Next Article in Journal
The Antiviral Effect of Nirmatrelvir/Ritonavir during COVID-19 Pandemic Real-World Data
Next Article in Special Issue
Metaviromic Characterization of Betaflexivirus Populations Associated with a Vitis cultivar Collection in South Africa
Previous Article in Journal
BAK-Mediated Pyroptosis Promotes Japanese Encephalitis Virus Proliferation in Porcine Kidney 15 Cells
Previous Article in Special Issue
The Three-Cornered Alfalfa Hopper, Spissistilus festinus, Is a Vector of Grapevine Red Blotch Virus in Vineyards
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 15
Issue 4
10.3390/v15040975
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan

by
Mariya Kolchenko
1,
Anastasiya Kapytina
1,
Nazym Kerimbek
1,
Alexandr Pozharskiy
1,2,
Gulnaz Nizamdinova
1,
Marina Khusnitdinova
1,
Aisha Taskuzhina
1 and
Dilyara Gritsenko
1,*
1
Laboratory of Molecular Biology, Institute of Plant Biology and Biotechnology, Almaty 050040, Kazakhstan
2
Department of Molecular Biology and Genetics, Al-Farabi Kazakh National University, Almaty 050040, Kazakhstan
*
Author to whom correspondence should be addressed.
Viruses 2023, 15(4), 975; https://doi.org/10.3390/v15040975
Submission received: 13 March 2023 / Revised: 13 April 2023 / Accepted: 14 April 2023 / Published: 16 April 2023
(This article belongs to the Special Issue A Tribute to Giovanni P. Martelli)
Browse Figures
Review Reports Versions Notes

Abstract

:
Raspberry bushy dwarf virus (RBDV) is an economically significant pathogen of raspberry and grapevine, and it has also been found in cherry. Most of the currently available RBDV sequences are from European raspberry isolates. This study aimed to sequence genomic RNA2 of both cultivated and wild raspberry in Kazakhstan and compare them to investigate their genetic diversity and phylogenetic relationships, as well as to predict their protein structure. Phylogenetic and population diversity analyses were performed on all available RBDV RNA2, MP and CP sequences. Nine of the isolates investigated in this study formed a new, well-supported clade, while the wild isolates clustered with the European isolates. Predicted protein structure analysis revealed two regions that differed between α- and β-structures among the isolates. For the first time, the genetic composition of Kazakhstani raspberry viruses has been characterized.

1. Introduction

Raspberry bushy dwarf virus (RBDV) is a representative member of the species Idaeovirus rubi of the genus Idaeovirus in the family Mayoviridae. Idaeovirus rubi is one of two species in the genus Idaeovirus [1]. RBDV naturally infects members of the Rubus species, including black raspberry (R. occidentalis), blackberry (R. fruticosus), loganberry (R. loganobaccus), boysenberry (R. ursinus × idaeus), and arctic bramble (R. arcticus) [2,3,4,5], as well as grapevine [6] and cherry [7]. It is transmitted both horizontally and vertically through pollen [8,9].
The RBDV genome is composed of two single-strand RNA molecules with sizes of 5.5 kb (RNA1) and 2.2 kb (RNA2), as well as a subgenomic 946 nt RNA molecule (RNA3) [10,11,12]. The bipartite RNA genome includes a bicistronic RNA2, while RNA3 is monocistronic [13]. RNA1 encodes a putative polymerase protein, while RNA2 encodes two genes, a 39 kDa putative movement protein (MP), whose nucleotide sequence is similar to movement proteins of other RNA viruses, and a 30 kDa coat protein (CP) [11]. The CP is expressed by RNA3, and it has been reported to play an important role in the infection process [14].
Several RBDV isolates have been distinguished based on the molecular and serological characteristics similar to Scottish-type D200 (S), resistance-breaking isolates (RB), and serological variant isolates from black raspberry (B) [15,16]. RBDV has been found to form virus complexes with raspberry leaf mottle virus (RLMV), increasing their infection synergy [17,18].
The genes located on the RNA2 segment are critical for transmission. The CP determines virion formation and its structure [19], provides assistance in replication via genome activation [14,20], and interacts with the plant immune system in tandem with the MP [21,22]. Despite significant genetic variability associated with CP and MP sequences, secondary and tertiary structures remain relatively conserved [23], indicating a morphological separation into a number of individual architectural classes [19].
This work aimed to identify and compare complete RNA2 sequences of RBDVs infecting both cultivated and wild subspecies of red raspberry from Kazakhstan and other countries around the world to gain insight into its evolution and epidemiology.

2. Materials and Methods

2.1. Sample Collection and Detection by RT-PCR

A total of 187 samples exhibiting leaf chlorosis (Figure 1) from a cultivated environment (Almaty Pomological Garden) and 35 samples from natural environments (Trans-Ile Alatau mountain range) were collected and analysed for RBDV infection. RNA was isolated from leaf tissue using the cetriltrimethylammonium bromide (CTAB) protocol [24]. The quality of the isolated RNA was confirmed by agarose gel electrophoresis (2% w/v). Reverse transcription was conducted using RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA, USA). The mix of 200 ng RNA, 0.5 μM Oligo-dT, and 0.5 μM random hexamer primers in a final volume of 15 μL was incubated for 10 min at 72 °C and then cooled on ice. Then, 5× RT reaction buffer, 0.5 mM dNTPs, and 200 U reverse transcriptase were added, followed by incubation for 1 h at 45 °C [25].
The raspberry samples were tested for the presence of RBDV, as well as raspberry ringspot virus (RpRSV), raspberry leaf mottle virus (RLMV), and raspberry leaf blotch virus (RLBV) via PCR assays with specific primers targeting the conserved regions inside different protein genes (Table 1).
The primer design process occurred as follows. The known nucleotide sequences of viral isolates were retrieved from GenBank, then aligned by Muscle [26], ClustalW [27]. The specificity of the primers was tested via sequencing of the PCR product and subsequent NCBI-Blast and Primer-BLAST searches. The most suitable primer pairs were selected for detection. Two microlitres of cDNA were used in the PCR reaction mix, along with 5 U Taq DNA Polymerase (New England Biolabs), 0.5 μM of forward and reverse primers, and 0.5 mM dNTPs. The amplification programme consisted of 95 °C for 3 min, 30 cycles of 95 °C for 30 s, 52 °C for 20 s, and 72 °C for 40 s, followed by a final extension at 72 °C for 5 min [25].

