Next Article in Journal
Investigating the Optimal Location of Potential Forest Industry Clusters to Enhance Domestic Timber Utilization in South Korea
Next Article in Special Issue
Do Seedlings Derived from Pinewood Nematode-Resistant Pinus thunbergii Parl. Clones Selected in Southwestern Region Perform Well in Northern Regions in Japan? Inferences from Nursery Inoculation Tests
Previous Article in Journal
Potential Impact of Climate Change on the Forest Coverage and the Spatial Distribution of 19 Key Forest Tree Species in Italy under RCP4.5 IPCC Trajectory for 2050s
Previous Article in Special Issue
Effects of Temperature Factors on Resistance against Pine Wood Nematodes in Pinus thunbergii, Based on Multiple Location Sites Nematode Inoculation Tests
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 11
Issue 9
10.3390/f11090935
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity and Structure of Japanese Endemic Genus Thujopsis (Cupressaceae) Using EST-SSR Markers

by
Michiko Inanaga
1,
Yoichi Hasegawa
2,
Kentaro Mishima
1 and
Katsuhiko Takata
3,*
1
Forest Tree Breeding Center, Forestry and Forest Products Research Institute, Forest Research and Management Organization, 3809-1 Ishi, Juo, Hitachi, Ibaraki 319-1301, Japan
2
Department of Forest Molecular Genetics and Biotechnology, Forestry and Forest Products Research Institute, Forest Research and Management Organization, 1 Matsunosato, Tsukuba, Ibaraki 305-8687, Japan
3
Institute of Wood Technology, Akita Prefectural University, 11-1 Kaieizaka, Noshiro, Akita 016-0876, Japan
*
Author to whom correspondence should be addressed.
Forests 2020, 11(9), 935; https://doi.org/10.3390/f11090935
Submission received: 24 July 2020 / Revised: 22 August 2020 / Accepted: 24 August 2020 / Published: 27 August 2020
(This article belongs to the Special Issue Genetics and Improvement of Forest Trees)
Browse Figures
Review Reports Versions Notes

Abstract

:
The genus Thujopsis (Cupressaceae) comprises monoecious coniferous trees endemic to Japan. This genus includes two varieties: Thujopsis dolabrata (L.f.) Siebold et Zucc. var. dolabrata (southern variety, Td) and Thujopsis dolabrata (L.f.) Siebold et Zucc. var. hondae Makino (northern variety, Th). The aim of this study is to understand the phylogeographic and genetic population relationships of the genus Thujopsis for the conservation of genetic resources and future breeding. A total of 609 trees from 22 populations were sampled, including six populations from the Td distribution range and 16 populations from the Th distribution range. The genotyping results for 19 expressed sequence tag (EST)-based simple sequence repeat (SSR) markers, followed by a structure analysis, neighbor-joining tree creation, an analysis of molecular variance (AMOVA), and hierarchical F statistics, supported the existence of two genetic clusters related to the distribution regions of the Td and Th varieties. The two variants, Td and Th, could be defined by their provenance, in spite of the ambiguous morphological differences between the varieties. The distribution ranges of both variants, which have been defined from their morphology, was confirmed by genetic analysis. The Th populations exhibited relatively uniform genetic diversity, most likely because Th refugia in the glacial period were scattered throughout their current distribution area. On the other hand, there was a tendency for Td’s genetic diversity to decrease from central to southern Honshu island. Notably, the structure analysis and neighbor-joining tree suggest the hybridization of the two varieties in the contact zone. More detailed studies of the genetic structure of Td are required in future analyses.

1. Introduction

Conifers are a dominant plant type found in the vast boreal forests of the North American and Eurasian continents. They represent an important forest resource in many countries because of their superior wood properties, including straighter trunks and stronger yet lighter wood compared to those of most angiosperms [1]. Generally, wild populations of trees are an important genetic resource and are required for breeding programs that aid in the selection of new plant varieties suitable for withstanding a range of environmental conditions, diseases, and future climate change [2,3,4]. A principal requirement for conserving forest genetic resources is maintaining the genetic diversity within and among the populations of a species [5]. Phylogeographic and population genetic studies using neutral molecular markers provide a means of identifying in situ units and can be used to determine diversity level and distribution, gene flow routes, and major genetic disjunctions within the species [6]. Therefore, it is important to examine the genetic diversity and phylogeography of a wide range of wild populations, including in the context of conifer breeding.
Thujopsis (Cupressaceae) is a genus of monoecious coniferous trees with wind-mediated pollen- and seed-dispersal systems. It is endemic to Japan and is one of the basal lineages of Cupressoideae in the Cupressaceae phylogenetic tree [7]. This genus includes two varieties: Thujopsis dolabrata (L.f.) Siebold et Zucc. var. dolabrata (Td) and Thujopsis dolabrata (L.f.) Siebold et Zucc. var. hondae Makino (Th). Taxonomically, the former is regarded as the southern variety and the latter as the northern variety. Td, which features somewhat horned cones, is widely distributed in the southern region of the Japanese Archipelago, whereas Th, which is characterized by denser needles and rounder cones, is a race distributed in northern Honshu and the southern region of Hokkaido [8,9] (Figure 1a and Figure A1). It is difficult to distinguish between these varieties using morphology alone, as their morphology tends to vary continuously. Therefore, in this study, both varieties will be classified according to their regional distribution. Because of the valuable properties of the wood, the genus Thujopsis is one of the most important tree species in Japanese forestry, and plantations of Th have been actively established in Aomori, Niigata, and Ishikawa Prefectures (see Figure 1b and Table 1) [10]. It is therefore essential to understand the phylogeographic and population genetic relationships of the genus Thujopsis for the conservation of genetic resources and future breeding.
Higuchi et al. [11] suggested that seven natural populations from the Th distribution region, as well as other Japanese conifers distributed over a wide area, showed a relatively low FST (0.046). The two populations that were located in the marginal part of the Th distribution region and the five populations in the northern part of the distribution region were genetically different in the neighbor-joining tree and structure analysis [11]. Ikeda et al. [12] also analyzed the genetic structure of natural forests using populations distributed over almost the same geographical area as studied by Higuchi et al. [11]. They suggested that the distribution area of Th included four regional groups (Hokkaido and Aomori prefectures, Iwate and Yamagata prefectures, Niigata, and Ishikawa prefectures) of natural populations [12]. These findings are important for illustrating the genetic structure of Th; however, they did not include Td populations. Therefore, a study examining both Td and Th is needed to determine the extent to which these two varieties are genetically distinct.
The aim of this study was to examine the genetic structure of the genus Thujopsis and to determine the relative contributions of the genetic structure between varieties. In the present study, simple sequence repeat (SSR) markers, which were representative neutral and co-dominant genetic markers, were used in order to provide basic information that would be useful in the conservation of Thujopsis genetic resources in natural forests.

2. Materials and Methods

2.1. Sampling and Study Sites

A total of 609 trees from 22 populations, including 6 populations from the Td distribution range and 16 populations from the Th distribution range, were sampled (Table 1; Figure 1b). Fresh needles were collected and stored at −30 °C. The sampled trees were each separated by more than 30 m. Sample sizes varied among the populations (Table 1). This variation reflects the sampling of large individuals (older trees) from some populations. Moreover, sampling was not attempted in dangerous areas where the topography was too steep.

