in Porcine Alveolar Macrophages in Response to the Chinese Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus. Biomed. Res. Int. 2018, 2018, 1538127. [Google Scholar] [CrossRef]
- Jenkins, M.K. The ups and downs of T cell costimulation. Immunity 1994, 1, 443–446. [Google Scholar] [CrossRef]
- Liu, G.; Yang, H. Modulation of macrophage activation and programming in immunity. J. Cell Physiol. 2013, 228, 502–512. [Google Scholar] [CrossRef]
- Lunney, J.K.; Ho, C.S.; Wysocki, M.; Smith, D.M. Molecular genetics of the swine major histocompatibility complex, the SLA complex. Dev. Comp. Immunol. 2009, 33, 362–374. [Google Scholar] [CrossRef]
- Smith, T.P.; Rohrer, G.A.; Alexander, L.J.; Troyer, D.L.; Kirby-Dobbels, K.R.; Janzen, M.A.; Cornwell, D.L.; Louis, C.F.; Schook, L.B.; Beattie, C.W. Directed integration of the physical and genetic linkage maps of the swine chromosome 7 reveals that SLA spans the centromere. Genom. Res. 1995, 5, 259–271. [Google Scholar] [CrossRef] [Green Version]
- Ceeraz, S.; Nowak, E.C.; Noelle, R.J. B7 family checkpoint regulators in immune regulation and disease. Trends. Immunol. 2013, 34, 556–563. [Google Scholar] [CrossRef] [Green Version]
- Schildberg, F.A.; Klein, S.R.; Freeman, G.J.; Sharpe, A.H. Coinhibitory Pathways in the B7-CD28 Ligand-Receptor Family. Immunity 2016, 44, 955–972. [Google Scholar] [CrossRef] [Green Version]
- Bour-Jordan, H.; Blueston, J.A. CD28 function: A balance of costimulatory and regulatory signals. J. Clin. Immunol. 2002, 22, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Lenschow, D.J.; Walunas, T.L.; Bluestone, J.A. CD28/B7 system of T cell costimulation. Annu. Rev. Immunol. 1996, 14, 233–258. [Google Scholar] [CrossRef]
- Suvas, S.; Singh, V.; Sahdev, S.; Vohra, H.; Agrewala, J.N. Distinct role of CD80 and CD86 in the regulation of the activa-tion of B cell and B cell lymphoma. J. Biol. Chem. 2002, 277, 7766–7775. [Google Scholar] [CrossRef] [Green Version]
- Ding, X.; Zhang, X.; Yang, Y.; Ding, Y.; Xue, W.; Meng, Y.; Zhu, W.; Yin, Z. Polymorphism, Expression of Natural Resistance-associated Macrophage Protein 1 Encoding Gene (NRAMP1) and Its Association with Immune Traits in Pigs. Asian-Australas J. Anim. Sci. 2014, 27, 1189–1195. [Google Scholar] [CrossRef]
- Canonne-Hergaux, F.; Gruenheid, S.; Ponka, P.; Gros, P. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 1999, 93, 4406–4417. [Google Scholar] [CrossRef] [PubMed]
- Thorenoor, N.; Umstead, T.M.; Zhang, X.; Phelps, D.S.; Floros, J. Survival of Surfactant Protein-A1 and SP-A2 Transgenic Mice after Klebsiella pneumoniae Infection, Exhibits Sex-, Gene-, and Variant Specific Differences; Treatment with Surfactant Protein Improves Survival. Front. Immunol. 2018, 9, 2404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Sequence (5′—3′) |
---|---|
GAPDH-F | TGACATCAAGAAGGTGGTGAAGCAG |
GAPDH-R | GTGTCGCTGTTGAAGTCAGAGGAG |
cGAS-F | CTTTCACCTATGTGCCGACAACCC |
cGAS-R | TGTCACGCAGTTATCAAAGCAGAGG |
TBK1-F | AAGCCTTCTGGTGCAATATCTGGAG |
TBK1-R | ACCTGAAGACCCCGAGAAAGACTG |
IRF-3-F | GAGGCTCGTGATGGTCAAGGTTG |
IRF-3-R | AGTGGGTGGCTGTTGGAAATGTG |
IFN-F | GAGTGTGGAGACCATCAAGGAAGAC |
IFN-R | GTTCATGTACTGCTTTGCGTTGGAC |
OAS1-F | GCGAGTTCTCCACCTGCTTCAC |
OAS1-R | ACTAGGCGGATGAGGCTCTTGAG |
ISG15-F | GGTGGTGGACAGATGCGATGAAC |
ISG15-R | GGCTCACTTGCTGCTTCAGGTG |
SLA-1-F | GGATGAGGAGACGCGGAAAGTCA |
SLA-1-R | TGGTCCCAAGTAGCAGCCAAACA |
SLA-DRB1-F | CGACTTTGACCCGCAGAATGG |
SLA-DRB1-R | TGGTGGCTCTGGTATGGTTGGA |
CD86-F | CTCTTTGTGATGGTCCTCCTG |
CD86-R | AGGCTTAGGTTCTGCGAGTT |
CD80-F | GGGAACACCATTACCCAAGC |
CD80-R | GTCACCTGAACGATGCCTGA |
Nramp1-F | GTCTCCTTCTTCATCAACCTCTT |
Nramp1-R | ATCACGCCGCCTTGGTAA |
SP-A-F | GGAGACTTCTTCTACTTGGATGG |
SP-A-R | GCTGGCAGTTCCTGTCATTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, K.; Yu, J.-Y.; Li, J.; Li, M.; Peng, L.-Y.; Yi, P.-F. Astragaloside IV Regulates cGAS-STING Signaling Pathway to Alleviate Immunosuppression Caused by PRRSV Infection. Viruses 2023, 15, 1586. https://doi.org/10.3390/v15071586
Song K, Yu J-Y, Li J, Li M, Peng L-Y, Yi P-F. Astragaloside IV Regulates cGAS-STING Signaling Pathway to Alleviate Immunosuppression Caused by PRRSV Infection. Viruses. 2023; 15(7):1586. https://doi.org/10.3390/v15071586
Chicago/Turabian StyleSong, Ke, Jia-Ying Yu, Jiang Li, Miao Li, Lu-Yuan Peng, and Peng-Fei Yi. 2023. "Astragaloside IV Regulates cGAS-STING Signaling Pathway to Alleviate Immunosuppression Caused by PRRSV Infection" Viruses 15, no. 7: 1586. https://doi.org/10.3390/v15071586