2.2. Amplification of Genomic RNA2 by RT-PCR

The primer pair for amplification of RNA2 was designed to correspond to the 5′ and 3′ ends of RBDV RNA2 (Table 1), and was synthesised by Macrogen Inc. (Seoul, Republic of Korea).
The cDNA was synthesised using 250 ng of RNA template, 1.0 μM reverse primer, and 200 U SuperScript IV Reverse Transcriptase (Invitrogen). The amplification utilised Q5 High-Fidelity DNA polymerase (New England Biotechnology), Q5 Buffer, and Q5 Enhancer for high fidelity and was performed on the platform C1000 TouchTM Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) under the following conditions: 96 °C for 3 min, 30 cycles of 96 °C for 30 s, 52 °C for 20 s, and 72 °C for 3 min, followed by a final extension at 72 °C for 10 min.
The yield was confirmed using gel electrophoresis, and the PCR product was subsequently purified using the GeneJet PCR Purification Kit (Thermo Scientific).

2.3. Nanopore Sequencing and Assembly

Library preparation was performed according to the “Ligation sequencing influenza whole genome (SQK-LSK109 with EXP-NBD196)” protocol from the Nanopore Community tab, with the substitution of the EXP-NBD196 kit for EXP-NBD104 for 12 samples. Barcode-labelled cDNA libraries were sequenced on a FLO-MIN106D flow cell using MinION (Oxford Nanopore Technologies, Oxford, UK). All sequences generated in this study were deposited into the NCBI GenBank database. Raw sequence reads were filtered based on quality score and read length using FastQC [28] and the MultiQC tool [29]. Epi2Me Labs (ONT) analysis confirmed the presence of RBDV.
Assembly was performed following the bioinformatics pipeline introduced by Brancaccio et al. for human papillomavirus [30]. After base calling the raw data on a “high” setting with Guppy [31], the results were filtered for reads between 500 and 2300 nucleotides long using Filtlong v.0.2.1 [32]. The worst 10% of the reads were discarded. The genome was assembled using Canu 2.2 [33] and polished with Medaka v1.7.2 [34] against filtered reads. To assess the effectiveness of the pipeline, contigs offered by Canu were analysed for open reading frames (ORFs) of 1077 and 825 nucleotides corresponding to sequences coding for MPs and CPs using UGENE v45.1 software [35] and translated and matched to the NCBI protein database using the BLASTp program (URL: http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 12 January 2023)). Positive matches were selected and trimmed down to the size of the reference sequence (NC_003740).
Whole genome sequences of the 18 RBDV isolates were submitted to GenBank (OQ336272–OQ336289). These sequences were analysed alongside publicly available sequences.

2.4. Molecular Characterisation and Phylogeny

The viral sequences were subsequently aligned with RNA2 sequences from the NCBI database using the MAFFT algorithm [36] implemented using UGENE v45.1 software [35]. The most genetically variable regions (deletions, insertions, or more than 2 substitutions across all samples) were plotted separately. A sequence logo for visualisation was generated in WebLogo [37].
Single nucleotide polymorphisms (SNPs) and insertion-deletion mutations (indels) called in BCFtools [38,39] were filtered by frequency, and only instances appearing in more than 30 reads were counted.
For each sample, mutations were defined as mismatches against the consensus sequence. Mutational frequency was calculated as the total number of unique mutations divided by the total number of nucleotides within the sequenced genomes [40,41], while mutational frequency per codon was estimated by summing the mutation frequencies of each codon within each gene, divided by the total number of codons within the sequenced genomes [42]. To arrive at mutant spectra heterogeneity, the normalised Shannon entropy was calculated according to the formula { Σ i   p i × l n p i / l n N } , where pi is the frequency of each sequence in the mutant spectrum and N is the total number of sequences compared [40,41].
Phylogenetic trees were constructed using the maximum likelihood method in MEGA11 (Kimura-2 parameter model, bootstrap 100), RAxML (bootstrap 1000), and MrBayes (1 million iterations) and investigated for conserved clades [43,44,45,46,47,48].

3. Results and Discussion

3.1. Occurrence of RBDV in Kazakhstan

In 2020 and 2021, field surveys were conducted to observe the incidence of viruses in raspberry growing areas in Almaty province (ca. 700–750 m above mean sea level) as well as from high-altitude regions of the Tien Shan mountains, approximately 1100–1200 m amsl. A total of 222 leaf samples, including 187 raspberry plants from cultivated fields and 35 from wild growing areas, were tested by RT-PCR for the presence of RBDV, RLMV, RLBV, and RpRSV. RBDV was found in 47 cultivated and 15 wild plants, with an RLMV coinfection in nine and two samples, respectively. The two wild raspberry bushes infected with RLMV also harboured an RLBV infection. RpRSV was not detected in any of the samples. The coinfection of RBDV and RLMV will not be examined further in this study, as it is the topic of future research.
RBDV RNA2 was characterized in this study because the corresponding sequences from many isolates are available in GenBank [30], providing a better scaffolding for an informative phylogenetic tree to analyse relationships between RBDV isolates from different locations.
The samples which tested positive for RBDV were characterized by RT-PCR with a second set of primers covering the 5′ and 3′ untranslated ends of RBDV RNA2 (Table 1). Since this set of primers did not target a conserved region, an amplicon corresponding to the nearly full-length RNA2 sequence of only 18 isolates was obtained and used for Nanopore sequencing (Table 2). Two out of eighteen RBDV isolates sequenced (KZD8 and KZSelection4) were from plants with an RLMV coinfection.

3.2. Variability of Genomic RNA2

Pairwise comparison of RBDV RNA2 sequences revealed a high level of similarity (97–100%) among the Kazakhstani isolates, along with isolate R15 from the UK and DMSZ PV 1316 from the Netherlands. The latter did not find confirmation through the cladogram.
Phylogenetic analysis of complete RNA2 sequences was performed on those obtained in the present study and those available in GenBank (Table 2).
For the most part, RBDV isolates grouped based on the nature of the plant host. Cherry isolates from Turkey were closer to the grapevine isolates [7] (Figure 2). Separation of Kazakhstani isolates into three clusters was present in all three phylogenetic trees constructed using Bayesian (MrBayes, 1 million generations), Maximum Likelihood (RaxML, bootstrap 1000), and Neighbour-Joining (MEGA11, bootstrap 1000) methods (Figure 2, others not pictured) and suggests three separate introduction events.
Swedish isolate SE3 from wild raspberry in Uppsala [51] clustered with Kazakhstani isolates KZWild2, KZWild4, and KZSelection4 (crossbreed) from wild raspberry but were separate from RBDV isolates from cultivated raspberry. This could indicate that the immune systems of the wild plants evolved within the context of plant virus ecology, which is categorically different from managed crop varieties [53,54]. Evidence suggests that non-cultivated plants can succumb to a wide diversity of plant viruses [55], although some coexist on the principle of tolerance [56] and even mutual benefit [57]. The combination of such circumstances might cause similar traits in cultivated hosts, even in different geographical locations.
The second cluster consisting of cultivated isolates KZ3-4, KZMol3, KZMol6, KZMol11, KZSelection2-8, and KZOgonek was consistent across the three trees, and was located next to the sequences of crops from Belarus and the UK, suggesting that RBDV might have been introduced through the importation of infected planting material from Russia [51] or England. The third cluster of Kazakhstani RBDV isolates was situated at a distance from the available isolates, the majority of which originated in Europe. It is possible that, as more Asian isolates are sequenced, new phylogenetic relationships will be revealed.
Among the Kazakhstani samples, the mutation frequencies ranged between 0.95 × 10−3 and 1.19 × 10−3 (Table 3), remaining relatively uniform across individual plants from multiple locations. Within each gene, the degree of mutation was diverse, indicating recurring substitutions, while the number of indels remained low. The highest mutational frequency of 4.04 × 10−3 was found in the CP gene of KZ3-4; however, the mean complexity was higher for the MP region (3.39 × 10−3). Both CP and MP genes are subject to significant selection pressure [23], and the data suggest that their mutation rates are similar. Low and uniform Shannon entropy indicates similarity among viral quasispecies.
Within the RBDV RNA2 metagenome, 182 variable positions (defined as containing either more than three substitutions across the sample pool or any indel mutations) were detected (Figure 3). Of these, 85 were located within the MP gene (7.89% sites), and 70 were within the CP gene (8.48% sites). The 5′ and 3′ untranslated regions of RNA2 could not be analysed sufficiently due to many sequences from GenBank lacking them. The most prominent insertions and deletions occurred outside the protein coding regions.
To assess the impact of genome variability on the protein sequence, phylogenetic analyses were run on each of the proteins separately.

3.3. Protein Sequence Analysis

The MP gene sequences (Figure 4) demonstrated similar distributions. The groups remained consistent with the whole RNA2 tree and point to a shared protein ancestor of the wild Kazakhstani cluster (1) and wild SE3.
The CP gene amino acid sequence analysis (Figure 5) included additional 46 sequences currently available in GenBank for a total of 94 (Supplementary Table S1). Among the additions were the Turkish blackberry isolates, which introduced a new, well-supported clade to the phylogenetic tree in relation to RBDV-China (Figure 4). Grouping according to the host plant remained, but the number and distribution of subgroups changed. The cluster of RBDV isolates from wild raspberry (1) previously located in the vicinity of SE3 was now near Slovenian RR3 and RR5, and the formerly isolated cluster (3) was placed deep within the upper raspberry subclade as a direct descendant of the wild SE3. Sweden is unlikely to be the progenitor of the CP gene or the main centre of Rubus biodiversity [58]. Sequencing isolates from the centre of Rubus biodiversity, such as Yunnan, might reveal more conclusive results.
Amino acids 1–29 and 204–274 were identical in all isolates except those from blackberry, even though McFarlane et al. confirmed in mutagenic studies that neither the 226 C-terminal nor the first 15 N-terminal amino acids are essential for biological activity of the virus [14].
Inconsistencies between CP and MP cladograms (Figure 4 and Figure 5) suggest that despite both proteins being involved in viral intracellular movement during the infection process [23], they face different selection pressures from the plant’s immune system.

3.4. Secondary Structure Prediction

Secondary structure properties prediction software RaptorX v1.01 [59] revealed that while CP sequences were relatively conserved among local isolates, the MP had two variable domains around the 170th and 250th amino acids, both consisting of 15 aa (Figure 6). Comparison with other isolates indicated that the α-helical domain at 170 aa was present in samples from the UK, Belarus, and Kazakhstan (15 out of 18). Other analysed sequences, along with the cluster of RBDV isolates from wild raspberry (1), exhibited putative β-strand structures at the same position.
The domain around 250 aa remained consistently α-helical across the sequences from GenBank, while MP sequences within cluster (3) had two substitutions in the region, Ala254Thr and Pro257Ser, which altered the predicted secondary structure to a β-strand in place of an α-helix and would have wider implications for the 3D conformation. The protein topology detection tool [60] predicted no transmembrane domains, concluding that all residues were facing inside. The Enthalpy prediction tool [61] assigned the two hydrophobic regions with the lowest ΔGapp (5.59–5.73 and 7.61–7.75, respectively), although they were not negative enough to be classified as trans-membrane domains. These regions can potentially be the sites through which MP associates with the membranes instead [62].
There is a lack of information currently available on the topology and aetiology of Idaeovirus MPs in general and RBDV in particular. However, groups of researchers consider them to be related to the Bromoviridae family (particularly to alfalfa mosaic virus and tobacco string virus) [63,64,65,66,67]. The alfamovirus MP is known to be associated with plasmodesmata and accomplishes intracellular movement by increasing their size exclusion limit and forming tubuli [68,69].
The introduction of a new serine into the amino acid sequence could potentially strengthen the binding of the MP to the CP (if the AMV model of movement between cells was to be applied) due to the addition of another phosphorylation site [70]. C-terminal deletions in AMV have been found to affect tubule formation and the association between MP and CP, which are prerequisites for cell-to-cell and systemic movement [71], although to a lesser extent than N-terminal mutations.
Because all RNA molecules were extracted from plants showing visible signs of virus infection, this confirmation change did not affect the virulence capabilities of RBDV. Further in planta experiments would help elucidate the effect of the amino acid substitutions on the infection process.

4. Conclusions

In Kazakhstan, raspberry planting material is imported primarily from Europe and Russia, in most cases without testing for absence of viruses. Therefore, research on viruses and virus transmission is crucial to raspberry industry.
Currently, our understanding of the complexities of plant virus dynamics across agroecological boundaries is severely limited due to the lack of information on wild populations [72,73]. For the first time, raspberry viruses present in Kazakhstan have been investigated for phylogenetic relationships. By providing RNA sequences from both sides of the agricultural–wild interface from a previously underrepresented single region, we contributed to a more complete picture of RBDV diversity and distribution, as well as tracking its movement between cultivated and non-cultivated plant host communities.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v15040975/s1, Table S1. Additional 46 isolates used for phylogenetic analysis of the raspberry bushy dwarf virus (RBDV) coat protein [15,74,75,76].