2.2. DNA Extraction and Genotyping

Total genomic DNA was extracted from 100-mg needles using the hexadecyltrimethylammonium bromide (CTAB) method [13] with minor modifications. The genotypes of the sample trees were determined for 19 markers that were developed from expressed sequence tag (EST)-based simple sequence repeat (SSR) markers for the genus Thujopsis [14] (Table 2). In addition, universal primers were attached to each forward primer to efficiently incorporate fluorescent dyes during PCR for multiplexing [15]. The PCR was performed in a volume of 10.0 μL containing 10–120 ng of template DNA, 0.15 μM of forward primer, 0.5 μM reverse primer, 0.2 μM of either one of the tail primers fluorescently labeled by FAM, VIC, or NED, and 5.0 μL of Go Taq Master mix (Promega Corporation, Madison, MI, USA). A GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, Foster City, CA, USA) was used (Applied Biosystems, Foster City, CA, USA) with the following thermal profile: initial denaturation at 94 °C for 2 min, followed by 30 cycles of denaturation at 94 °C for 30 s; an annealing temperature of 60 °C for 30 s, and an extension at 72 °C for 30 s; then a final extension at 72 °C for 5 min. The amplified PCR products of each individual were classified into five groups according to the fragment size and the type of fluorescent marker (Table A1). Each group of PCR products was separated by capillary electrophoresis using a 3100 Genetic Analyzer (Applied Biosystems), and genotypes were scored with Geneious 7.0.4 software (Biomatters Ltd., Auckland, New Zealand).

2.3. Data Analysis

2.3.1. Genetic Diversity within Populations

The total number of detected alleles (TA), the observed heterozygosity (Ho), the total gene diversity (HT), and Wright’s inbreeding coefficient (FIS) were calculated at each locus using FSTAT software version 2.9.4 [16].
The total number of detected alleles (allele number), the observed (Ho) and expected heterozygosity (He), and the number of private alleles were calculated for each population using GenAlEx 6.51b2 [17].
The allelic richness was standardized based on 12 individuals (24 gene copies), which was the smallest sample size among the populations. Fixation index values estimating inbreeding within individuals in a population (FIS) were calculated. The significance of positive or negative values of FIS was tested based on 8360 randomizations with a Bonferroni correction. These calculations were performed using FSTAT [16]. The statistical independence of loci (linkage disequilibrium for all pairs of loci across populations) was also evaluated using FSTAT.
To compare genetic differentiation among populations and between loci, the relative genetic differentiation among populations defined under the infinite allele model (IAM; FST) [18] and the stepwise mutation model (SMM; RST) [19] were calculated using SPAGeDi version 1.5 [20]. The genetic differentiation coefficients (GST; analogous to FST) and a standardized measure, which had a range of 0–1 for all levels of genetic diversity (G’ST), were calculated based on the allele frequencies for each locus using GenAlEx [21,22]. The significance of the deviations of FST, RST, GST and G’ST (from zero) was evaluated by permutation tests.
The likelihood of a bottleneck within each population was examined using the two-phase model with 95% single-step mutations and 5% multi-step mutations with 1000 iterations, implemented in the program BOTTLENECK version 1.2.02 [23]. The one-tailed Wilcoxon test was used to detect an excess of expected heterozygosity (He) compared to that expected under mutation–drift equilibrium (HEQ).

2.3.2. Genetic Structures among Populations and Distribution Regions

The presence of isolation-by-distance patterns in population differentiation was investigated by applying the Mantel test to the pairwise relationship between the geographic distances (transformed to natural logarithms) and genetic distances, FST/(1 − FST), between the populations according to Rousset’s method [24]. Comparison analyses for Td population vs. Td population, Th population vs. Th population, and the species as a whole were performed, in order to separately examine the effect of isolation-by-distance within each distribution region and within the species. These calculations were performed using SPAGeDi version 1.5 [20].
For the analysis of molecular variance (AMOVA), we used Arlequin version 3.5.2.2 [25].
Hierarchical F statistics were estimated using the R hierfstat package [26] (“varcomp.glob” and “boot.vc” functions), with the individuals (“Ind”) nested within populations (“Pop”), nested within distribution regions (“Region”), and with 95% confidence intervals (CIs) from 1000 bootstraps. The significance of the hierarchical F statistics was assessed using 10,000 permutations (“test.between” and “test.within” functions) [27]. These calculations were performed using R version 3.6.1 [28].
The genetic relationships among the populations were evaluated by constructing a neighbor-joining tree [29] using Poptree2 web [30,31]. Nei’s chord distance (Da) [32] was used to estimate the degree of genetic divergence of the populations. The node significances of the trees were evaluated using bootstrap probabilities based on 1000 replicates.
The Bayesian approach, which infers population structure and assigns individuals into clusters, was used, implemented in STRUCTURE version 2.3.4 software [33]. We performed 10 runs for each value of K (number of putative populations) from 1 to 10, and employed the Markov chain method with 100,000 iterations (burn-in) and 100,000 Markov chain Monte Carlo repetitions. The simulation was performed under the admixture model with correlated allele frequencies (default parameters). Then the most appropriate cluster number (K) was selected using the criterion from Evanno et al. [34], which is based on ΔK. To choose K and identify sets of highly similar runs in multiple independent runs at a single K value, we used CLUMPAK software [35].

3. Results

3.1. Genetic Diversity across All Populations

The total number of detected alleles for all populations at each locus ranged from five to 32, with an average value of 14.3 (Table A2). On average, over all loci, the observed heterozygosity (Ho) and gene diversity in the total population (HT) were 0.621 and 0.691, respectively. The inbreeding coefficient (FIS) ranged from −0.056 to 0.096. At all loci, the FIS values deviated significantly from zero.
The ranges of genetic diversity within the populations were 5.5 to 8.7 for allele number, 4.20 to 6.55 for allelic richness, 0.496 to 0.746 for Ho, and 0.500 to 0.682 for He (Table 2). The average genetic diversities for Td and Th were 6.42 and 7.17 for allele number, 4.93 and 5.93 for allelic richness, 0.545 and 0.650 for Ho, and 0.551 and 0.642 for He, respectively. Private alleles were found in 18 populations, with a maximum value of five. There were four populations without private alleles. In all populations, observed heterozygosity was not significantly different from that expected for Hardy–Weinberg equilibrium. No evidence of significant linkage disequilibrium was detected in any of the total of 3420 tests for linkage disequilibrium between loci in the populations.
The genetic differentiation among population parameters FST, RST, GST and G’ST varied among loci, ranging from 0.037 to 0.238, from 0.021 to 0.289, from 0.031 to 0.204, and from 0.098 to 0.502, respectively (Table A2). The genetic differentiation between populations over all loci (FST, RST, GST and G’ST) was 0.105, 0.096, 0.088, and 0.246, respectively. All these measures were significantly different from zero at all loci.
No evidence of a recent bottleneck was found (i.e., no He excess compared to HEQ) in the genotypes of all the populations.

3.2. Genetic Structure among Populations

All of the FST/(1 − FST) values between pairs of populations calculated for the three categories were significantly related to the natural logarithms of the geographic distances between them (Figure A2). For the Td vs. Td category, the intercept of the regression line (a) = −0.073 and the slope of the regression line (b) = 0.038, R2 = 0.567 and p < 0.01. The Th vs. Th category showed a = −0.075, b = 0.022, R2 = 0.479, p < 0.000. The species as a whole category showed a = −0.292, b = 0.071, R2 = 0.564, p < 0.000.
The AMOVA suggested that the majority of the variation existed within population (Within Pop, 5.889, p < 0.001, Table 3). The results of the AMOVA and hierarchical F statistics revealed a highly significant genetic divergence between the two distribution regions (Among Region, 0.606; FRegion/Total = 0.088; p < 0.001). The genetic differentiation was highly significant among populations, whereas the contribution of variety was relatively low between the two distribution regions (Among Pop, 0.393; FPop/Region = 0.062; p < 0.001).
The neighbor-joining tree based on Da distance reflected the geographical locations of the populations for the most part (Figure 2). However, genetic relationships between two distribution regions (Td and Th) and two intermediate populations (Minakami (MK) and Nikko (NK)) were not reliably supported because of low bootstrap values.
According to clustering analysis in STRUCTURE, the cluster number (K) was 2 (Figure A3). The distribution of populations for the two clusters was found to be geographically structured between the populations along the distribution regions (Figure 3). The proportion of cluster 1 was much higher in the Td distribution region, while that of cluster 2 was much higher in the Th region. Although the MK and NK populations were located in the Td region, individuals of these two populations belonged to both clusters 1 and 2.

4. Discussion

4.1. Genetic Diversity at EST-SSR in Thujopsis

In the present study, 19 EST-SSR loci were used to estimate population genetic diversity and to investigate the genetic structure in 22 natural populations of the genus Thujopsis. The EST-SSR polymorphisms of the genus Thujopsis retained a nearly equal or slightly higher diversity compared to other Cupressaceae species (Table 2) [36,37,38]. In general, EST-SSR markers have a lower polymorphism than nuclear SSR markers [39,40]. Therefore, the EST-SSR marker loci used in the present study showed lower levels of polymorphism than the previous research on Th [11] and other conifers that are widely distributed in Japan [4,41,42].
A significant and relatively high value of overall population differentiation was found among the populations we examined (Table A2; FST = 0.105, p < 0.001; RST = 0.096, p < 0.001; GST = 0.088, p < 0.001; G’ST = 0.246, p < 0.001). These values were clearly greater than those obtained in Ikeda et al. [12] (FST = 0.039; G’ST = 0.114; EST-SSR). Katsuki et al. [43] reanalyzed and summarized the measures of population differentiation for major conifers distributed in the Japanese Archipelago, including Cryptomeria japonica (FST, 0.028; RST, 0.032; G’ST, 0.125; SSR; [41]), Chamaecyparis obtusa (FST = 0.039; GST = 0.040; G’ST = 0.188; SSR; [4]), Picea alcoquiana (FST = 0.071; G’ST = 0.164; SSR; [44]), and Picea jezoensis (FST = 0.101; SSR; [45]). Additionally, Iwaizumi et al. [46] performed these measurements for Pinus densiflora populations distributed in Japan (FST = 0.013; GST = 0.013; G’ST = 0.122; SSR). Compared with these species, we found a relatively moderate value for FST and a high value for G’ST in the genus Thujopsis. In contrast to previous studies, which were conducted on a single species, measures of population differentiation in the genus Thujopsis may be higher because the study populations included two varieties (Td and Th). On the other hand, higher values for population differentiation measures have been observed in species, including isolated populations, of Picea koyamae (FST = 0.209; RST = 0.173; G’ST = 0.410; SSR; [43]), Sciadopitys verticillata (FST = 0.142; SSR; [47]), Abies mariesii (GST = 0.144; allozyme; [48]), and Pinus pumila (GST = 0.170; allozyme; [49]). These species have narrow, isolated distributions that could reflect restricted gene flow between populations because of habitat discontinuity [50]. Therefore, it is likely the case that the two populations were not completely genetically isolated, although we identified relatively high values for the population differentiation measures in the genus Thujopsis.

4.2. Comparison of Genetic Structure between Td and Th

The population relationships and genetic structures for the genus Thujopsis were analyzed, focusing on the relationship between the two variants. Structure analysis supported the existence of two genetic clusters related to the distribution regions (Figure 1a), i.e., the Td and Th varieties (Figure 3). These clusters were significantly differentiated based on AMOVA and hierarchical F statistics (Table 3). The neighbor-joining tree also supported these results, according to the high (100%) bootstrap probability of branches between the KM population (No. 14, Th) and the MK population (No. 17, Td) (Figure 2). Therefore, the two variants, Td and Th, could be defined by their provenance, in spite of the ambiguous morphological differences between these varieties.
The average values of allelic richness, Ho and He, were relatively lower in Td than Th. Two factors may have contributed to the decline of genetic diversity in Td. First, demographic factors, such as postglacial colonization and a history of human overexploitation, could have played a role. If the refugia of the species were restricted to the southern region, a postglacial rapid expansion to northern regions would be expected to cause a series of founding events that would lead to a loss of alleles and homozygosity [51]. Similarly, tree species that have experienced population declines due to human overexploitation may show low genetic diversity and genetic bottlenecks [52,53,54]. However, no significant bottlenecks were detected in the population in the present study. This suggests that the low genetic diversity exhibited by each of the Td populations was probably caused by the natural characteristics of this variety, or other factors.
Since the Japanese Archipelago extends in a narrow arc from northeast to southwest, with the various mountain ranges probably acting as physical barriers, temperate plant species have generally migrated along the Pacific side, the Sea of Japan side, or the mountain slopes of the Archipelago. Thus, plants species migrated either southwards along the coasts or to lower altitudes into refugia during glacial periods, and expanded either northwards or to higher altitudes during interglacial periods [55]. In fact, many plant species distributed in Japan exhibit genetic divergence between the Pacific side and the Sea of Japan side (e.g., Fagus crenata, [56]; Kalopanax septemlobus, [36]). Additionally, as many tree species exhibit a long generation time, it is likely that not many generations have elapsed since the initial postglacial colonization. As a result, there has been less opportunity for genetic drift, and the large size of many plant populations could fossilize the genetic structure established at the time of colonization [57]. In the case of conifers, Kimura et al. [58] identified clear genetic divergence between two and four gene pools in Cryptomeria japonica. Two gene pools were distributed along the Sea of Japan side and along the Pacific Ocean side, while four gene pools suggested the potential of northern cryptic refugia and/or the potential of admixture events from several refugia between populations in the northern Tohoku district and an isolated gene pool on Yakushima Island (south of Kyushu district). As an example of fossilized genetic structures, Tsuda and Ide [59] suggested that the populations of Betula maximowicziana could be divided into a southern group (Central Honshu island) and a northern group (Hokkaido and Tohoku district) that originated from different refugia. They detected significant bottlenecks that may have been caused by processes of postglacial colonization and the species’ characteristics and/or life history as a long-lived pioneer tree species. However, the present study indicates that the relatively high genetic differentiation of the genus Thujopsis did not fit these frequent patterns of genetic differentiation. The Td and Th varieties were distributed in the southern and northern parts of the Japanese Archipelago. No evidence of a genetic structure between the Sea of Japan side and Pacific Ocean side was found in this study. Th has similar diversity among populations, with relatively uniform values of allelic richness, Ho and He. On the other hand, there was a tendency for allelic richness, Ho and He, to decrease from the Minakami and Nikko groups to the Obitani group in Td. Structure analysis, and the locations of the Minakami and Nikko populations in the neighbor-joining tree with low node significances, suggested that these two populations may contain Td and Th hybridization. In this case, the reason for the high genetic diversity in the Minakami and Nikko populations could be due to hybridization. The remaining four populations (Kiso, Kuraiyama, Toyo-oka, and Obitani) most likely represented pure Td populations, but we found no evidence of refugia in any of these.
Comparing the current distribution of Th with that of Cr. japonica, Aoyama [60] indicated that Th is more drought tolerant and can survive in colder climates. These physiological characteristics may have allowed Th to form refugia in southern Hokkaido and the areas below 500 m elevation in the Tohoku district during the last glacial period [60]. In the case of Th, refugia may have been scattered throughout the Tohoku district, which is the approximate current distribution range of Th. The relatively uniform values of allelic richness, Ho and He, among the Th populations could be explained by this hypothesis. However, additional populations must be examined to fully understand the characteristics of Td.

4.3. Contributions of the Breeding Program for the Genus Thujopsis

Both varieties, Td and Th, are essential elements of natural forests in Japan, and logs from natural forests have historically been used for timber and other wooden materials. However, at present, Th is more important than Td in forestry. Plantations of Th are active mainly in Aomori, Niigata, and Ishikawa Prefectures (see Table 1) [10]. In Aomori, the demand for Th has recently increased. As a result, seed orchards were established in the beginning of 2003 [61]. In Niigata, plus trees on Sado Island were selected in 1989, and a seed orchard was established on Honshu island in 2009 [62]. Plantations in Ishikawa were established using rooted cuttings or saplings created by layering, and the majority of trees in these plantations are clones of 14 Th cutting/saplings [10]. In the Niigata and Ishikawa plantations, particular attention to interactions between natural populations through pollen flow and hybridization with Td is required. Th is found on Sado Island, and both Td and Th are distributed in the closest area on Honshu island (Figure 1). Similarly, the Suzu (SZ) population in Ishikawa, the present study site, is classified as Th; however, Td is distributed in neighboring areas. This study showed that these varieties are genetically different, and there is a risk that the seed orchard in Niigata may unintentionally produce seeds derived from hybridization between the variants. Furthermore, Th plantations in Ishikawa might risk introducing pollen of different variants into the surrounding natural Td forests. Since the breeding program of Th in Niigata and Ishikawa started relatively recently, the results of the present study could be useful for ongoing and future breeding programs, especially for the proper development and maintenance of seed orchards.
The results of the present study suggest that Td and Th can be distinguished by EST-SSR. As mentioned previously, distinguishing among varieties may be an important task in the future for breeding within the genus, Thujopsis. Several loci containing alleles with characteristic frequencies for Td and Th, respectively, were identified (Table A3). A combination of four loci, Tdest24, 39, 42, and 56, maintain a 100% bootstrap probability between varieties when constructing a neighbor-joining tree. Therefore, an analysis of these four loci is sufficient for the identification of the varieties.

5. Conclusions

Evidence from EST-SSR markers suggested that the two variants of the genus Thujopsis, Thujopsis dolabrata (L.f.) Siebold et Zucc. var. dolabrata (Td) and Thujopsis dolabrata (L.f.) Siebold et Zucc. var. hondae Makino (Th), were clearly distinct, as assessed using structure analysis and a neighbor-joining tree. Using these techniques, the two varieties could be defined by their provenance, in spite of the ambiguous morphological differences between them. The relatively uniform values of genetic diversity among the Th populations suggest that refugia of Th may have been scattered throughout the Tohoku district. On the other hand, there was a tendency for genetic diversity to decrease from central to southern Honshu island in Td. Structure analysis and the neighbor-joining tree suggested hybridization in the contact zone between the two varieties. More detailed studies of the genetic structure of Td will be needed in the future.

Author Contributions

Study design and funding acquisition, K.M. and K.T.; needle sampling and fieldwork, M.I., Y.H., K.M., and K.T.; molecular and data analyses, M.I., and Y.H.; writing—original draft preparation, M.I.; writing—review and editing, M.I., Y.H., K.M., and K.T.; supervision and project administration, K.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

We would like to express our deepest gratitude to Miyako Sato, who was the first to summarize the research for this paper and provide draft results. Our heartfelt appreciation goes to Satomi Akiyama, whose enormous experimental support and encouraging words were invaluable. We would like to thank Seishiro Taki for his assistance in the fieldwork and for compiling information on sampling locations. Permission to use photographs of Td and Th used in Figure A1 in Appendix A was provided by the Forestry and Forest Products Research Institute (FFPRI) Database of Japanese Woods (http://db.ffpri.affrc.go.jp/WoodDB/JWDB-E/home.php). We are also indebted to the anonymous reviewers, who gave us invaluable comments.

Conflicts of Interest

The authors indicated no conflicts of interest.

Appendix A

Forests 11 00935 g0a1 550
Figure A1. Typical morphology of (a) Thujopsis dolabrata (L.f.) Siebold et Zucc. var. dolabrata (Td) and (b) Thujopsis dolabrata (L.f.) Siebold et Zucc. var. hondae Makino (Th). Td (a) have horned cones, and Th (b) have denser needles and rounder cones. Photographs are cited from Forestry and Forest Products Research Institute (FFPRI) Database of Japanese Woods ((a) http://db.ffpri.affrc.go.jp/WoodDB/JWDB-E/detailA_coll.php?-action=browse&-recid=262420, and (b) http://db.ffpri.affrc.go.jp/WoodDB/JWDB-E/detailA_coll.php?-action=browse&-recid=265188).
Figure A1. Typical morphology of (a) Thujopsis dolabrata (L.f.) Siebold et Zucc. var. dolabrata (Td) and (b) Thujopsis dolabrata (L.f.) Siebold et Zucc. var. hondae Makino (Th). Td (a) have horned cones, and Th (b) have denser needles and rounder cones. Photographs are cited from Forestry and Forest Products Research Institute (FFPRI) Database of Japanese Woods ((a) http://db.ffpri.affrc.go.jp/WoodDB/JWDB-E/detailA_coll.php?-action=browse&-recid=262420, and (b) http://db.ffpri.affrc.go.jp/WoodDB/JWDB-E/detailA_coll.php?-action=browse&-recid=265188).
Forests 11 00935 g0a1
Forests 11 00935 g0a2 550
Figure A2. Relationships between pairwise genetic distances, FST/(1 − FST), and the geographic distance separating 22 Thujopsis populations.
Figure A2. Relationships between pairwise genetic distances, FST/(1 − FST), and the geographic distance separating 22 Thujopsis populations.
Forests 11 00935 g0a2
Forests 11 00935 g0a3 550
Figure A3. Relationships between the number of clusters (K) and the rate of the change in lnP(X|K) (Delta K), based on STRUCTURE analysis.
Figure A3. Relationships between the number of clusters (K) and the rate of the change in lnP(X|K) (Delta K), based on STRUCTURE analysis.
Forests 11 00935 g0a3
Table
Table A1. Characteristics of 19 EST-SSR loci for use in the genus Thujopsis.
Table A1. Characteristics of 19 EST-SSR loci for use in the genus Thujopsis.
LocusGroupRepeat Motif Primer Sequence (5′−3′)Allele Size Range (bp)
Tdest15(CT)11F:GCCTCCCTCGCGCCATCAG GATTTTCTGACAGGCTTTGTTCTC137–173
R:GTTTCTTAATTCCCAAGAGTGCTTATGAGTTC
Tdest31(AT)11F:GCCTCCCTCGCGCCATCAG CGGCCCAGGTTTCTGTACTC155–184
R:GTTTCTTGCCCATTAAAGTCGGGTATTG
Tdest113(AT)12F:GCCTCCCTCGCGCCATCAGTGGGATACATACTGCATTTGTTAGG136–161
R:GTTTCTTCTCCCCAAGCAAGTCACCAC
Tdest144(AG)12F:GCCTCCCTCGCGCCATCAGCAGTAGACAATTTCTGCAAATCACC152–190
R:GTTTCTTTCCCTTTTGTTGGCATTATAGG
Tdest173(AG)12F:GCCTCCCTCGCGCCATCAGGCTTTTGATGTCCGCTATATCCTC160–176
R:GTTTCTTGGAGATTCCAATGTTTGTCATGC
Tdest213(AG)13F:GCCTCCCTCGCGCCATCAGGTCCATCCATTCTCACTCCAAAG228–292
R:GTTTCTTAGCAGACCCTATTTCACAGCATC
Tdest244(AT)15F:GCCTCCCTCGCGCCATCAGATACCATACAGCTTTCAGCCAG239–266
R:GTTTCTTGCAGAACAAACGAATCAATGAGAG
Tdest293(AC)16F:GCCTCCCTCGCGCCATCAGAAACGACTCTGCTGGATTTCAC215–243
R:GTTTCTTTTCCGCTCTTGATTTTCTCTCC
Tdest352(CT)15F:GCCTCCCTCGCGCCATCAGAAGCTATTGACCCTTCTCAGGATAC191–227
R:GTTTCTTCCATGTTGAATTGTTCCCTTTC
Tdest375(ATC)9F:GCCTCCCTCGCGCCATCAGCCAAGCGACAGAAAACCATTC158–175
R:GTTTCTTTCAGTCTCTTCCTCCTCCTCCTC
Tdest381(ACC)9F:GCCTCCCTCGCGCCATCAGTGACCATTCCTCCTCCTCCTC114–137
R:GTTTCTTCATGTTTGCAGTTGAGAGAAGACC
Tdest391(GCT)9F:GCCTCCCTCGCGCCATCAGGCAGCACAGGAGAAGAAAGATG153–186
R:GTTTCTTACAACAGCCACAACGTGTCC
Tdest421(ACC)9F:GCCTCCCTCGCGCCATCAGCTCCCTATCCCAACACCAACAC225–258
R:GTTTCTTTGCCTACCTATCCTTCTTCTTCTCC
Tdest432(CGG)9F:GCCTCCCTCGCGCCATCAGGGTCCAATGCAGGTAATACAAGAAG134–167
R:GTTTCTTTCCCCGCCAAGATACTCAAC
Tdest455(GGT)12F:GCCTCCCTCGCGCCATCAGTGAGGGTGGTGAGACAATTC208–235
R:GTTTCTTCAAGATTTGGAACTCCTGCAAC
Tdest492(GAT)10F:GCCTCCCTCGCGCCATCAGGTGCCCTCAAAGTTACAGCAGTC221–248
R:GTTTCTTGCAATCACCTCATCCTCACTTC
Tdest534(CTT)13F:GCCTCCCTCGCGCCATCAGCCAAAGCCCTTCCAGTAACATC241–305
R:GTTTCTTGATGGAATGAGTGAATCTCAGGAAC
Tdset562(AAG)9F:GCCTCCCTCGCGCCATCAGCATTGCCCTTTGGAATATAGGATC142–167
R:GTTTCTTGTTGCCCATCTGCTCTTCTTC
Tdest584(AAG)13F:GCCTCCCTCGCGCCATCAGCTGAACGGCGCCCTAATCTC151–188
R:GTTTCTTGCCCACTCCTCAAATCCAAC
Groups of loci that were mixed when amplified PCR products of individuals were separated by capillary electrophoresis (Group).
Table
Table A2. Genetic diversity measures estimated at 19 microsatellite loci.
Table A2. Genetic diversity measures estimated at 19 microsatellite loci.
LocusTAHoHTFISFSTRSTGSTG’ST
Tdest1190.889 0.904 −0.037 *0.065 **0.097 **0.052 **0.380 **
Tdest3130.503 0.606 0.064 **0.135 **0.058 **0.113 **0.251 **
Tdest11140.789 0.873 0.032 **0.078 **0.289 **0.066 **0.371 **
Tdest14200.864 0.904 0.014 *0.037 **0.024 *0.031 **0.260 **
Tdest17100.624 0.781 0.054 **0.175 **0.069 **0.157 **0.474 **
Tdest21320.891 0.927 0.004 **0.041 **0.021 *0.035 **0.349 **
Tdest24160.710 0.767 0.023 **0.054 **0.205 **0.053 **0.199 **
Tdest2980.358 0.409 0.025 **0.118 **0.153 **0.101 **0.163 **
Tdest35320.852 0.935 0.040 **0.059 **0.095 **0.051 **0.470 **
Tdest3750.398 0.484 0.018 **0.207 **0.205 **0.164 **0.281 **
Tdest38100.655 0.692 −0.034 **0.108 **0.104 **0.085 **0.239 **
Tdest3970.456 0.490 −0.056 **0.143 **0.173 **0.118 **0.212 **
Tdest42130.565 0.732 0.031 **0.238 **0.054 **0.204 **0.502 **
Tdest43140.714 0.753 −0.011 **0.077 **0.121 **0.062 **0.218 **
Tdest4590.462 0.581 0.096 **0.144 **0.136 **0.120 **0.252 **
Tdest4980.228 0.272 0.051 **0.121 **0.125 **0.116 **0.155 **
Tdest53210.863 0.888 −0.025 **0.064 **0.099 **0.052 **0.342 **
Tdest5680.626 0.730 −0.010 **0.183 **0.082 **0.152 **0.411 **
Tdest58120.361 0.402 0.044 **0.065 **0.068 **0.060 **0.098 **
average14.3 0.621 0.691 0.014 **0.105 **0.096 **0.088 **0.246 **
Total number of detected alleles (TA); average observed heterozygosity (Ho); total gene diversity (HT); Wright’s inbreeding coefficient (FIS) and significant deviations from Hardy–Weinberg expectations were tested; Weir and Cockerham’s FST (FST); relative genetic differentiation among populations defined under the stepwise mutation model (RST); genetic differentiation coefficient (GST); standardized measure of relative genetic differentiation among populations (G’ST); *, p < 0.01; **, p < 0.001; p values indicate the significance of deviations of FIS, FST, RST, GST, and G’ST from zero, evaluated by permutation tests.
Table
Table A3. Recommended set of markers for distinguishing Td and Th and their allele characteristics.
Table A3. Recommended set of markers for distinguishing Td and Th and their allele characteristics.
Allele Frequencies across All Populations
LocusAllele SizeTdThTd/ThTh/Td
Tdest24N230379
2390.1520.00357.6 0.0
2420.0000.001
2430.0300.000
2450.2170.0902.4 0.4
2470.4240.4291.0 1.0
2490.0720.1100.7 1.5
2510.0570.1730.3 3.1
2530.0040.0740.1 17.0
2550.0020.0510.0 23.7
2560.0020.0080.3 3.6
2570.0260.0280.9 1.1
2590.0020.0030.8 1.2
2610.0090.0042.2 0.5
2630.0020.0220.1 10.3
2650.0000.004
2660.0000.001
Tdest39N230379
1530.9520.5751.7 0.6
1560.0000.001
1590.0390.2430.2 6.2
1620.0000.003
1650.0090.1700.1 19.6
1680.0000.003
1860.0000.005
Tdest42N230379
2250.0280.00121.4 0.0
2280.0000.003
2310.0040.0180.2 4.2
2340.0220.000
2370.0410.2150.2 5.2
2400.0150.00111.5 0.1
2430.4980.04211.8 0.1
2440.1020.000
2460.0480.6000.1 12.5
2490.1850.0623.0 0.3
2520.0070.0410.2 6.3
2550.0500.0077.6 0.1
2580.0000.009
Tdest56N230379
1420.0020.000
1470.0000.001
1520.3700.0804.6 0.2
1530.0110.000
1550.0220.4630.0 21.3
1610.4780.2302.1 0.5
1640.1170.2230.5 1.9
1670.0000.003
Sample size (N); T. dolabrata (L.f.) Siebold et Zucc. var. dolabrata (Td); Thujopsis dolabrata (L.f.) Siebold et Zucc. var. hondae Makino (Th); ratio of allele frequency, Td divided by Th (Td/Th); ratio of allele frequency, Th divided by Td (Th/Td).

References

  1. Neale, D.B.; Wheeler, N.C. The Conifers: Genomes, Variation and Evolution; Springer Science+Business Media: New York, NY, USA, 2019; ISBN 978-3-319-46806-8. [Google Scholar]
  2. Rice, K.J.; Emery, N.C. Managing microevolution: Restoration in the face of global change. Front. Ecol. Environ. 2003, 1, 469–478. [Google Scholar] [CrossRef]
  3. Grassi, F.; Labra, M.; Imazio, S.; Rubio, R.O.; Failla, O.; Scienza, A.; Sala, F. Phylogeographical structure and conservation genetics of wild grapevine. Conserv. Genet. 2006, 7, 837–845. [Google Scholar] [CrossRef]
  4. Matsumoto, A.; Uchida, K.; Taguchi, Y.; Tani, N.; Tsumura, Y. Genetic diversity and structure of natural fragmented Chamaecyparis obtusa populations as revealed by microsatellite markers. J. Plant Res. 2010, 123, 689–699. [Google Scholar] [CrossRef]
  5. Rajora, O.P.; Mosseler, A. Challenges and opportunities for conservation of forest genetic resources. Euphytica 2001, 118, 197–212. [Google Scholar] [CrossRef]
  6. Cavers, S.; Navarro, C.; Lowe, A.J. Targeting genetic resource conservation in widespread species: A case study of Cedrela odorata L. For. Ecol. Manag. 2004, 197, 285–294. [Google Scholar] [CrossRef]
  7. Yang, Z.Y.; Ran, J.H.; Wang, X.Q. Three genome-based phylogeny of Cupressaceae s.l.: Further evidence for the evolution of gymnosperms and southern hemisphere biogeography. Mol. Phylogenet. Evol. 2012, 64, 452–470. [Google Scholar] [CrossRef]
  8. Hayashi, Y. Taxonomical and Phytogeographical Study of Japanese Conifers; Norin Shuppan: Tokyo, Japan, 1960. (In Japanese) [Google Scholar]
  9. Kurata, S. Illustrated Important Forest Trees of Japan; Chikyu Shuppan Co., LTD: Tokyo, Japan, 1964. (In Japanese) [Google Scholar]
  10. Ikeda, T.; Tokuda, N.; Tomaru, N. Identification of Thujopsis dolabrata var. hondae clones and their distribution across plantations in Ishikawa Prefecture. J. For. Res. 2018, 23, 105–111. [Google Scholar] [CrossRef]
  11. Higuchi, Y.; Matsumoto, A.; Moriguchi, Y.; Mishima, K.; Tanaka, K.; Yada, Y.; Takata, K.; Watanabe, A.; Hirao, T.; Tsumura, Y.; et al. Genetic diversity and structure using microsatellite markers in natural and breeding populations of Thujopsis dolabrata var. hondae. J. Jpn. For. Soc. 2012, 94, 247–251. (In Japanese) [Google Scholar] [CrossRef] [Green Version]
  12. Ikeda, T.; Mishima, K.; Takata, K.; Tomaru, N. The origin and genetic variability of vegetatively propagated clones identified from old planted trees and plantations of Thujopsis dolabrata var. hondae in Ishikawa Prefecture, Japan. Tree Genet. Genomes 2019, 15, 80. [Google Scholar] [CrossRef]
  13. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [Green Version]
  14. Sato, M.; Hasegawa, Y.; Mishima, K.; Takata, K. Isolation and characterization of 22 EST-SSR markers for the Genus Thujopsis (Cupressaceae). Appl. Plant Sci. 2015, 3, 1400101. [Google Scholar] [CrossRef]
  15. Blacket, M.J.; Robin, C.; Good, R.T.; Lee, S.F.; Miller, A.D. Universal primers for fluorescent labelling of PCR fragments—An efficient and cost-effective approach to genotyping by fluorescence. Mol. Ecol. Resour. 2012, 12, 456–463. [Google Scholar] [CrossRef]
  16. Goudet, J. A Program to Estimate and Test Population Genetics Parameters. Available online: https://www2.unil.ch/popgen/softwares/fstat.htm (accessed on 25 May 2020).
  17. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Green Version]
  18. Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar]
  19. Slatkin, M. A measure of population subdivision based on microsatellite allele frequencies. Genetics 1995, 139, 457–462. [Google Scholar]
  20. Hardy, O.J.; Vekemans, X. SPAGeDi: A versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol. Ecol. Notes 2002, 2, 618–620. [Google Scholar] [CrossRef] [Green Version]
  21. Hedrick, P.W. A standardized genetic differentiation measure. Evolution 2005, 59, 1633–1638. [Google Scholar] [CrossRef]
  22. Meirmans, P.G.; Hedrick, P.W. Assessing population structure: FST and related measures. Mol. Ecol. Resour. 2011, 11, 5–18. [Google Scholar] [CrossRef]
  23. Piry, S.; Luikart, G.; Cornuet, J.M. BOTTLENECK: A computer program for detecting recent reductions in the effective size using allele frequency data. J. Hered. 1999, 90, 502–503. [Google Scholar] [CrossRef]
  24. Rousset, F. Genetic differentiation and estimation of gene flow from F-statistics under isolation by distance. Genetics 1997, 145, 1219–1228. [Google Scholar]
  25. Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
  26. Goudet, J. HierFstat, a package for r to compute and test hierarchical F-statistics. Mol. Ecol. Notes 2005, 5, 184–186. [Google Scholar] [CrossRef] [Green Version]
  27. De Meeûs, T.; Goudet, J. A step-by-step tutorial to use HierFstat to analyse populations hierarchically structured at multiple levels. Infect. Genet. Evol. 2007, 7, 731–735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2019. [Google Scholar]
  29. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [PubMed]
  30. Takezaki, N.; Nei, M.; Tamura, K. POPTREE2: Software for constructing population trees from allele frequency data and computing other population statistics with windows interface. Mol. Biol. Evol. 2010, 27, 747–752. [Google Scholar] [CrossRef] [Green Version]
  31. Takezaki, N.; Nei, M.; Tamura, K. POPTREE2_web. Available online: http://www.kms.ac.jp/~genomelb/takezaki/poptree2/poptree2_web.html (accessed on 12 June 2020).
  32. Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. II. Gene frequency data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef]
  33. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar]
  34. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Green Version]
  35. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. CLUMPAK: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [Green Version]
  36. Sakaguchi, S.; Takeuchi, Y.; Yamasaki, M.; Sakurai, S.; Isagi, Y. Lineage admixture during postglacial range expansion is responsible for the increased gene diversity of Kalopanax septemlobus in a recently colonised territory. Heredity 2011, 107, 338–348. [Google Scholar] [CrossRef] [Green Version]
  37. Ding, M.; Meng, K.; Fan, Q.; Tan, W.; Liao, W.; Chen, S. Development and validation of EST-SSR markers for Fokienia hodginsii (Cupressaceae). Appl. Plant Sci. 2017, 5, 1600152. [Google Scholar] [CrossRef] [PubMed]
  38. Huang, C.J.; Chu, F.H.; Liu, S.C.; Tseng, Y.H.; Huang, Y.S.; Ma, L.T.; Wang, C.T.; You, Y.T.; Hsu, S.Y.; Hsieh, H.C.; et al. Isolation and characterization of SSR and EST-SSR loci in Chamaecyparis formosensis (Cupressaceae). Appl. Plant Sci. 2018, 6, e01175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Leigh, F.; Lea, V.; Law, J.; Wolters, P.; Powell, W.; Donini, P. Assessment of EST- and genomic microsatellite markers for variety discrimination and genetic diversity studies in wheat. Euphytica 2003, 133, 359–366. [Google Scholar] [CrossRef]
  40. Kalia, R.K.; Rai, M.K.; Kalia, S.; Singh, R.; Dhawan, A.K. Microsatellite markers: An overview of the recent progress in plants. Euphytica 2011, 177, 309–334. [Google Scholar] [CrossRef]
  41. Takahashi, T.; Tani, N.; Taira, H.; Tsumura, Y. Microsatellite markers reveal high allelic variation in natural populations of Cryptomeria japonica near refugial areas of the last glacial period. J. Plant Res. 2005, 118, 83–90. [Google Scholar] [CrossRef] [PubMed]
  42. Iwaizumi, M.G.; Takahashi, M.; Isoda, K.; Austerlitz, F. Consecutive five-year analysis of paternal and maternal gene flow and contributions of gametic heterogeneities to overall genetic composition of dispersed seeds of Pinus densiflora (Pinaceae). Am. J. Bot. 2013, 100, 1896–1904. [Google Scholar] [CrossRef]
  43. Katsuki, T.; Shimada, K.; Yoshimaru, H. Process to extinction and genetic structure of a threatened Japanese conifer species, Picea koyamae. J. For. Res. 2011, 16, 292–301. [Google Scholar] [CrossRef]
  44. Aizawa, M.; Yoshimaru, H.; Katsuki, T.; Kaji, M. Imprint of post-glacial history in a narrowly distributed endemic spruce, Picea alcoquiana, in central Japan observed in nuclear microsatellites and organelle DNA markers. J. Biogeogr. 2008, 35, 1295–1307. [Google Scholar] [CrossRef]
  45. Aizawa, M.; Yoshimaru, H.; Saito, H.; Katsuki, T.; Kawahara, T.; Kitamura, K.; Shi, F.; Sabirov, R.; Kaji, M. Range-wide genetic structure in a north-east Asian spruce (Picea jezoensis) determined using nuclear microsatellite markers. J. Biogeogr. 2009, 36, 996–1007. [Google Scholar] [CrossRef]
  46. Iwaizumi, M.G.; Tsuda, Y.; Ohtani, M.; Tsumura, Y.; Takahashi, M. Recent distribution changes affect geographic clines in genetic diversity and structure of Pinus densiflora natural populations in Japan. For. Ecol. Manag. 2013, 304, 407–416. [Google Scholar] [CrossRef]
  47. Kawase, D.; Tsumura, Y.; Tomaru, N.; Seo, A.; Yumoto, T. Genetic structure of an endemic Japanese conifer, Sciadopitys verticillata (Sciadopityaceae), by using microsatellite markers. J. Hered. 2010, 101, 292–297. [Google Scholar] [CrossRef] [Green Version]
  48. Suyama, Y.; Tsumura, Y.; Ohba, K. A cline of allozyme variation in Abies mariesii. J. Plant Res. 1997, 110, 219–226. [Google Scholar] [CrossRef]
  49. Tani, N.; Tomaru, N.; Araki, M.; Ohba, K. Genetic diversity and differentiation in populations of Japanese stone pine (Pinus pumila) in Japan. Can. J. For. Res. 1996, 26, 1454–1462. [Google Scholar] [CrossRef]
  50. Hamrick, J.L.; Godt, M.J.W.; Sherman-Broyles, S.L. Factors influencing levels of genetic diversity in woody plant species. New For. 1992, 6, 95–124. [Google Scholar] [CrossRef]
  51. Hewitt, G.M. Post-glacial re-colonization of European biota. Biol. J. Linn. Soc. 1999, 68, 87–112. [Google Scholar] [CrossRef]
  52. Baucom, R.S.; Estill, J.C.; Cruzan, M.B. The effect of deforestation on the genetic diversity and structure in Acer saccharum (Marsh): Evidence for the loss and restructuring of genetic variation in a natural system. Conserv. Genet. 2005, 6, 39–50. [Google Scholar] [CrossRef]
  53. O’Connell, L.M.; Mosseler, A.; Rajora, O.P. Impacts of forest fragmentation on the mating system and genetic diversity of white spruce (Picea glauca) at the landscape level. Heredity 2006, 97, 418–426. [Google Scholar] [CrossRef] [Green Version]
  54. Fady, B.; Lefèvre, F.; Vendramin, G.G.; Ambert, A.; Régnier, C.; Bariteau, M. Genetic consequences of past climate and human impact on eastern Mediterranean Cedrus libani forests. Implications for their conservation. Conserv. Genet. 2008, 9, 85–95. [Google Scholar] [CrossRef]
  55. Tsukada, M. The history of Cryptomeria japonica (sugi): The last 15000 years. Kagaku Sci. 1980, 50, 538–546. (In Japanese) [Google Scholar]
  56. Hiraoka, K.; Tomaru, N. Genetic divergence in nuclear genomes between populations of Fagus crenata along the Japan Sea and Pacific sides of Japan. J. Plant Res. 2009, 122, 269–282. [Google Scholar] [CrossRef]
  57. Hu, F.S.; Hampe, A.; Petit, R.J. Paleoecology meets genetics: Deciphering past vegetational dynamics. Front. Ecol. Environ. 2009, 7, 371–379. [Google Scholar] [CrossRef] [Green Version]
  58. Kimura, M.K.; Uchiyama, K.; Nakao, K.; Moriguchi, Y.; Jose-Maldia, L.S.; Tsumura, Y. Evidence for cryptic northern refugia in the last glacial period in Criptomeria japonica. Ann. Bot. 2014, 114, 1687–1700. [Google Scholar] [CrossRef] [Green Version]
  59. Tsuda, Y.; Ide, Y. Wide-range analysis of genetic structure of Betula maximowicziana, a long-lived pioneer tree species and noble hardwood in the cool temperate zone of Japan. Mol. Ecol. 2005, 14, 3929–3941. [Google Scholar] [CrossRef]
  60. Aoyama, T. The properties of cold environment for Thujopsis dolabrata var. hondai and Criptomeria japonica in the northeastern Japan. Q. J. Geogr. 1995, 47, 91–102. (In Japanese) [Google Scholar] [CrossRef] [Green Version]
  61. Tanaka, K. Forest tree breeding project in Aomori Prefecture to promote excellent seeds and seedlings. For. Genet. Tree Breed. 2013, 2, 139–141. (In Japanese) [Google Scholar]
  62. Higuchi, Y.; Itou, S. Test on breeding of Hiba plus trees (I) seed production characteristics of Hiba plus trees selected from Sado Island. Bull. Niigata Prefect. For. Res. Inst. 2012, 53, 1–6. (In Japanese) [Google Scholar]
Forests 11 00935 g001 550
Figure 1. (a) Classical distribution range of genus Thujopsis defined by morphological differences between varieties shown in Kurata [9], var. dolabrata (Td, black dots) and var. hondae (Th, white dots). (b) Locations of the 22 sampled populations. Numbers correspond to the population numbers in Table 1.
Figure 1. (a) Classical distribution range of genus Thujopsis defined by morphological differences between varieties shown in Kurata [9], var. dolabrata (Td, black dots) and var. hondae (Th, white dots). (b) Locations of the 22 sampled populations. Numbers correspond to the population numbers in Table 1.
Forests 11 00935 g001
Forests 11 00935 g002 550
Figure 2. Neighbor-joining tree based on the Da distance of the 22 populations. The populations from No. 1 to 16 represent var. hondae (Th), whereas the populations from No. 17 to 22 represent var. dolabrata (Td).
Figure 2. Neighbor-joining tree based on the Da distance of the 22 populations. The populations from No. 1 to 16 represent var. hondae (Th), whereas the populations from No. 17 to 22 represent var. dolabrata (Td).
Forests 11 00935 g002
Forests 11 00935 g003 550
Figure 3. The proportions of cluster memberships at the individual level in the 22 genus Thujopsis populations based on STRUCTURE software analysis. Populations are represented from the left (southern populations) to the right (northern populations).
Figure 3. The proportions of cluster memberships at the individual level in the 22 genus Thujopsis populations based on STRUCTURE software analysis. Populations are represented from the left (southern populations) to the right (northern populations).
Forests 11 00935 g003
Table
Table 1. Locations of Thujopsis dolabrata. Populations 1 to 16 fall within the range of var. hondae and 17 to 22 fall within var. dolabrata.
Table 1. Locations of Thujopsis dolabrata. Populations 1 to 16 fall within the range of var. hondae and 17 to 22 fall within var. dolabrata.
NoPop NamePop CodePrefectureDistribution RegionLatitude/LongitudeN
1MinamidateMDHokkaidovar. hondae41.870072,140.28339415
2TodogawaTGHokkaidovar. hondae41.823216,140.20833423
3OkoppeOKAomorivar. hondae41.478333,140.95277827
4OhataOHAomorivar. hondae41.386911,141.04866630
5HigashidoriHDAomorivar. hondae41.085490,141.31499030
6NakazatoNZAomorivar. hondae40.987595,140.45685031
7AjigasawaASAomorivar. hondae40.677765,140.18435412
8ChoubousanCBAomorivar. hondae40.903131,140.60556515
9JunikoJNAomorivar. hondae40.558209,139.96421630
10OwaniOWAomorivar. hondae40.448351,140.59062522
11OmyoujinOMIwatevar. hondae39.654310,140.89656129
12HayachineHCIwatevar. hondae39.582572,141.48126824
13GoyousanGYIwatevar. hondae39.207849,141.71618724
14KaminoyamaKMYamagatavar. hondae38.083196,140.30477319
15SadoSDNiigatavar. hondae38.215756,138.45188031
16SuzuSZIshikawavar. hondae37.402306,137.16502817
17MinakamiMKGunmavar. dolabrata36.839137,138.97269535
18NikkoNKTochigivar. dolabrata36.822614,139.44034248
19KisoKSNaganovar. dolabrata35.727433,137.62093432
20KuraiyamaKRGifuvar. dolabrata35.985774,137.21663835
21Toyo-okaTOHyougovar. dolabrata35.509750,134.63719044
22ObitaniOBTokushimavar. dolabrata33.844595,134.32793336
Population numbers (No); sample size of each population (N).
Table
Table 2. Genetic diversity measures estimated at 19 microsatellite loci.
Table 2. Genetic diversity measures estimated at 19 microsatellite loci.
VarietyNoPop CodeNAllele NumberAllelic RichnessPrivate AlleleHoHeFIS
Th1MD156.30 5.86 10.646 0.639 0.025
2TG236.70 5.54 10.593 0.623 0.071
3OK277.50 5.97 20.673 0.662 0.002
4OH308.00 6.02 10.628 0.664 0.071
5HD307.80 5.93 20.646 0.641 0.010
6NZ318.70 6.55 00.689 0.682 0.005
7AS125.80 5.84 30.746 0.646 −0.112
8CB156.50 6.12 00.662 0.660 0.032
9JN307.80 6.08 30.681 0.664 −0.009
10OW226.80 5.76 10.624 0.636 0.042
11OM297.90 6.13 40.679 0.663 −0.006
12HC246.80 5.56 10.618 0.603 −0.004
13GY247.60 6.19 00.672 0.651 −0.012
14KM196.70 5.87 30.637 0.624 0.006
15SD317.30 5.67 00.637 0.623 −0.005
16SZ176.50 5.74 10.573 0.587 0.054
Average 7.175.931.40.6500.642
Td17MK357.20 5.61 10.609 0.611 0.018
18NK487.30 5.24 50.554 0.584 0.062
19KS326.40 5.15 10.554 0.561 0.027
20KR356.20 4.70 20.496 0.500 0.022
21TO445.90 4.68 10.542 0.548 0.023
22OB365.50 4.20 10.513 0.504 −0.005
Average 6.42 4.93 1.8 0.545 0.551
Thujopsis dolabrata (L.f.) Siebold et Zucc. var. hondae Makino (Th); T. dolabrata (L.f.) Siebold et Zucc. var. dolabrata (Td); population numbers (No); sample size of each population (N); number of alleles per locus (allele number); allelic richness for standardized samples of 24 gene copies (allelic richness); number of private alleles per population (private allele); average observed heterozygosity (Ho); average expected heterozygosity (He); fixation index (FIS).
Table
Table 3. Hierarchical analysis of genetic structure using analysis of molecular variance (AMOVA) and hierarchical F statistics.
Table 3. Hierarchical analysis of genetic structure using analysis of molecular variance (AMOVA) and hierarchical F statistics.
AMOVAHierarchical F Statistics
Source of VariationVariance ComponentsPercentage of Variation F95% CI
Among Region0.6068.80 *FRegion/Total0.088 *0.050–0.136
Among Pop0.3935.71 *FPop/Region0.062 *0.049–0.079
Within Pop5.88985.49 *FInd/Pop0.018 ns0.004–0.035
* p < 0.001.

Share and Cite

MDPI and ACS Style

Inanaga, M.; Hasegawa, Y.; Mishima, K.; Takata, K. Genetic Diversity and Structure of Japanese Endemic Genus Thujopsis (Cupressaceae) Using EST-SSR Markers. Forests 2020, 11, 935. https://doi.org/10.3390/f11090935

AMA Style

Inanaga M, Hasegawa Y, Mishima K, Takata K. Genetic Diversity and Structure of Japanese Endemic Genus Thujopsis (Cupressaceae) Using EST-SSR Markers. Forests. 2020; 11(9):935. https://doi.org/10.3390/f11090935

Chicago/Turabian Style

Inanaga, Michiko, Yoichi Hasegawa, Kentaro Mishima, and Katsuhiko Takata. 2020. "Genetic Diversity and Structure of Japanese Endemic Genus Thujopsis (Cupressaceae) Using EST-SSR Markers" Forests 11, no. 9: 935. https://doi.org/10.3390/f11090935

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop