1. Introduction
The first cases of COVID-19, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) emerged in Wuhan, Hubei Province, China in December 2019 and since then, SARS-CoV-2 infections have spread rapidly around the globe. Infection usually results in a mild flu-like illness that includes fever, fatigue, dry cough often with olfactory dysfunction, including anosmia [
1,
2]. However, in some cases, disease can progress to severe pneumonia, acute respiratory distress syndrome (ARDS), multi-organ failure, and even death [
3,
4,
5,
6]. Individuals at a greater risk of developing severe COVID-19 include those with underlying health conditions such as obesity, diabetes, chronic respiratory disease, and cardiovascular disease [
7,
8]. A worldwide effort to combat this disease has resulted in the successful deployment of numerous vaccine candidates and therapeutics, however the COVID-19 pandemic is presenting new challenges with the emergence of new variants of concern (VOCs) with possible enhanced transmission and immune evasion [
9,
10].
A number of animal species have been used to develop models of COVID-19, and these models have played a vital role in the preclinical development of novel vaccine candidates and therapeutics prior to use in humans (reviewed in [
11]). These models are essential in the continued research effort to address challenges posed by new SARS-CoV-2 variants, in particular the virulence, transmission, and immune escape. Despite these research efforts, animal models that can recapitulate key features of the severe and lethal form of disease in humans has been identified as a major gap in the armory of SARS-CoV-2 infection models available for preclinical studies (reviewed in [
12]). Therefore, there is an enduring requirement to develop and characterize alternative models that would fulfil this need.
The common marmoset may be a suitable model of human COVID-19 disease, as marmoset models have previously been developed for highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV-1) [
13] and Middle Eastern Respiratory Syndrome coronavirus (MERS-CoV) [
14,
15,
16], with the disease closely resembling features of disease in humans. In response to the SARS-CoV-2 pandemic, several groups have undertaken COVID-19 modelling with marmosets using either the intranasal route only or a combination of intranasal, intratracheal, and ocular routes of infection [
17,
18]. No clinical signs or virus shedding were observed when marmosets were challenged by the intranasal route only; however, virus was detected in the blood, throat, and nose of animals challenged by multiple routes.
This study aimed to uniquely assess the susceptibility of the marmoset to aerosolised SARS-CoV-2. This challenge route delivers aerosols containing the virus into the deep lung and has the potential to cause a more severe form of the disease, and possibly even at lower challenge doses [
16,
19]. This increases the likelihood of marmosets developing clear, reproducible signs of disease that are relevant to human COVID-19. This study also aimed to support the principles of the 3Rs by increasing the knowledge of SARS-CoV-2 infection in the marmoset, in particular using continuous monitoring of core body temperature (Tc) to assess the fever response, an extensive immunological assessment, and the establishment of immunohistochemistry and RNAScope in situ hybridization methodologies to detect viral RNA, ACE2, and TMPRSS2 in marmoset tissues.
2. Materials and Methods
2.1. Cell Lines
Vero/hSLAM cell line (04091501, ECACC, Salisbury, UK) and Vero C1008 cell line (85020206, ECACC, Salisbury, UK) were maintained in Dulbecco’s minimal essential media (DMEM) supplemented with 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and 10% (v/v) foetal calf serum (FCS) (all Sigma-Aldrich, Gillingham, UK) at 37 °C in 5% (v/v) CO2 humidified atmosphere. For cell infections, cells were maintained in Leibovitz’s L-15 medium supplemented 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and 2% (v/v) FCS (all Sigma-Aldrich, Gillingham, UK) at 37 °C without CO2 in a humidified atmosphere. Vero/hSLAM cells were also supplemented with 0.4 μg/mL Geneticin® (10131027, Gibco™ Thermo Fisher Scientific, Paisley, UK).
2.2. Viruses, Propagation and Enumeration
SARS-CoV-2 (BetaCoV/Australia/VIC01/2020 (Passage 2)) was obtained from the Victorian Infectious Diseases Reference Laboratory at the Peter Doherty Institute for Infection and Immunity in Melbourne, Australia [
20]. A Master stock (Passage 3) and Working stocks (Passage 4) were propagated in Vero/hSLAM cell line. To generate high titre stocks for aerosol challenge, the virus was first concentrated using Amicon
® Ultra-15 100 k centrifugal filter units for 25 min at 4000×
g, at 4 °C (UFC910024, Merck Millipore, Watford, UK) prior to a final purification step through a 30% (
w/
v) sucrose cushion at 179,200×
g for 2 h, at 4 °C. Genome stability was verified following the passage using an amplicon-based Illumina whole genome sequencing approach with the Liverpool protocol/primers [
21]. Sub-consensus variant analysis was conducted using LoFreq [
22]. Virus was enumerated using plaque assay or Reed & Muench TCID
50 method [
23] in Vero C1008 cells, as indicated. The presence of replicating virus was assessed in the lungs, liver, spleen, kidney, brain, and blood by plaque assay and a further blind passage in Vero C1008 cells for 7 days.
2.3. Animals
Healthy, sexually mature common marmosets (Callithrix jacchus) were obtained from the Dstl Porton Down breeding colony and housed as female and vasectomised male pairs. The overall weight of animals when assigned to the study ranged from 370 to 440 g (mean of 406.2 ± 25.33 g). The overall age ranged from 3.7 to 4.7 years (mean of 4.3 ± 0.4 years). Animals were randomly assigned (in pairs) to each group. Animals were allowed free access to food and water as well as environmental enrichment throughout the study. All animals were surgically implanted intraperitoneally with a Remo 201 device (EMMS, Bordon, UK) under general anaesthesia (ketamine hydrochloride/medetomidine hydrochloride/isofluorane in oxygen) to record core body temperature (Tc). Data were transmitted from the devices at 30 s intervals to locally placed antennas and relayed to receivers. Data were analyzed using the eDacq software (v1.9.1 BETA 3, EMMS, Bordon, UK) to provide real-time and recordable Tc. The animal studies were carried out in accordance with the UK Animals (Scientific Procedures) Act of 1986 and the Codes of Practice for the Housing and Care of Animals used in Scientific Procedures 1989. Following a challenge with SARS-CoV-2, animals were handled under animal containment level 3 (CL3) conditions, within a half-suit isolator compliant with British Standard BS5726.
2.4. Aerosol Conditions Optimisation
Prior to undertaking in vivo studies, the conditions for aerosolization of the virus were optimized at different relative humidities (~35%, ~50%, and ~80%) on 3 separate occasions. Two concentrations of the virus diluted in tissue culture fluid supplemented with 2% FCS (1 × 107 to 1 × 108 TCID50/mL) were used to load separate Collison nebulisers. The aerosol system was conditioned to the appropriate relative humidity. To mimic a 10 min animal exposure, an all-glass impinger (AGI-30; Ace Glass Inc., Vineland, NJ, USA) was collected between 4.5 and 5.5 min (i.e., the mid-point of exposure). The impinger contained 10 mL of tissue culture fluid supplemented with 2% FCS and the aerosol cloud was sampled for 1 min. The flow rate of the collection impinger was fixed at 12 L/minute. An Aerodynamic Particle Sizer (APS) (Model 3321, TSI Incorporated, Shoreview, MN, USA) equipped with a 1:100 diluter (Model 3302A, TSI Incorporated, Shoreview, MN, USA) was included into the system and sampled the aerosol cloud for 1 min at 2.5 and 6.5 min from the start of aerosolization.
The starting concentration of the virus (Cneb), the concentration of virus recovered by impingement (Csamp) and the Spray factor (Sf) was determined and compared for each of the conditions. The mass median aerodynamic diameter (MMAD) and the geometric standard deviation (GSD) were calculated using Aerosol Instrument Manager® v9.0 (TSI Incorporated, Shoreview, MN, USA) and were compared between humidities.
2.5. Marmoset Challenge
Prior to challenge, pairs of animals were sedated with 10 mg/kg of ketamine hydrochloride delivered intra-muscularly. Animals were secured within plethysmography tubes and placed within the exposure unit. Briefly, a 4.5 mL suspension of 1.6 × 10
8 TCID
50/mL of SARS-CoV-2 VIC01 (C
neb) was aerosolized using a 3-jet Collison nebuliser in conjunction with an AeroMP (Biaera Technologies L.L.C., Hagerstown, MD, USA) [
24]) at an RH of 43.4% ± 1.1%. Animals were exposed to aerosolized virus for a period of ten minutes and sampled to assess the concentration of the virus and the particle size as described above. The virus was enumerated using TCID
50 assay. The presented challenge dose was calculated for each animal using the concentration of the virus in the aerosol and real-time plethysmography to determine the volume of air breathed by the animal using eDacq software (v1.9.1 BETA 3, EMMS, Bordon, UK). The concentration of the virus in the aerosol cloud was calculated as described below:
* Obtained using real-time plethysmography for each animal, sampled during exposure.
The spray factor (S
f) (ratio of the concentration of virus per L of air and the starting concentration in the Collison nebuliser) was calculated as described below and used as a measure of the reproducibility of the aerosol system and to compare aerosolization conditions.
2.6. Post-Challenge Observations
The animals were observed at least 3 times per day after the challenge, for up to 21 days. Clinical signs were scored during physical entry into the room and Tc were recorded during silent hours for each animal. Animals were conditioned to weighing prior to being assigned to the study using a balance placed within their home cage, thus avoiding the need to handle the animal to obtain this data. The animals were incentivized to sit in a weighing bucket containing a “treat” that is placed on the balance. Body weight data was collected weekly during the pre-containment phase of the study. Once in high containment, body weight data was collected daily in the 5 days prior to the challenge and continued daily throughout the study. This method of weighing relies on animal co-operation and therefore there is an occasional data point missing. On days where procedures were conducted on marmosets, body weight data was collected whilst the animals were anaesthetized.
2.7. In-Life Data Collection
The schedule for in-life data collection is summarized in
Figure 1. Briefly, on days −14, 1, 2, 3, 4, 7, 14, and 21 post-challenge, groups of animals were anaesthetized with a cocktail of fentanyl (0.01 mg/kg), medetomidine (0.06 mg/kg), and midazolam (0.5 mg/kg) (FMM) delivered intra-muscularly. At the end of sampling, anaesthesia was reversed using a cocktail of naloxone (0.005 mg/kg), flumazenil (0.1 mg/kg), and atipamezole (0.3 mg/kg) (NFA) delivered intra-muscularly. Anaesthetic doses were calculated according to the individual animal weight. Whilst sedated, blood was collected from the femoral vein into sodium citrate blood tubes for viral load assessment and immunological analysis. Nasal and throat swabs were collected to assess virus shedding using a flocked nasopharyngeal sampling swab into HiViral™ transport medium (VTM) (A04-96000T and AL167CS-50NO; both supplied by Trafalgar Scientific, Leicester, UK) and vortexed prior to storage at −20 °C.
2.8. Study Termination and Post-Mortem Sampling
The schedule for post-mortem sampling is summarized in
Figure 1. Briefly, pairs of marmosets were euthanised at day 2, 4, or at the end of the study on day 21 post-challenge, using an overdose of sodium pentobarbitone administered intraperitoneally. Blood was collected by cardiac puncture into sodium citrate blood tubes for viral load assessment and immunological analysis. Throat and nasal swab samples were collected as described above. The liver, spleen, kidney, brain, gastrointestinal tract, thymus, and mediastinal lymph node were removed. In addition, the whole head and the respiratory tract (trachea and whole lung) were removed. Sections of each organ were collected for processing for viral load and immunological assessment, and the remainder of the respiratory tract, liver, spleen, kidney, gastrointestinal tract, mediastinal lymph node, and the whole head were collected into 10% (
v/
v) neutral buffered saline for histopathological assessment.
2.9. Detection of Viral RNA Using RT-PCR
RT-PCR was used to determine the presence of viral RNA in representative organs including lungs, liver, spleen, kidney, brain, and blood and in throat and nasal swab samples. Viral RNA was extracted from blood and tissue homogenates using QIAamp
® Viral RNA mini kit (52904, Qiagen, Manchester, UK). Viral RNA was extracted from throat and nasal swabs using the MagMax Pathogen RNA/DNA kit, Kingfisher Flex (4462359, Thermo Fisher Scientific, Paisley, UK). Real-time RT-PCR assays for the SARS-CoV-2
E gene were performed in duplicate using the method developed by Corman et al. [
25], Briefly, 5 µL of RNA sample was added to 20 µL of TaqMan™ Fast Virus 1-Step Master Mix (4444432, Thermo Fisher Scientific, Paisley, UK) containing primers E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT (400 nM per reaction), E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ (200 nM per reaction), E_Sarbeco_R ATATTGCAGCAG TACGCACACA (400 nM per reaction). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 94 °C for 3 min and then 45 cycles of 94 °C for 15 s, 58 °C for 30 s.
2.10. Histopathology
Sections of lung, nasal cavity (longitudinal section close to the medial septum after decalcification with 10% formic acid solution), trachea, liver, kidney, spleen, mediastinal lymph node, thymus, oesophagus, small, and large intestine from each animal were fixed in 10% neutral-buffered formalin (for 16 to 35 days), processed to paraffin wax and 4 µm thick sections cut and stained with haematoxylin and eosin (H&E). The tissues specified above were examined by light microscopy and evaluated subjectively by a qualified pathologist. Tissue sections were scanned by a Hamamatsu NanoZoomer S360 and viewed with NDP.view2 software (v2.8.24, Hamamatsu, Japan). The pathologist was blinded to the group details and the slides were randomized prior to examination in order to prevent bias (blind evaluation).
2.11. SARS-CoV-2 RNA Staining by ISH (RNAScope)
RNAScope® was used to determine the presence of SARS-CoV-2 virus in tissues. Briefly, tissues were pre-treated with hydrogen peroxide and incubated for 10 min at room temperature, with target retrieval for 15 min at 98–101 °C followed by protease plus treatment for 30 min at 40 °C (322350, Advanced Cell Diagnostics, Newark, NJ, USA). A V-nCoV2019-S probe (848561, Advanced Cell Diagnostics, Newark, CA, USA) targeting the S gene was incubated on the tissues for 2 h at 40 °C. Amplification of the signal was carried out following the RNAScope protocol (RNAScope 2.5 HD Detection Reagent—Red) using the RNAScope 2.5 HD red kit (322350, Advanced Cell Diagnostics). Positive control sections (Rhesus macaque lung from experimentally infected animals with SARS-CoV-2) and negative controls were used in the RNAScope ISH runs.
2.12. ACE2 and TMPRSS2 Distribution (IHC)
Tissue sections from each animal were cut at 4 µm on superfrost slides and stained using immunohistochemistry to detect ACE2 and TMPRSS2. The Leica Bond Rxm and polymer refine detection kit with HRP (DS9800, Leica Biosystems, Wetzlar, Germany) were used to visualize the antigens. Sections were dewaxed, rehydrated, and treated in 3–4% hydrogen peroxide for 5 min to quench endogenous peroxidase activity. Anti-ACE2 rabbit monoclonal antibody (NBP267692, Novus Biologicals, Centennial, CO, USA) and TMPRSS2 rabbit polyclonal antibody (NBP293322, Novus Biologicals) were used at dilutions of 1:250 and 1:1000, respectively, and were incubated for 30 min. Leica polymer refine detection kit (DS9800, Leica Biosystems) was used, and DAB as chromogen for visualization and sections were counterstained with Harris’ haematoxylin (DS9800, Leica Biosystems). Positive control sections (Rhesus macaque lung and jejunum experimentally infected with SARS-CoV-2) and negative controls were used in the IHC runs. Images were scanned digitally using a Hamamatsu S360 digital slide scanner and examined using NDP.view2 software (v2.8.24, Hamamatsu, Japan).
2.13. Cell Phenotyping
Blood, spleen, and lung aliquots were stained for an array of immunological markers. Blood samples (collected into sodium citrate and further diluted 50:50 with PBS) were centrifuged at 300× g for 5 min, and the plasma was stored frozen at −70 °C for later analysis. The cell pellets were lysed in 2 mL of red cell lysis buffer (555899, BD biosciences, Oxford, UK) for 5 min then centrifuged at 300× g for 5 min. White cells were re-suspended in zombie UV stain (423107, BioLegend, San Diego, CA, USA) for 5 min, followed by the addition of 100 µL cell staining mix, incubated at room temperature for 30–40 min whilst protected from light. Stain mix comprised of fluorescently bound anti-human or anti-marmoset antibodies: CD45 (6C9: 250204), CD20 (Bly1: Sc-19990), TCR γδ (B1: 331220), CD27 (M-T721: 564894), CD279 PD-1 (EH12.2E7: 329930), CD163 (GHI/61: 333624), CD80 (2D10: 305236), MHCII (L243: 307630), CD40 (5C3: 334336), CD16 (3G8: 302018), CD64 (10.1: 305020), CD54 (HCD54: 322716) all from BioLegend (San Diego, CA, USA); antibodies: CD3 (SP34-2: 741872), CD8 (HIT8a: 740303), CD56 (B159: 741375), CD69 (FN50: 750213), CD14 (M5E2: 557742), CD11c (SHCL3: 340544) from BD biosciences (Oxford, UK).
Cells were washed with 1 mL of PBS followed by centrifugation at 300× g, and the cell pellet was re-suspended in 4% (v/v) paraformaldehyde for 36 h at 4 °C. Cell populations were measured by flow cytometry on an Aurora Cytek (Fremont, CA, USA) and analyzed using Flow Jo v10 (BD, Franklin Lakes, NJ, USA). The CD40 staining for day 2 samples failed, therefore this data was not included in the final analysis.
Lung and spleen samples were minced into 2 mL of L-15 media and gently stroked though a 45 µm cell sieve to obtain a viable single cell suspension. Spleen cells (50 µL) and lung cells (200 µL) were processed and stained as above.
2.14. Recall Assays
Spleen cells or white blood cells (separated as described above) were diluted to achieve a density of 1–3 × 106 cells/mL, and stimulated with either L-15 media (negative control), ConA 2.5 µg/mL (positive control; C0412, Sigma-Aldrich, Gillingham, UK), or SARS-CoV-2 spike peptide mix (0.1 µg/mL Peptivator 130-126-700, Miltenyi Biotec, Surrey, UK) for 18 h incubated at 37 °C. The supernatant was removed and stored at −80 °C prior to cytokine analysis. To the cells, 1 µL/mL of brefeldin A (555029, BD biosciences, Oxford, UK) was added, and cells were re-incubated for 4 h. Cells were than harvested, stained for CD3+ T cells, CD8+ T cells, and CD56+ cells, and fixed in 4% (v/v) paraformaldehyde for 36 h at 4 °C. Following fixation, cells were permeabilized (561651, BD biosciences) and stained for intracellular IFN-γ (1-D1K 3420-7, Mabtech, Nacka Strand, Sweden) and measured by flow cytometry on an Aurora Cytek.
2.15. Cytokine Analysis
Cytokines and chemokines were measured in the plasma or lung and spleen homogenates that were stored frozen at −80 °C until required. Levels of cytokines and chemokines were quantified using the human flexset for IL-1β (558279), IL-6 (558276), MCP-1 (558287), and RANTES ((558324, all BD biosciences, Oxford, UK) and for TNF-α (antibody pair from kit CT772 U-CyTech, Ultrecht, The Netherlands) and IFN-γ (Antibody pair 1-D1K 3420-7 and MT126L:3421M-3 from Mabtech, Nacka Strand, Sweden, conjugated to flex beads by BBI Detection Ltd., Salisbury, UK). All samples were fixed in 4% paraformaldehyde for 36 h at 4 °C and analyzed by flow cytometry (FACS Canto II BD, Oxford, UK). The concentration of IFN-γ (3421M, Mabtech, Nacka Strand, Sweden) and C-reactive protein (CRP; ab260062, Abcam, Cambridge, UK) in plasma were measured by ELISA following manufactures instructions.
2.16. Antibodies
Total IgG was measured in plasma samples collected at post-mortem by ELISA using the Human SARS-CoV-2 Spike (Trimer) Ig Total ELISA Kit (BMS2323, Thermo Fisher Scientific, Paisley, UK) with the human IgG conjugate (AP112P, Sigma-Aldrich, Gillingham, UK), as per manufacturer’s protocol. Briefly, 10 µL of diluted plasma (1:10) was added to the well and incubated for 30 min at 37 °C. Standards and control were also included on the plate. The wells were washed three times using wash buffer before adding 100 µL of HRP-conjugate solution, and was incubated for 30 min at 37 °C. The wells were washed three times using wash buffer, then 100 µL substrate solution was added. The plate was incubated for a further 15 min at room temperature, then 100 µL of stop solution was added to each well. The optical density at 450 nm was determined for each well.
2.17. Plaque Reduction Neutralization Test (PRNT)
Vero C1008 cells were seeded into 24-well plates at a density of 1 × 105 to 5 × 105 cells/mL in Dulbecco’s minimal essential media (DMEM) supplemented with 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and 10% (v/v) foetal calf serum (FCS) (all Sigma-Aldrich, Gillingham, UK) and incubated at 37 °C in 5% (v/v) CO2 humidified atmosphere for 1 to 3 days. On the day of infection, the virus was diluted to a final concentration of 1200 pfu/mL in Leibovitz’s L-15 medium supplemented 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and 2% (v/v) foetal calf serum (FCS) (all Sigma-Aldrich, Gillingham, UK). Marmoset sera was diluted 1:5 and 1:10 in L-15 medium and was either heat treated at 56 °C for 30 min to inactivate complement or left untreated, then incubated with 250 µL of diluted virus for 1 h at 37 °C. A volume of 200 µL of virus–serum mixtures were transferred to seeded plates in duplicate onto Vero C1008 monolayers and allowed to adsorb at room temperature for 1 h, with occasional rocking. Then, 1 mL of carboxymethylcellulose (CMC) overlay media was added to each well, and plates were incubated for 7 days at 37 °C without CO2. Cells were fixed to a minimum final concentration of 1% (v/v) formaldehyde and stained with 0.12% (w/v) crystal violet solution to visualize plaques for counting.
2.18. Statistical Analysis
All statistical analysis was performed using GraphPad Prism version 8.0.1. (GraphPad Software, San Diego, CA, USA). Comparison of the spray factor and particle size was performed on logarithmically transformed data by one-way ANOVA analysis. The comparison of the effect of RH on the MMAD was performed on untransformed data by one-way ANOVA analysis. Linear regression of data was used to assess the relationship between the Csamp (impinger) and Cneb (Collison) and Spray Factor and Csamp. A mixed-effects model was used to determine statistical difference in weight change with time. Statistical differences were determined using ordinary one-way ANOVA with Tukey’s multiple comparisons or Dunnett’s multiple comparisons test on log transformed data (Y = LogY) for clinical chemistry and haematological parameters.
Ensuring consistent volumes of blood collected as small bleed samples obtained from in-life animals was difficult. Therefore, statistical differences between cell types were only performed on relative cell proportions rather than total count data, although for clarity this is also quoted. Neutrophil and monocyte/macrophage proportions and T:B ratios were determined by one-way ANOVA.
4. Discussion
This study is the first example of exposure of marmosets to aerosolized SARS-CoV-2 to deliver the virus directly to the lower respiratory tract. Prior to the challenge, optimization studies were performed to determine the appropriate aerosolization conditions for SARS-CoV-2. These studies indicated that there was a reproducible, proportional relationship between the starting titre of the virus in the Collison nebuliser and the titre of the virus recovered in the impinger. The Spray Factor was not related to the concentration of the virus recovered in the impinger, which indicated that the efficiency of the aerosol delivery system was not compromised by other compounding factors. Changes in the relative humidity were assessed to determine the optimal viral recovery following aerosolization. Spray Factor suggested better recovery at low relative humidity than medium or high relative humidity.
In this study, key features of COVID-19 observed in human disease such as fever, respiratory dysfunction, virus replication, histopathological changes, and immunological responses to infection were studied in the marmoset. Marmosets challenged with SARS-CoV-2 by the aerosol route did not develop overt signs of clinical disease; however, there was some evidence for weight loss during the initial phase following the challenge. In addition, although the animals did not develop a typical fever, a transient disruption to the diurnal temperature profiles of three out of six animals was observed.
Infectious virus could not be recovered from marmoset tissues at post-mortem, and the presence of viral RNA could only be detected in the lungs of animals on days 2 and 4 post-challenge by RT-PCR. Viral RNA was detected in nasal and/or throat swabs on day 1 post-challenge only, with the exception of animal M6 where viral RNA was still detectable in nasal swabs until day 7. The lack of evidence for virus replication in the upper airways and the lungs and dissemination of virus to other tissues would suggest that the challenge input virus was being detected in these assays. Similar findings have also been reported by Lu et al. [
18]. A sub-genomic PCR would be required to confirm this, which was outside of the scope of this study.
Despite the lack of clinical disease, marmosets developed a profound innate immune response following SARS-CoV-2 challenge with prolonged disruptions to the proportions of circulating neutrophils and T cells. Elevated proportions of neutrophils were sustained for the 21-day duration of study, with a slight decline in levels on day 7. A similar profile was also observed in marmosets challenged with MERS-CoV reaching a similarly high level of approximately 60% of the PMBC’s [
16]. However, in contrast to infection with SARS-CoV-2, the neutrophil proportions in marmosets challenged with MERS-CoV declined and returned to baseline levels by day 7. Infection with MERS-CoV also resulted in activation of the neutrophils, which were CD54
+ and CD80
+, whereas there was no change in the activation markers following infection with SAR-CoV-2, apart from the HLA-DR marker. A reduction in neutrophil HLA-DR expression was observed in some animals infected with SARS-CoV-2 and was suggestive of ill health in these marmosets. The expression of HLA-DR on neutrophils is not observed in humans, but it has been linked with a number of bacterial and viral diseases in the marmoset including the febrile response in Q Fever, melioidosis, and MERS [
16,
26,
27]. The lack of expression of the other markers that would typically occur in response to a developing infection was not observed, indicating that the infection was cleared quickly and a maturing immune response did not develop.
The sustained increase in neutrophil proportions during an infection is unusual as neutrophils are considered to be short-lived cells (less than 1 day). Persistence of activated neutrophils have been reported [
28] and sustained levels in COVID-19 patients is associated with severe disease [
29]. In these marmosets, the expansion of the neutrophil population was associated with the initial challenge, and this pool of neutrophils in other marmoset infections would usually be exhausted in an attempt to control a severe infection [
30] or return to normal levels for mild infections [
27]. Following the SARS-CoV-2 challenge, however, the virus was cleared quickly, therefore the neutrophil populations were not expended but persisted for the duration of the study. The apparent reduction in T-cells starting from day 1 post-challenge is difficult to explain, as there was no evidence for migration of T-cells into the lung tissue with only minimal inflammation observed by histopathology. However, a later lymphopenia is characteristic of COVID-19 in humans and is linked to severe disease [
31].
Severe COVID-19 infection in humans is associated with immune dysfunction including the cytokine storm [
32] and macrophage activation syndrome [
33]. Assessing these parameters in the marmoset did not indicate any dysfunction; despite an increase in the levels of monocytes there was minimal systemic activation of the cells. However, levels of C-reactive protein (CRP) were elevated in five out of six animals from day 1 post-challenge compared to pre-challenge baseline levels, but these levels were below diagnostically significant levels described in human COVID-19 cases [
34]. There was no evidence of a developing adaptive immune response (indicated by either T-cell recall assays, identification of memory cells, or antibody production). This provides further evidence that despite a high dose challenge, the virus was cleared before the infection could establish and the adaptive immune response could develop. There was no evidence of pathology associated with SARS-CoV-2 infection in the respiratory tissues or major organs at the macroscopic and microscopic level. Overall, no significant histopathological changes were observed in fixed tissues at any time point. This coincided with the absence of viral RNA using a very sensitive and specific RNAScope ISH technique to target the
S-gene. This method has also been successfully used for tissues from rhesus and cynomolgus macaques [
35], ferrets [
36], and hamsters [
37], and even though the RNA probe used in the ISH RNAScope analysis was not targeting the replicating virus (sense probe), these studies have found a good correlation between infectious virus and presence of ISH positive staining. In addition, a red chromogen in the RNAScope ISH technique was used to avoid any misinterpretation of small amounts of pigment present in multiple tissues. The absence of viral RNA using RNAScope is at odds with the RT-PCR data where viral RNA was still detectable in the lungs of marmosets on days 2 and 4 post-challenge and in nasal and/or throat swab samples, and this may be due to a higher limit of detection for the RNAScope method as there is no amplification phase, compared to the RT-PCR method.
It cannot be excluded that these observations could be attributed to components of the virus diluent used for challenge or the frequent anaesthesia for bio-sampling. The use of mock-infected animals was outside the scope of this pilot study, however future studies could include these controls to address this.
The entry of SARS-CoV-2 into host cells depends on binding of the viral spike (S) protein to the ACE2 host receptor and the priming of the viral S by host TMPRSS2 [
38]. To further understand the interactions between the ACE2 receptor and S protein, Damas et al. have conducted studies to assess binding affinities and predict species susceptibility to SARS-CoV-2 infection [
39]. Their results indicated that 21 of the 24 amino acids in the binding region of the marmoset ACE2 were identical to the human ACE2 binding region, predicting medium susceptibility to SARS-CoV-2. This would suggest that the marmoset may be suitable to model COVID-19. In this study, protocols were established for the immunohistochemical detection of ACE2 and TMPRSS2 in marmoset tissues to explore the abundance and distribution of ACE2 and TMPRSS2 in respiratory and non-respiratory tissues. ACE2 staining was strong in the intestinal absorptive epithelium as well as kidney tubular epithelial cells; however, the respiratory tissues showed almost non-existent staining overall. The absence of the ACE2 receptor is supportive of the lack of evidence for virus replication in the lung and other respiratory tissues that has been observed in this study, even though TMPRSS2 was present in multiple cell populations in tissues. More recent evidence has indicated that even though the marmoset ACE2 orthologue differs from the human ACE2 receptor by only four amino acids [
39], the H41 and E42 residues are critical for SARS-CoV-2 infectivity [
40]. This would explain the findings of this study. Furthermore, humanization of the marmoset ACE2 by mutating the orthologue at positions 41 and 42 into Y and Q, respectively, was able to restore S1 binding and SARS-CoV-2 infectivity.
In summary, marmosets did not develop overt disease when challenged with SARS-CoV-2 by the aerosol route, and there was limited evidence of viral replication or pathology associated with infection. This data is in agreement with other research groups who have reported only mild disease in marmosets challenged with SARS-CoV-2 by alternative routes such as intranasal or combination of intranasal/intratracheal/oral/ocular [
17,
18]. However, further studies to optimise binding of SARS-CoV-2 to the ACE2 receptor could be considered to explore the common marmoset as an alternative non-human primate species to model COVID-19.