Author Contributions

Conceptualization, D.G. and M.K. (Mariya Kolchenko); methodology, M.K. (Mariya Kolchenko) and A.T.; software, M.K. (Mariya Kolchenko) and A.P.; formal analysis, M.K. (Marina Khusnitdinova) and G.N.; investigation, M.K. (Mariya Kolchenko), A.K., and N.K.; resources, A.K.; data curation, N.K.; writing—original draft preparation, M.K. (Mariya Kolchenko); writing—review and editing, M.K. (Mariya Kolchenko) and D.G.; visualization, A.P.; project administration, D.G.; funding acquisition, D.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Agriculture of the Republic of Kazakhstan, grant number BR10765038 “Development of methodology and implementation of scientifically based system of certification and inspection of seed potatoes and planting material of fruit crops in the Republic of Kazakhstan”.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Raw data are available in the Supplementary Material.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zerbini, F.M.; Siddell, S.G.; Mushegian, A.R.; Walker, P.J.; Lefkowitz, E.J.; Adriaenssens, E.M.; Alfenas-Zerbini, P.; Dutilh, B.E.; García, M.L.; Junglen, S.; et al. Differentiating between Viruses and Virus Species by Writing Their Names Correctly. Arch. Virol. 2022, 167, 1231–1234. [Google Scholar] [CrossRef] [PubMed]
  2. Barnett, O.W.; Murant, A.F. Host Range, Properties and Purification of Raspberry Bushy Dwarf Virus. Ann. Appl. Biol. 1970, 65, 435–449. [Google Scholar] [CrossRef]
  3. Jones, A.T.; Murant, A.F.; Jennings, D.L.; Wood, G.A. Association of Raspberry Bushy Dwarf Virus with Raspberry Yellows Disease; Reaction of Rubus Species and Cultivars, and the Inheritance of Resistance. Ann. Appl. Biol. 1982, 100, 135–147. [Google Scholar] [CrossRef]
  4. Kokko, H.; Lemmetty, A.; Haimi, P.; Kärenlampi, S. New Host for Raspberry Bushy Dwarf Virus: Arctic Bramble (Rubus arcticus). Eur. J. Plant Pathol. 1996, 102, 713–717. [Google Scholar] [CrossRef]
  5. Strik, B.; Martin, R.R. Impact of Raspberry Bushy Dwarf Virus on “Marion” Blackberry. Plant Dis. 2003, 87, 294–296. [Google Scholar] [CrossRef] [PubMed]
  6. Mavrič, I.; Marn, M.V.; Koron, D.; Žežlina, I. First Report of Raspberry Bushy Dwarf Virus on Red Raspberry and Grapevine in Slovenia. Plant Dis. 2003, 87, 1148. [Google Scholar] [CrossRef] [PubMed]
  7. Çağlayan, K.; Gazel, M.; Roumi, V.; Lamovsek, J.; Beber, A.; Pleško, I.M. Sweet Cherry, a New Host of Raspberry Bushy Dwarf Virus. J. Plant Pathol. 2023, 105, 307–311. [Google Scholar] [CrossRef]
  8. Murant, A.F.; Jones, A.T. Comparison of Isolates of Raspberry Bushy Dwarf Virus from Red and Black Raspberries. Acta Hortic. 1976, 66, 47–52. [Google Scholar] [CrossRef]
  9. Isogai, M.; Yoshida, T.; Nakanowatari, C.; Yoshikawa, N. Penetration of Pollen Tubes with Accumulated Raspberry Bushy Dwarf Virus into Stigmas Is Involved in Initial Infection of Maternal Tissue and Horizontal Transmission. Virology 2014, 452–453, 247–253. [Google Scholar] [CrossRef] [PubMed]
  10. Ziegler, A.; Natsuaki, T.; Mayo, M.A.; Jolly, C.A.; Murant, A.F. The Nucleotide Sequence of RNA-1 of Raspberry Bushy Dwarf Virus. J. Gen. Virol. 1992, 73, 3213–3218. [Google Scholar] [CrossRef]
  11. Natsuaki, T.; Mayo, M.A.; Jolly, C.A.; Murant, A.F. Nucleotide Sequence of Raspberry Bushy Dwarf Virus RNA-2: A Bicistronic Component of a Bipartite Genome. J. Gen. Virol. 1991, 72, 2183–2189. [Google Scholar] [CrossRef] [PubMed]
  12. Mayo, M.A.; Jolly, C.A.; Murant, A.F.; Raschke, J.H. Nucleotide Sequence of Raspberry Bushy Dwarf Virus RNA-3. J. Gen. Virol. 1991, 72, 469–472. [Google Scholar] [CrossRef] [PubMed]
  13. Raj, F.; Mallika, J. SRNA Deep Sequencing Aided Plant RNA Virus Detection in Cultivated Raspberries and Molecular Characterization of Raspberry Bushy Dwarf Virus and Black Raspberry Necrosis Virus from Finland, Helsingin Yliopisto. Master’s Thesis, University of Helsinki, Helsinki, Finland, 2018. [Google Scholar]
  14. MacFarlane, S.A.; McGavin, W.J. Genome Activation by Raspberry Bushy Dwarf Virus Coat Protein. J. Gen. Virol. 2009, 90, 747–753. [Google Scholar] [CrossRef] [PubMed]
  15. Jones, A.T.; Mcgavin, W.J.; Mayo, M.A.; Angel-Diaz, J.E.; Kärenlampi, S.O.; Kokko, H. Comparisons of Some Properties of Two Laboratory Variants of Raspberry Bushy Dwarf Virus (RBDV) with Those of Three Previously Characterised RBDV Isolates. Eur. J. Plant Pathol. 2000, 106, 623–632. [Google Scholar] [CrossRef]
  16. Quito-Avila, D.F.; Ibarra, M.A.; Alvarez, R.; Peralta, E.L.; Martin, R.R. A Raspberry Bushy Dwarf Virus Isolate from Ecuadorean Rubus Glaucus Contains an Additional RNA That Is a Rearrangement of RNA-2. Arch. Virol. 2014, 159, 2519–2521. [Google Scholar] [CrossRef]
  17. Quito-Avila, D.F.; Lightle, D.; Martin, R.R. Effect of Raspberry Bushy Dwarf Virus, Raspberry Leaf Mottle Virus, and Raspberry Latent Virus on Plant Growth and Fruit Crumbliness in “Meeker” Red Raspberry. Plant Dis. 2013, 98, 176–183. [Google Scholar] [CrossRef]
  18. Tzanetakis, I.E. The Gordian Knot of Small Fruit Virology: Emerging Diseases and Their Control. APSnet Feature Artic. 2012. [Google Scholar] [CrossRef]
  19. Krupovic, M.; Koonin, E.V. Multiple Origins of Viral Capsid Proteins from Cellular Ancestors. Proc. Natl. Acad. Sci. USA 2017, 114, E2401–E2410. [Google Scholar] [CrossRef]
  20. Chare, E.R.; Holmes, E.C. Selection Pressures in the Capsid Genes of Plant RNA Viruses Reflect Mode of Transmission. J. Gen. Virol. 2004, 85, 3149–3157. [Google Scholar] [CrossRef]
  21. Davino, S.; Panno, S.; Rangel, E.A.; Davino, M.; Bellardi, M.G.; Rubio, L. Population Genetics of Cucumber Mosaic Virus Infecting Medicinal, Aromatic and Ornamental Plants from Northern Italy. Arch. Virol. 2012, 157, 739–745. [Google Scholar] [CrossRef]
  22. Zelyüt, F.R.; Ertunç, F. Population Genetic Analysis of Lettuce Big-Vein Disease Viruses and Their Vector Fungi Olpidium Virulentus in Ankara Province, Turkey. Physiol. Mol. Plant Pathol. 2021, 113, 101593. [Google Scholar] [CrossRef]
  23. Callaway, A.; Giesman-Cookmeyer, D.; Gillock, E.T.; Sit, T.L.; Lommel, S.A. The Multifunctional Capsid Proteins of Plant RNA Viruses. Annu. Rev. Phytopathol. 2001, 39, 419–460. [Google Scholar] [CrossRef]
  24. Amraee, L.; Rahmani, F. Modified CTAB Protocol for RNA Extraction from Lemon Balm (Melissa Officinalis L.). Acta Agric. Slov. 2020, 115, 53–57. [Google Scholar] [CrossRef]
  25. Gritsenko, D.; Kerimbek, N.; Kapytina, A.; Pozharskiy, A.; Nizamdinova, G.; Taskuzhina, A.; Kostyukova, V.; Adilbayeva, K. Development of Primer Sets for Detection of Raspberry Leaf Blotch Virus and Raspberry Leaf Mottle Virus by Multiplex RT-PCR. Eurasian J. Appl. Biotechnol. 2022, 1, 33–39. [Google Scholar] [CrossRef]
  26. Edgar, R.C. MUSCLE: A Multiple Sequence Alignment Method with Reduced Time and Space Complexity. BMC Bioinform. 2004, 5, 113. [Google Scholar] [CrossRef]
  27. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; Mcgettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X Version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
  28. Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data; ScienceOpen, Inc.: Berlin, Germany, 2010. [Google Scholar]
  29. Ewels, P.; Magnusson, M.; Lundin, S.; Käller, M. MultiQC: Summarize Analysis Results for Multiple Tools and Samples in a Single Report. Bioinformatics 2016, 32, 3047–3048. [Google Scholar] [CrossRef]
  30. Brancaccio, R.N.; Robitaille, A.; Dutta, S.; Rollison, D.E.; Tommasino, M.; Gheit, T. MinION Nanopore Sequencing and Assembly of a Complete Human Papillomavirus Genome. J. Virol. Methods 2021, 294, 114180. [Google Scholar] [CrossRef] [PubMed]
  31. Wick, R.R.; Judd, L.M.; Holt, K.E. Performance of Neural Network Basecalling Tools for Oxford Nanopore Sequencing. Genome Biol. 2019, 20, 129. [Google Scholar] [CrossRef]
  32. Wick, R. Filtlong. 2018. Available online: https://github.com/rrwick/Filtlong (accessed on 10 March 2023).
  33. Koren, S.; Walenz, B.P.; Berlin, K.; Miller, J.R.; Bergman, N.H.; Phillippy, A.M. Canu: Scalable and Accurate Long-Read Assembly via Adaptive κ-Mer Weighting and Repeat Separation. Genome Res. 2017, 27, 722–736. [Google Scholar] [CrossRef]
  34. Medaka: Sequence Correction Provided by ONT Research. Available online: https://github.com/nanoporetech/medaka (accessed on 10 March 2023).
  35. Okonechnikov, K.; Golosova, O.; Fursov, M.; Varlamov, A.; Vaskin, Y.; Efremov, I.; Grehov, O.G.G.; Kandrov, D.; Rasputin, K.; Syabro, M.; et al. Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
  36. Katoh, K.; Misawa, K.; Kuma, K.I.; Miyata, T. MAFFT: A Novel Method for Rapid Multiple Sequence Alignment Based on Fast Fourier Transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [PubMed]
  37. Crooks, G.E.; Hon, G.; Chandonia, J.M.; Brenner, S.E. WebLogo: A Sequence Logo Generator. Genome Res. 2004, 14, 1188–1190. [Google Scholar] [CrossRef] [PubMed]
  38. Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M. Twelve Years of SAMtools and BCFtools. GigaScience 2021, 10, giab008. [Google Scholar] [CrossRef] [PubMed]
  39. Li, H.; Barrett, J. A Statistical Framework for SNP Calling, Mutation Discovery, Association Mapping and Population Genetical Parameter Estimation from Sequencing Data. Bioinformatics 2011, 27, 2987–2993. [Google Scholar] [CrossRef]
  40. Domingo, E.; Martín, V.; Perales, C.; Grande-Pérez, A.; García-Arriaza, J.; Arias, A. Viruses as Quasispecies: Biological Implications. Curr. Top. Microbiol. Immunol. 2006, 299, 51–82. [Google Scholar] [CrossRef] [PubMed]
  41. Sánchez-Campos, S.; Domínguez-Huerta, G.; Díaz-Martínez, L.; Tomás, D.M.; Navas-Castillo, J.; Moriones, E.; Grande-Pérez, A. Differential Shape of Geminivirus Mutant Spectra across Cultivated and Wild Hosts with Invariant Viral Consensus Sequences. Front. Plant Sci. 2018, 9, 932. [Google Scholar] [CrossRef]
  42. Juárez, M.; Rabádan, M.P.; Martínez, L.D.; Tayahi, M.; Grande-Pérez, A.; Gómez, P. Natural Hosts and Genetic Diversity of the Emerging Tomato Leaf Curl New Delhi Virus in Spain. Front. Microbiol. 2019, 10, 140. [Google Scholar] [CrossRef]
  43. Felsenstein, J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution 1985, 39, 783. [Google Scholar] [CrossRef]
  44. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian Inference of Phylogenetic Trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
  45. Kimura, M. A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
  46. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian Phylogenetic Inference under Mixed Models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
  47. Stamatakis, A. RAxML Version 8: A Tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
  48. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  49. Chamberlain, C.J.; Kraus, J.; Kohnen, P.D.; Finn, C.E.; Martin, R.R. First Report of Raspberry Bushy Dwarf Virus in Rubus Multibracteatus from China. Plant Dis. 2003, 87, 603. [Google Scholar] [CrossRef]
  50. Mavrič Pleško, I.; Viršček Marn, M.; Širca, S.; Urek, G. Biological, Serological and Molecular Characterisation of Raspberry Bushy Dwarf Virus from Grapevine and Its Detection in the Nematode Longidorus Juvenilis. Eur. J. Plant Pathol. 2009, 123, 261–268. [Google Scholar] [CrossRef]
  51. Valasevich, N.; Kukharchyk, N.; Kvarnheden, A. Molecular Characterisation of Raspberry Bushy Dwarf Virus Isolates from Sweden and Belarus. Arch. Virol. 2011, 156, 369–374. [Google Scholar] [CrossRef]
  52. Mavrič Pleško, I.; Lamovšek, J.; Lešnik, A.; Viršček Marn, M. Raspberry Bushy Dwarf Virus in Slovenia—Geographic Distribution, Genetic Diversity and Population Structure. Eur. J. Plant Pathol. 2020, 158, 1033–1042. [Google Scholar] [CrossRef]
  53. Haňcinský, R.; Mihálik, D.; Mrkvová, M.; Candresse, T.; Glasa, M. Plant Viruses Infecting Solanaceae Family Members in the Cultivated and Wild Environments: A Review. Plants 2020, 9, 667. [Google Scholar] [CrossRef]
  54. Shates, T.M.; Sun, P.; Malmstrom, C.M.; Dominguez, C.; Mauck, K.E. Addressing Research Needs in the Field of Plant Virus Ecology by Defining Knowledge Gaps and Developing Wild Dicot Study Systems. Front. Microbiol. 2018, 9, 3305. [Google Scholar] [CrossRef] [PubMed]
  55. Malmstrom, C.M.; Alexander, H.M. Effects of Crop Viruses on Wild Plants. Curr. Opin. Virol. 2016, 19, 30–36. [Google Scholar] [CrossRef] [PubMed]
  56. Paudel, D.B.; Sanfaçon, H. Exploring the Diversity of Mechanisms Associated with Plant Tolerance to Virus Infection. Front. Plant Sci. 2018, 9, 1575. [Google Scholar] [CrossRef] [PubMed]
  57. Roossinck, M.J.; Bazán, E.R. Symbiosis: Viruses as Intimate Partners. Annu. Rev. Virol. 2017, 4, 123–139. [Google Scholar] [CrossRef] [PubMed]
  58. Huang, Y.-J.; Jacques, F.M.B.; Liu, Y.-S.C.; Su, T.; Ferguson, D.K.; Xing, Y.-W.; Zhou, Z.-K. Rubus (Rosaceae) Diversity in the Late Pliocene of Yunnan, Southwestern China. Geobios 2015, 48, 439–448. [Google Scholar] [CrossRef]
  59. Yang, Y.; Gao, J.; Wang, J.; Heffernan, R.; Hanson, J.; Paliwal, K.; Zhou, Y. Sixty-Five Years of the Long March in Protein Secondary Structure Prediction: The Final Stretch? Brief. Bioinform. 2018, 19, 482–494. [Google Scholar] [CrossRef]
  60. Hallgren, J.; Tsirigos, K.D.; Pedersen, M.D.; Juan, J.; Armenteros, A.; Marcatili, P.; Nielsen, H.; Krogh, A.; Winther, O. DeepTMHMM Predicts Alpha and Beta Transmembrane Proteins Using Deep Neural Networks. bioRxiv, 2022; bioRxiv:2022.04.08.487609. [Google Scholar] [CrossRef]
  61. Hessa, T.; Meindl-Beinker, N.M.; Bernsel, A.; Kim, H.; Sato, Y.; Lerch-Bader, M.; Nilsson, I.; White, S.H.; Heijne, G.V. Molecular Code for Transmembrane-Helix Recognition by the Sec61 Translocon. Nature 2007, 450, 1026–1030. [Google Scholar] [CrossRef] [PubMed]
  62. Peiró, A.; Martínez-Gil, L.; Tamborero, S.; Pallás, V.; Sánchez-Navarro, J.A.; Mingarro, I. The Tobacco Mosaic Virus Movement Protein Associates with but Does Not Integrate into Biological Membranes. J. Virol. 2014, 88, 3016–3026. [Google Scholar] [CrossRef]
  63. Gallitelli, D.; Finetti-Sialer, M.; Martelli, G.P. Anulavirus, a Proposed New Genus of Plant Viruses in the Family Bromoviridae. Arch. Virol. 2005, 150, 407–411. [Google Scholar] [CrossRef]
  64. Isogai, M.; Matsudaira, T.; Ito, M.; Yoshikawa, N. The 1b Gene of Raspberry Bushy Dwarf Virus Is a Virulence Component That Facilitates Systemic Virus Infection in Plants. Virology 2019, 526, 222–230. [Google Scholar] [CrossRef]
  65. Sztuba-Solińska, J.; Bujarski, J.J. Insights into the Single-Cell Reproduction Cycle of Members of the Family Bromoviridae : Lessons from the Use of Protoplast Systems. J. Virol. 2008, 82, 10330–10340. [Google Scholar] [CrossRef]
  66. Thekke-Veetil, T.; Ho, T.; Postman, J.D.; Tzanetakis, I.E. Characterization and Detection of a Novel Idaeovirus Infecting Blackcurrant. Eur. J. Plant Pathol. 2017, 149, 751–757. [Google Scholar] [CrossRef]
  67. Ziegler, A.; Mayo, M.A.; Murant, A.F. Proposed Classification of the Bipartite-Genomed Raspberry Bushy Dwarf Idaeovirus, with Tripartite-Genomed Viruses in the Family Bromoviridae. Arch. Virol. 1993, 131, 483–488. [Google Scholar] [CrossRef]
  68. Kumar, G.; Dasgupta, I. Variability, Functions and Interactions of Plant Virus Movement Proteins: What Do We Know So Far? Microorganisms 2021, 9, 695. [Google Scholar] [CrossRef] [PubMed]
  69. Tenllado, F.; Bol, J.F. Genetic Dissection of the Multiple Functions of Alfalfa Mosaic Virus Coat Protein in Viral RNA Replication, Encapsidation, and Movement. Virology 2000, 268, 29–40. [Google Scholar] [CrossRef]
  70. Akamatsu, N.; Takeda, A.; Kishimoto, M.; Kaido, M.; Okuno, T.; Mise, K. Phosphorylation and Interaction of the Movement and Coat Proteins of Brome Mosaic Virus in Infected Barley Protoplasts. Arch. Virol. 2007, 152, 2087–2093. [Google Scholar] [CrossRef] [PubMed]
  71. Sánchez-Navarro, J.A.; Bol, J.F. Role of the Alfalfa Mosaic Virus Movement Protein and Coat Protein in Virus Transport. Mol. Plant-Microbe Interact. 2001, 14, 1051–1062. [Google Scholar] [CrossRef] [PubMed]
  72. Bernardo, P.; Charles-Dominique, T.; Barakat, M.; Ortet, P.; Fernandez, E.; Filloux, D.; Hartnady, P.; Rebelo, T.A.; Cousins, S.R.; Mesleard, F.; et al. Geometagenomics Illuminates the Impact of Agriculture on the Distribution and Prevalence of Plant Viruses at the Ecosystem Scale. ISME J 2018, 12, 173–184. [Google Scholar] [CrossRef]
  73. Fraile, A.; Alonso-Prados, J.L.; Aranda, M.A.; Bernal, J.J.; Malpica, J.M.; García-Arenal, F. Genetic Exchange by Recombination or Reassortment Is Infrequent in Natural Populations of a Tripartite RNA Plant Virus. J. Virol. 1997, 71, 934–940. [Google Scholar] [CrossRef] [PubMed]
  74. Isogai, M.; Yoshida, M.; Imanishi, H.; Yoshikawa, N. First Report of Raspberry Yellows Disease Caused by Raspberry Bushy Dwarf Virus in Japan. J. Gen. Plant Pathol. 2012, 78, 360–363. [Google Scholar] [CrossRef]
  75. Pleško, I.M.; Marn, M.V.; Nyerges, K.; Lázár, J. First Report of Raspberry Bushy Dwarf Virus Infecting Grapevine in Hungary. Plant Dis. 2012, 96, 1582. [Google Scholar] [CrossRef] [PubMed]
  76. Czotter, N.; Molnar, J.; Szabó, E.; Demian, E.; Kontra, L.; Baksa, I.; Szittya, G.; Kocsis, L.; Deak, T.; Bisztray, G.; et al. NGS of Virus-Derived Small RNAs as a Diagnostic Method Used to Determine Viromes of Hungarian Vineyards. Front. Microbiol. 2018, 9, 122. [Google Scholar] [CrossRef]
Viruses 15 00975 g001 550
Figure 1. Plant images showing virus-like symptoms of RBDV infection in samples KZWild2 (A) and KZWild4 (B), as well as a healthy raspberry plant (C).
Figure 1. Plant images showing virus-like symptoms of RBDV infection in samples KZWild2 (A) and KZWild4 (B), as well as a healthy raspberry plant (C).
Viruses 15 00975 g001
Viruses 15 00975 g002 550
Figure 2. Cladogram constructed from all publicly available complete RNA2 sequences of RBDV using Bayesian algorithm. Branches are coloured according to the plant host, while isolates are coloured according to their countries of origin. Isolates introduced in this study (prefix KZ) are divided into three groups (1–3) according to their position in the cladogram.
Figure 2. Cladogram constructed from all publicly available complete RNA2 sequences of RBDV using Bayesian algorithm. Branches are coloured according to the plant host, while isolates are coloured according to their countries of origin. Isolates introduced in this study (prefix KZ) are divided into three groups (1–3) according to their position in the cladogram.
Viruses 15 00975 g002
Viruses 15 00975 g003 550
Figure 3. Heat map and logo of most variable regions within complete RBDV RNA2 sequences that were included in the phylogenetic tree.
Figure 3. Heat map and logo of most variable regions within complete RBDV RNA2 sequences that were included in the phylogenetic tree.
Viruses 15 00975 g003
Viruses 15 00975 g004 550
Figure 4. Phylogenetic analysis constructed from all publicly available MP sequences using Bayesian algorithm. Branches are coloured according to the plant host. Kazakhstani cluster (1), (2) and (3) are congruent with the Figure 3.
Figure 4. Phylogenetic analysis constructed from all publicly available MP sequences using Bayesian algorithm. Branches are coloured according to the plant host. Kazakhstani cluster (1), (2) and (3) are congruent with the Figure 3.
Viruses 15 00975 g004
Viruses 15 00975 g005 550
Figure 5. Phylogenetic analysis constructed from all publicly available CP sequences using Bayesian algorithm (includes additional 46 sequences). Branches are coloured according to the plant host. Kazakhstani cluster (1), (2) and (3) are congruent with the Figure 3. Both halves of the separated Kazakhstani cluster two are marked with (2).
Figure 5. Phylogenetic analysis constructed from all publicly available CP sequences using Bayesian algorithm (includes additional 46 sequences). Branches are coloured according to the plant host. Kazakhstani cluster (1), (2) and (3) are congruent with the Figure 3. Both halves of the separated Kazakhstani cluster two are marked with (2).
Viruses 15 00975 g005
Viruses 15 00975 g006 550
Figure 6. Protein Structure Property Prediction of KZWild4 MP, KZD8 MP and R-15 MP (reference) using SS8 DSSP notation. Note the prevalence of either E (extended strand, participating in β ladder) structures or H (α-helix) structures at 160–175 aa and 240–255 aa.
Figure 6. Protein Structure Property Prediction of KZWild4 MP, KZD8 MP and R-15 MP (reference) using SS8 DSSP notation. Note the prevalence of either E (extended strand, participating in β ladder) structures or H (α-helix) structures at 160–175 aa and 240–255 aa.
Viruses 15 00975 g006
Table
Table 1. Sequence information of primer pairs used in RT-PCR and PCR assays for detection and amplification of RBDV, RLMV, RLBV, and RpRSV [25]. NP = nucleocapsid protein.
Table 1. Sequence information of primer pairs used in RT-PCR and PCR assays for detection and amplification of RBDV, RLMV, RLBV, and RpRSV [25]. NP = nucleocapsid protein.
VirusPurposeRegionDirectionSequence (5′–3′)Amplicon Size (bp)
RBDVDetectionCPFagatccatgacggatgtgg182
Raactaagttagaactattgtgg
RBDVAmplificationRNA2Fagatccatgacggatgtgg2231
Raactaagttagaactattgtgg
RLMVDetectionCPFtagcgtacttgtactgttc163
Rtacacttgtagcatgtttgg
RLBVDetectionNPFtacacttgtagcatgtttgg106
Rccaacccttgtcaattttgat
RpRSVDetectionMPFcagagtatgggtgatttct127
Rgaaacagcgcactctt
Table
Table 2. Complete RBDV RNA2 sequences analysed in the present study.
Table 2. Complete RBDV RNA2 sequences analysed in the present study.
IsolateAccessionCountryHostYearSource
J1AB948215JapanRed raspberry cv. Autumn Britten2016Direct submission
RBDV-ChinaDQ120126ChinaRubus multibracteatus2003[49]
GR-6EU796085SloveniaGrapevine2009[50]
GR-4EU796086SloveniaGrapevine2009[50]
GR-2EU796087SloveniaGrapevine2009[50]
RR-1EU796088SloveniaRed raspberry2009[50]
CmRR-1EU796089SloveniaC. murale—raspberry2009[50]
CmGR-2EU796090SloveniaC. murale—grapevine2009[50]
BY1FR687354BelarusRed raspberry cv. Zolotye Cupola2011[51]
BY3FR687355BelarusRed raspberry cv. Abricosovaya2011[51]
BY8FR687356BelarusRed raspberry cv. Zolotye Cupola2011[51]
BY22FR687357BelarusRed raspberry cv. Elegantnaya2011[51]
SE3FR687358SwedenRed raspberry2011[51]
Ec_AzKJ007640EcuadorRubus glaucus—Andean rasp2014[16]
RR2KY417868SloveniaRed raspberry cv. Chilliwack2016Direct submission
RR3KY417869SloveniaRed raspberry2016Direct submission
RR5KY417870SloveniaRed raspberry2016Direct submission
RR8KY417871SloveniaRed raspberry cv. Titan2016Direct submission
GR7KY417872SloveniaGrapevine cv. Chardonnay2016Direct submission
GR10KY417873SloveniaGrapevine cv. Renski Rizling (Riesling)2016Direct submission
GR11KY417874SloveniaGrapevine cv. Sipon2016Direct submission
GR12KY417875SloveniaGrapevine cv. Zweigelt2016Direct submission
GR13KY417876SloveniaGrapevine cv. Kraljevina2016Direct submission
GR8KY417880SloveniaGrapevine cv. Modra Frankinja (Blaufrankisch)2020[52]
GR9KY417881SloveniaGrapevine cv. Modra Frankinja (Blaufrankisch)2020[52]
12G412MH802010CanadaGrapevine2019Direct submission
PV-0053MW582778N/A Chenopodium quinoa (lab) DSMZ PV-00532021Direct submission
B39MW729744TurkeyCherry2022[7]
B188MW729744TurkeyCherry2022[7]
PV-1316MZ202351NetherlandsRed raspberry DSMZ PV-13162021Direct submission
R15S55890UKRed raspberry cv. Mailing Jewel1991[11]
KZ3-4OQ336272KazakhstanRed raspberry, crop2021Present study
KZD6-1OQ336288KazakhstanRed raspberry, crop2021Present study
KZD8OQ336289KazakhstanRed raspberry, crop2021Present study
KZHybrid4-33OQ336273KazakhstanRed raspberry, crop2021Present study
KZMol11OQ336274KazakhstanRed raspberry, crop2021Present study
KZMol13OQ336275KazakhstanRed raspberry, crop2021Present study
KZMol2OQ336276KazakhstanRed raspberry, crop2021Present study
KZMol3OQ336277KazakhstanRed raspberry, crop2021Present study
KZMol5OQ336278KazakhstanRed raspberry, crop2021Present study
KZMol6OQ336279KazakhstanRed raspberry, crop2021Present study
KZMol8OQ336280KazakhstanRed raspberry, crop2021Present study
KZMol9OQ336281KazakhstanRed raspberry, crop2021Present study
KZOgonekOQ336282KazakhstanRed raspberry, crop2021Present study
KZSelection1OQ336283KazakhstanRed raspberry, crop2021Present study
KZSelection2-8OQ336284KazakhstanRed raspberry, crop2021Present study
KZSelection4OQ336285KazakhstanRed raspberry, crop2021Present study
KZWild2OQ336286KazakhstanRed raspberry, wild2021Present study
KZWild4OQ336287KazakhstanRed raspberry, wild2021Present study
Table
Table 3. Molecular characterization of mutant spectra for RNA2 of RBDV isolates: mutation frequency per genome and per gene. Numbers of SNPs, indels, nucleotide diversity, and Shannon index were estimated by retracting the 10−3 error rate correction.
Table 3. Molecular characterization of mutant spectra for RNA2 of RBDV isolates: mutation frequency per genome and per gene. Numbers of SNPs, indels, nucleotide diversity, and Shannon index were estimated by retracting the 10−3 error rate correction.
Mutation Frequency per Codon, 10−3
SamplesMutation Frequency, 10−3MPCPSNPIndelShannon Index
KZ3-41.194.024.043000.00278
KZD6-10.973.252.422100.00233
KZD80.973.252.422100.00233
KZHybrid4-331.003.252.422210.00238
KZMol110.973.252.422110.00233
KZMol131.103.713.842100.00258
KZMol20.952.943.432100.00228
KZMol31.103.713.842110.00258
KZMol50.952.943.432100.00228
KZMol60.973.252.632600.00233
KZMol81.103.713.842000.00258
KZMol90.973.252.422000.00233
KZOgonek1.123.873.842600.00263
KZSelection10.952.943.432600.00228
KZSelection2-80.973.093.032610.00233
KZSelection41.123.873.842600.00263
KZWild21.103.403.232500.00258
KZWild41.073.403.232500.00253
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kolchenko, M.; Kapytina, A.; Kerimbek, N.; Pozharskiy, A.; Nizamdinova, G.; Khusnitdinova, M.; Taskuzhina, A.; Gritsenko, D. Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan. Viruses 2023, 15, 975. https://doi.org/10.3390/v15040975

AMA Style

Kolchenko M, Kapytina A, Kerimbek N, Pozharskiy A, Nizamdinova G, Khusnitdinova M, Taskuzhina A, Gritsenko D. Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan. Viruses. 2023; 15(4):975. https://doi.org/10.3390/v15040975

Chicago/Turabian Style

Kolchenko, Mariya, Anastasiya Kapytina, Nazym Kerimbek, Alexandr Pozharskiy, Gulnaz Nizamdinova, Marina Khusnitdinova, Aisha Taskuzhina, and Dilyara Gritsenko. 2023. "Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan" Viruses 15, no. 4: 975. https://doi.org/10.3390/v15040975

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop