The 24.5-kb Left Variable Region Is Not a Determinant for African Swine Fever Virus to Replicate in Primary Porcine Alveolar Macrophages
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Hemadsorption Assay (HAD)
2.3. Western Blotting
2.4. Virus Replication Kinetics
2.5. Generation of a Mutant ASFV with the 24.5-kb LVR Deleted
2.6. Next-Generation Sequencing (NGS)
2.7. Transmission Electron Microscopy (TEM)
2.8. Statistical Analysis
3. Results and Discussion
3.1. The Cell-Adapted ASFV with Varying LVR MGF Deletions Lost the Ability to Replicate in PAMs
3.2. The 24.5-kb LVR Is Non-Essential for ASFV Replication and Virion Morphogenesis in PAMs
3.3. The Growth of the ASFV Mutant Lacking the 24.5-kb LVR Was Decreased in PAMs
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dixon, L.K.; Stahl, K.; Jori, F.; Vial, L.; Pfeiffer, D.U. 2020 African swine fever epidemiology and control. Annu. Rev. Anim. Biosci. 2020, 8, 221–246. [Google Scholar] [CrossRef] [PubMed]
- Vietnam News Agency. Available online: https://link.gov.vn/DNTMXWAb (accessed on 1 June 2022).
- Wang, T.; Sun, Y.; Huang, S.; Qiu, H.J. Multifaceted immune responses to African swine fever virus: Implications for vaccine development. Vet. Microbiol. 2020, 249, 108832. [Google Scholar] [CrossRef]
- Wang, T.; Luo, R.; Sun, Y.; Qiu, H.J. Current efforts towards safe and effective live attenuated vaccines against African swine fever: Challenges and prospects. Infect. Dis. Poverty 2021, 10, 137. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Luo, Y.; Wang, Y.; Li, S.; Zhao, Z.; Bi, Y.; Sun, J.; Peng, R.; Song, H.; Zhu, D.; et al. Cryo-EM structure of the African swine fever virus. Cell Host Microbe 2019, 26, 836–843. [Google Scholar] [CrossRef]
- Dixon, L.K.; Chapman, D.A.; Netherton, C.L.; Upton, C. African swine fever virus replication and genomics. Virus Res. 2013, 173, 3–14. [Google Scholar] [CrossRef]
- Rathakrishnan, A.; Connell, S.; Petrovan, V.; Moffat, K.; Goatley, L.C.; Jabbar, T.; Sánchez-Cordón, P.J.; Reis, A.L.; Dixon, L.K. Differential effect of deleting members of African swine fever virus multigene families 360 and 505 from the genotype II Georgia 2007/1 isolate on virus replication, virulence, and induction of protection. J. Virol. 2022, 96, e0189921. [Google Scholar] [CrossRef]
- Zhang, K.; Yang, B.; Shen, C.; Zhang, T.; Hao, Y.; Zhang, D.; Liu, H.; Shi, X.; Li, G.; Yang, J.; et al. MGF360-9L is a major virulence factor associated with the African swine fever virus by antagonizing the JAK/STAT signaling pathway. mBio 2022, 13, e0233021. [Google Scholar] [CrossRef]
- León, P.D.; Bustos, M.J.; Carrascosa, A.L. Laboratory methods to study African swine fever virus. Virus Res. 2013, 173, 168–179. [Google Scholar] [CrossRef]
- Dixon, L.K.; Sun, H.; Roberts, H. African swine fever. Antiviral Res. 2019, 165, 34–41. [Google Scholar] [CrossRef]
- Yáñez, R.J.; Rodríguez, J.M.; Nogal, M.L.; Yuste, L.; Enríquez, C.; Rodriguez, J.F.; Viñuela, E. Analysis of the complete nucleotide sequence of African swine fever virus. Virology 1995, 208, 249–278. [Google Scholar] [CrossRef] [Green Version]
- Borca, M.V.; Rai, A.; Ramirez-Medina, E.; Silva, E.; Velazquez-Salinas, L.; Vuono, E.; Pruitt, S.; Espinoza, N.; Gladue, D.P. A cell culture-adapted vaccine virus against the current African swine fever virus pandemic strain. J. Virol. 2021, 95, e0012321. [Google Scholar] [CrossRef]
- Wang, T.; Wang, L.; Han, Y.; Pan, L.; Yang, J.; Sun, M.; Zhou, P.; Sun, Y.; Bi, Y.; Qiu, H.J. Adaptation of African swine fever virus to HEK293T cells. Transbound. Emerg. Dis. 2021, 68, 2853–2866. [Google Scholar] [CrossRef] [PubMed]
- Tabarés, E.; Olivares, I.; Santurde, G.; Garcia, M.J.; Martin, E.; Carnero, M.E. African swine fever virus DNA: Deletions and additions during adaptation to growth in monkey kidney cells. Arch. Virol. 1987, 97, 333–346. [Google Scholar] [CrossRef] [PubMed]
- Portugal, R.; Coelho, J.; Höper, D.; Little, N.S.; Smithson, C.; Upton, C.; Martins, C.; Leitão, A.; Keil, G.M. Related strains of African swine fever virus with different virulence: Genome comparison and analysis. J. Gen. Virol. 2015, 96, 408–419. [Google Scholar] [CrossRef]
- Zsak, L.; Lu, Z.; Burrage, T.G.; Neilan, J.G.; Kutish, G.F.; Moore, D.M.; Rock, D.L. African swine fever virus multigene family 360 and 530 genes are novel macrophage host range determinants. J. Virol. 2001, 75, 3066–3076. [Google Scholar] [CrossRef] [PubMed]
- Pan, L.; Luo, R.; Wang, T.; Qi, M.; Wang, B.; Sun, M.; Luo, Y.; Ji, C.; Sun, Y.; Qiu, H.J. Efficient inactivation of African swine fever virus by a highly complexed iodine. Vet. Microbiol. 2021, 263, 109245. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Luo, Y.; Wang, W.; Sun, Y.; Qiu, H.J. Efficient inactivation of African swine fever virus by ozonized water. Vet. Microbiol. 2020, 247, 108796. [Google Scholar] [CrossRef]
- Zhao, D.; Liu, R.; Zhang, X.; Li, F.; Wang, J.; Zhang, J.; Liu, X.; Wang, L.; Zhang, J.; Wu, X.; et al. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg. Microbes Infect. 2019, 8, 438–447. [Google Scholar] [CrossRef]
- Malmquist, W.A.; Hay, D. Hemadsorption and cytopathic effect produced by African swine fever virus in swine bone marrow and buffy coat cultures. Am. J. Vet. Res. 1960, 21, 104–108. [Google Scholar]
- Rai, A.; Pruitt, S.; Ramirez-Medina, E.; Vuono, E.A.; Silva, E.; Velazquez-Salinas, L.; Carrillo, C.; Borca, M.V.; Gladue, D.P. Identification of a continuously Stable and commercially available cell line for the identification of infectious African swine fever virus in clinical samples. Viruses 2020, 12, 820. [Google Scholar] [CrossRef]
- Sun, M.; Yu, S.; Ge, H.; Wang, T.; Li, Y.; Zhou, P.; Pan, L.; Han, Y.; Yang, Y.; Sun, Y.; et al. The A137R protein of African swine fever virus inhibits type I interferon production via the autophagy-mediated lysosomal degradation of TBK1. J. Virol. 2022, 96, e0195721. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Teklue, T.; Wang, T.; Luo, Y.; Hu, R.; Sun, Y.; Qiu, H.J. Generation and evaluation of an African swine fever virus mutant with deletion of the CD2v and UK genes. Vaccines 2020, 8, 763. [Google Scholar] [CrossRef]
- Zhou, P.; Li, L.F.; Zhang, K.; Wang, B.; Tang, L.; Li, M.; Wang, T.; Sun, Y.; Li, S.; Qiu, H.J. Deletion of the H240R gene of African swine fever virus decreases infectious progeny virus production due to aberrant virion morphogenesis and enhances the inflammatory cytokines expression in porcine macrophages. J. Virol. 2022, 96, e0166721. [Google Scholar]
- Andrés, G.; Charro, D.; Matamoros, T.; Dillard, R.S.; Abrescia, N.G.A. The cryo-EM structure of African swine fever virus unravels a unique architecture comprising two icosahedral protein capsids and two lipoprotein membranes. J. Biol. Chem. 2020, 295, 1–12. [Google Scholar] [CrossRef]
- Krug, P.W.; Holinka, L.G.; O’Donnell, V.; Reese, B.; Sanford, B.; Fernandez-Sainz, I.; Gladue, D.P.; Arzt, J.; Rodriguez, L.; Risatti, G.R.; et al. The Progressive adaptation of a Georgian isolate of African swine fever virus to Vero cells leads to a gradual attenuation of virulence in swine corresponding to major modifications of the viral genome. J. Virol. 2015, 89, 2324–2332. [Google Scholar] [CrossRef] [PubMed]
- Chapman, D.A.G.; Tcherepanov, V.; Upton, C.; Dixon, L.K. Comparison of the genome sequences of non-pathogenic and pathogenic African swine fever virus isolates. J. Gen. Virol. 2008, 89, 397–408. [Google Scholar] [CrossRef]
- Sánchez-Cordón, P.J.; Chapman, D.; Jabbar, T.; Reis, A.L.; Goatley, L.; Netherton, C.L.; Taylor, G.; Montoya, M.; Dixon, L. Different routes and doses influence protection in pigs immunised with the naturally attenuated African swine fever virus isolate OURT88/3. Antiviral Res. 2017, 138, 1–8. [Google Scholar] [CrossRef]
- Zhu, Z.; Chen, H.; Liu, L.; Cao, Y.; Jiang, T.; Zou, Y.; Peng, Y. Classification and characterization of multigene family proteins of African swine fever viruses. Brief. Bioinform. 2021, 22, bbaa380. [Google Scholar] [CrossRef]
Primers | Sequences (5′→3′) | Description |
---|---|---|
LA-F | GGTACCCGGGAGCTCGAATTCTAAAAGCCTTACAGATCATCC | Amplification of left homology arm |
LA-R | CATCTCTCACGAGATCGTGACTGAAAACAGCTACTTGACAAC | |
72EGFP-F | GTTGTCAAGTAGCTGTTTTCAGTCACGATCTCGTGAGAGATG | Amplification of p72EGFP |
72EGFP-R | ATGGGCTTTATAGTCCTTTGTCCTGTGAGATCATGGCAGCT | |
RA-F | AGCTGCCATGATCTCACAGGACAAAGGACTATAAAGCCCAT | Amplification of right homology arm |
RA-R | GTCTGCAGAAGCTTCGAATTCTCTCATTTTCTGTATAGCCAT | |
PF | AAATCCTGTTAAATAGGCAAA | Amplification of the MGF300-1L gene |
PR | AGTAAAATATTAGAGCGTCTG | |
RF | GATCCGCCACAACATCGAG | Amplification of the EGFP and right homology arm sequence |
RR | TTTTCAAACGTATTCGCGTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, R.; Wang, T.; Sun, M.; Pan, L.; Huang, S.; Sun, Y.; Qiu, H.-J. The 24.5-kb Left Variable Region Is Not a Determinant for African Swine Fever Virus to Replicate in Primary Porcine Alveolar Macrophages. Viruses 2022, 14, 2119. https://doi.org/10.3390/v14102119
Luo R, Wang T, Sun M, Pan L, Huang S, Sun Y, Qiu H-J. The 24.5-kb Left Variable Region Is Not a Determinant for African Swine Fever Virus to Replicate in Primary Porcine Alveolar Macrophages. Viruses. 2022; 14(10):2119. https://doi.org/10.3390/v14102119
Chicago/Turabian StyleLuo, Rui, Tao Wang, Maowen Sun, Li Pan, Shujian Huang, Yun Sun, and Hua-Ji Qiu. 2022. "The 24.5-kb Left Variable Region Is Not a Determinant for African Swine Fever Virus to Replicate in Primary Porcine Alveolar Macrophages" Viruses 14, no. 10: 2119. https://doi.org/10.3390/v14102119