De Novo Transcriptome Analysis of Dalbergia odorifera T. Chen (Fabaceae) and Transferability of SSR Markers Developed from the Transcriptome
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Preparation
2.2. Transcriptome Sequencing, Assembly and Annotation
2.3. SSR Identification and Marker Development
2.4. SSR Marker Validation, Transferability, and PCR Conditions
2.5. Analysis of Marker Polymorphism and Dalbergia Genetic Relationship
3. Results
3.1. Transcriptome Assembly and Annotation
3.2. Frequency and Distribution of SSRs in D. odorifera Transcriptome
3.3. Development and Transferability of Polymorphic SSR Markers
3.4. SSR Polymorphism and Phylogenetic Analysis of the Three Dalbergia Species
4. Discussion
4.1. Transcriptome Sequencing, De Novo Assembly, and Annotation for D. odorifera
4.2. SSR Prediction, Validation, and Application
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Institute of Botany, Chinese Academy of Sciences. Flora of China, 1st ed.; Science Press: Beijing, China, 1994; Volume 40, p. 98. [Google Scholar]
- So, T.; Dell, B. Conservation and utilization of threatened hardwood species through reforestation—An example of (Kruz.) craib and Pierre in Cambodia. Pac. Conserv Biol. 2010, 16, 101–116. [Google Scholar] [CrossRef]
- Dalbergia cochinchinensis. The IUCN Red List of Threatened Species 1998:e.T32625A9719096. Available online: http://dx.doi.org/10.2305/IUCN.UK.1998.RLTS.T32625A9719096.en (accessed on 9 December 2018).
- Dalbergia odorifera. The IUCN Red List of Threatened Species 1998:e.T32398A9698077. Available online: http://dx.doi.org/10.2305/IUCN.UK.1998.RLTS.T32398A9698077.en (accessed on 9 December 2018).
- Dalbergia tonkinensis. The IUCN Red List of Threatened Species 1998:e.T32819A9732061. Available online: http://dx.doi.org/10.2305/IUCN.UK.1998.RLTS.T32819A9732061.en (accessed on 9 December 2018).
- Hartvig, I.; So, T.; Changtragoon, S.; Tran, H.T.; Bouamanivong, S.; Theilade, I.; Kjaer, E.D.; Nielsen, L.R. Population genetic structure of the endemic rosewoods Dalbergia cochinchinensis and D. oliveri at a regional scale reflects the Indochinese landscape and life-history traits. Ecol. Evol. 2018, 8, 530–545. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.X.; Feng, J.D.; Wei, J.H.; Li, R.T.; He, M.J. Genetic diversity of China’s endangered medicinal plant Dalbergia odorifera. World Sci. Technol. Mod. Tradit. Chin. Med. Mater. Med. 2007, 9, 73–79. Available online: http://kns.cnki.net/KCMS/detail/detail.aspx?dbcode=CJFQ&dbname=CJFD2007&filename=SJKX200702016&v=MTgxNzJGeUhuVmJ2TE5pZkFkckc0SHRiTXJZOUVZb1I4ZVgxTHV4WVM3RGgxVDNxVHJXTTFGckNVUkxLZVplZHE= (accessed on 20 June 2018).
- Sanabam, R.; Singh, N.S.; Sahoo, D.; Devi, H.S. Genetic relationship of rough lemon landraces and under-utilised citrus genotypes from North-East India revealed by SSR and RAPD markers. Trees 2018, 32, 1043–1059. [Google Scholar] [CrossRef]
- Vu Thi Thu, H. Genetic diversity among endangered rare Dalbergia cochinchinensis (Fabaceae) genotypes in Vietnam revealed by random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) markers. Afr. J. Biotechnol. 2012, 11. [Google Scholar] [CrossRef]
- Mohammad-Panah, N.; Shabanian, N.; Khadivi, A.; Rahmani, M.-S.; Emami, A. Genetic structure of gall oak (Quercus infectoria) characterized by nuclear and chloroplast SSR markers. Tree Genet. Genomes 2017, 13. [Google Scholar] [CrossRef]
- Chhajer, S.; Jukanti, A.K.; Bhatt, R.K.; Kalia, R.K. Genetic diversity studies in endangered desert teak [Tecomella undulata (Sm) Seem] using arbitrary (RAPD), semi-arbitrary (ISSR) and sequence based (nuclear rDNA) markers. Trees 2018, 32, 1083–1101. [Google Scholar] [CrossRef]
- Nybom, H. Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plants. Mol. Ecol. 2004, 13, 1143–1155. [Google Scholar] [CrossRef]
- Yang, Y.; Meng, H.; Wu, Y.; Chen, B.; Gan, B.C. Primer Screening of SRAP Molecular Marker in Dalbergia odorifera. Acta Agric. Jiangxi 2011, 23, 29–31. [Google Scholar] [CrossRef]
- Alexander, L.W.; Thammina, C.S.; Kramer, M. Cross-transferability of SSR markers in Osmanthus. Genet. Resour. Crop Evol. 2018, 65, 125–136. [Google Scholar] [CrossRef]
- Liu, S.; An, Y.; Li, F.; Li, S.; Liu, L.; Zhou, Q.; Zhao, S.; Wei, C. Genome-wide identification of simple sequence repeats and development of polymorphic SSR markers for genetic studies in tea plant (Camellia sinensis). Mol. Breed. 2018, 38, 59. [Google Scholar] [CrossRef]
- Göl, Ş.; Göktay, M.; Allmer, J.; Doğanlar, S.; Frary, A. Newly developed SSR markers reveal genetic diversity and geographical clustering in spinach (Spinacia oleracea). Mol. Genet. Genom. 2017, 292, 847–855. [Google Scholar] [CrossRef] [PubMed]
- Onoue, N.; Kobayashi, S.; Kono, A.; Sato, A. SSR-based molecular profiling of 237 persimmon (Diospyros kaki Thunb.) germplasms using an ASTRINGENCY-linked marker. Tree Genet. Genomes 2018, 14, 28. [Google Scholar] [CrossRef]
- Taheri, S.; Lee Abdullah, T.; Yusop, M.; Hanafi, M.; Sahebi, M.; Azizi, P.; Shamshiri, R. Mining and development of novel SSR markers using next generation sequencing (NGS) data in plants. Molecules 2018, 23, 399. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zheng, Y.-Q.; Ding, H.-M.; Li, H.-P.; Peng, H.-Z.; Jiang, B.; Li, H.-B. Development and validation of SSR markers based on transcriptome sequencing of Casuarina equisetifolia. Trees 2017, 32, 41–49. [Google Scholar] [CrossRef]
- Dervishi, A.; Jakše, J.; Ismaili, H.; Javornik, B.; Štajner, N. Comparative assessment of genetic diversity in Albanian olive (Olea europaea L.) using SSRs from anonymous and transcribed genomic regions. Tree Genet. Genomes 2018, 14. [Google Scholar] [CrossRef]
- Dong, M.; Wang, Z.; He, Q.; Zhao, J.; Fan, Z.; Zhang, J. Development of EST-SSR markers in Larix principis-rupprechtii Mayr and evaluation of their polymorphism and cross-species amplification. Trees 2018, 32, 1559–1571. [Google Scholar] [CrossRef]
- Zhai, S.H.; Yin, G.S.; Yang, X.H. Population Genetics of the Endangered and Wild Edible Plant Ottelia acuminata in Southwestern China Using Novel SSR Markers. Biochem. Genet. 2018, 56, 235–254. [Google Scholar] [CrossRef]
- Vu, D.-D.; Bui, T.T.-X.; Nguyen, M.-D.; Shah, S.N.M.; Vu, D.-G.; Zhang, Y.; Nguyen, M.-T.; Huang, X.-H. Genetic diversity and conservation of two threatened dipterocarps (Dipterocarpaceae) in southeast Vietnam. J. For. Res. 2018, 1–9. [Google Scholar] [CrossRef]
- Yan, L.-P.; Liu, C.-L.; Wu, D.-J.; Li, L.; Shu, J.; Sun, C.; Xia, Y.; Zhao, L.-J. De novo transcriptome analysis of Fraxinus velutina using Illumina platform and development of EST-SSR markers. Biol. Plant. 2017, 61, 210–218. [Google Scholar] [CrossRef]
- Chen, L.-Y.; Cao, Y.-N.; Yuan, N.; Nakamura, K.; Wang, G.-M.; Qiu, Y.-X. Characterization of transcriptome and development of novel EST-SSR makers based on next-generation sequencing technology in Neolitsea sericea (Lauraceae) endemic to East Asian land-bridge islands. Mol. Breed. 2015, 35, 187. [Google Scholar] [CrossRef]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644. Available online: https://www.nature.com/articles/nbt.1883 (accessed on 28 June 2018). [CrossRef] [PubMed]
- Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 2013, 8, 1494–1512. Available online: https://www.nature.com/articles/nprot.2013.084 (accessed on 28 June 2018). [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Popgene. version 1.32. the User-Friendly Shareware for Population Genetic Analysismolecular Biology and Biotechnology Center, University of AlbertaEdmonton. Available online: http://www.ualberta.ca/~fyeh (accessed on 23 November 2017).
- Powell, W.; Morgante, M.; Andre, C.; Hanafey, M.; Vogel, J.; Tingey, S.; Rafalski, A. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 1996, 2, 225–238. [Google Scholar] [CrossRef]
- Rohlf, F.J. NTSYS-pc: Microcomputer programs for numerical taxonomy and multivariate analysis. Am. Stat. 1987, 41, 330. Available online: https://www.jstor.org/stable/2684761 (accessed on 28 June 2018). [CrossRef]
- Moritsuka, E.; Chhang, P.; Tagane, S.; Toyama, H.; Sokh, H.; Yahara, T.; Tachida, H. Genetic variation and population structure of a threatened timber tree Dalbergia cochinchinensis in Cambodia. Tree Genet. Genomes 2017, 13. [Google Scholar] [CrossRef]
- Wariss, H.M.; Yi, T.-S.; Wang, H.; Zhang, R. Characterization of the complete chloroplast genome of Dalbergia odorifera (Leguminosae), a rare and critically endangered legume endemic to China. Conserv. Genet. Resour. 2018, 10, 527–530. [Google Scholar] [CrossRef]
- Deng, C.-Y.; Xin, G.-L.; Zhang, J.-Q.; Zhao, D.-M. Characterization of the complete chloroplast genome of Dalbergia hainanensis (Leguminosae), a vulnerably endangered legume endemic to China. Conserv. Genet. Resour. 2018. [Google Scholar] [CrossRef]
- Li, N.N.; Yue, C.; Cao, H.L.; Qian, W.J.; Hao, X.Y.; Wang, Y.C.; Wang, L.; Ding, C.Q.; Wang, X.C.; Yang, Y.J. Transcriptome sequencing dissection of the mechanisms underlying differential cold sensitivity in young and mature leaves of the tea plant (Camellia sinensis). J. Plant Physiol. 2018, 224–225, 144–155. [Google Scholar] [CrossRef] [PubMed]
- Dai, F.; Tang, C.; Wang, Z.; Luo, G.; He, L.; Yao, L. De novo assembly, gene annotation, and marker development of mulberry (Morus atropurpurea) transcriptome. Tree Genet. Genomes 2015, 11, 26. [Google Scholar] [CrossRef]
- Huang, J.; Lu, X.; Yan, H.; Chen, S.; Zhang, W.; Huang, R.; Zheng, Y. Transcriptome characterization and sequencing-based identification of salt-responsive genes in Millettia pinnata, a semi-mangrove plant. DNA Res. 2012, 19, 195–207. [Google Scholar] [CrossRef] [PubMed]
- An, M.; Deng, M.; Zheng, S.-S.; Song, Y.-G. De novo transcriptome assembly and development of SSR markers of oaks Quercus austrocochinchinensis and Q. kerrii (Fagaceae). Tree Genet. Genomes 2016, 12. [Google Scholar] [CrossRef]
- Sato, S.; Nakamura, Y.; Kaneko, T.; Asamizu, E.; Kato, T.; Nakao, M.; Sasamoto, S.; Watanabe, A.; Ono, A.; Kawashima, K.; et al. Genome structure of the legume, Lotus japonicus. DNA Res. 2008, 15, 227–239. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.Y.; Lee, S.; Van, K.; Kim, T.H.; Jeong, S.C.; Choi, I.Y.; Kim, D.S.; Lee, Y.S.; Park, D.; Ma, J.; et al. Whole-genome sequencing and intensive analysis of the undomesticated soybean (Glycine soja Sieb. and Zucc.) genome. Proc. Natl. Acad. Sci. USA 2010, 107, 22032–22037. [Google Scholar] [CrossRef] [PubMed]
- Torales, S.L.; Rivarola, M.; Pomponio, M.F.; Gonzalez, S.; Acuña, C.V.; Fernández, P.; Lauenstein, D.L.; Verga, A.R.; Hopp, H.E.; Paniego, N.B.; et al. De novo assembly and characterization of leaf transcriptome for the development of functional molecular markers of the extremophile multipurpose tree species Prosopis alba. BMC Genom. 2013, 14, 705. [Google Scholar] [CrossRef]
- Huang, J.; Guo, X.; Hao, X.; Zhang, W.; Chen, S.; Huang, R.; Gresshoff, P.M.; Zheng, Y. De novo sequencing and characterization of seed transcriptome of the tree legume Millettia pinnata for gene discovery and SSR marker development. Mol. Breed. 2016, 36, 75. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S.; Sato, Y.; Furumichi, M.; Tanabe, M. KEGG for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res. 2012, 40, D109–D114. [Google Scholar] [CrossRef]
- Sathyanarayana, N.; Pittala, R.K.; Tripathi, P.K.; Chopra, R.; Singh, H.R.; Belamkar, V.; Bhardwaj, P.K.; Doyle, J.J.; Egan, A.N. Transcriptomic resources for the medicinal legume Mucuna pruriens: De novo transcriptome assembly, annotation, identification and validation of EST-SSR markers. BMC Genom. 2017, 18, 409. [Google Scholar] [CrossRef]
- Liu, S.; Liu, H.; Wu, A.; Hou, Y.; An, Y.; Wei, C. Construction of fingerprinting for tea plant (Camellia sinensis) accessions using new genomic SSR markers. Mol. Breed. 2017, 37, 93. [Google Scholar] [CrossRef]
- Guo, Q.; Wang, J.-X.; Su, L.-Z.; Lv, W.; Sun, Y.-H.; Li, Y. Development and evaluation of a novel set of EST-SSR markers based on transcriptome sequences of Black Locust (Robinia pseudoacacia L.). Genes 2017, 8, 177. Available online: https://www.mdpi.com/2073-4425/8/7/177 (accessed on 28 June 2018). [CrossRef] [PubMed]
- Barboza, K.; Beretta, V.; Kozub, P.C.; Salinas, C.; Morgenfeld, M.M.; Galmarini, C.R.; Cavagnaro, P.F. Microsatellite analysis and marker development in garlic: Distribution in EST sequence, genetic diversity analysis, and marker transferability across Alliaceae. Mol. Genet. Genom. 2018, 293, 1091–1106. [Google Scholar] [CrossRef]
- Yan, Z.; Wu, F.; Luo, K.; Zhao, Y.; Yan, Q.; Zhang, Y.; Wang, Y.; Zhang, J. Cross-species transferability of EST-SSR markers developed from the transcriptome of Melilotus and their application to population genetics research. Sci. Rep. 2017, 7, 17959. [Google Scholar] [CrossRef] [PubMed]
- Väli, Ü.; Einarsson, A.; Waits, L.; Ellegren, H. To what extent do microsatellite markers reflect genome-wide genetic diversity in natural populations? Mol. Ecol. 2008, 17, 3808–3817. [Google Scholar] [CrossRef] [PubMed]
Species | Code | location | Size | Latitude (N) | Longitude (E) | Altitude (m) |
---|---|---|---|---|---|---|
D. odorifera | H1-H20 | Hainan Island, China | 20 | 18°40′–20°32′ | 108°37′–110°45′ | 5–250 |
D. tonkinensis | 1-20 | Vietnam | 20 | 13°49′–21°52′ | 104°55′–108°07′ | 8–324 |
D. cochinchinensis | J1-J20 | Thailand | 20 | 13°41′–16°49′ | 100°16′–102°49′ | 7–280 |
Sample | Raw Reads | Clean Reads | Clean Bases | Error (%) | Q20 (%) | Q30 (%) | GC (%) |
---|---|---|---|---|---|---|---|
DO27 | 42,267,758 | 40,896,098 | 6.13G | 0.01 | 97.46 | 93.94 | 45.09 |
DO98 | 45,415,150 | 43,885,716 | 6.58G | 0.01 | 98.07 | 95.26 | 45.01 |
DO100 | 55,666,026 | 53,734,604 | 8.06G | 0.01 | 97.86 | 94.9 | 44.72 |
Repeat Motif (Sum) | No. of Repeats | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | >12 | Total | |
Mono-nucleotide (21623) | ||||||||||
A/T | - | - | - | - | - | 6114 | 3554 | 2773 | 8486 | 20,927 |
C/G | - | - | - | - | - | 6114 | 3554 | 2773 | 380 | 696 |
Di-nucleotide (7612) | ||||||||||
AG/CT | - | 883 | 733 | 757 | 903 | 585 | 112 | 1 | - | 3974 |
AT/AT | - | 486 | 345 | 359 | 417 | 287 | 53 | - | 1947 | |
AC/GT | - | 528 | 359 | 285 | 242 | 191 | 66 | 4 | - | 1675 |
CG/CG | - | 11 | 4 | 1 | - | 16 | ||||
Tri-nucleotide (6112) | ||||||||||
AAG/CTT | 733 | 469 | 212 | 4 | - | 1 | - | - | - | 1419 |
AAT/ATT | 558 | 379 | 172 | 6 | 1 | - | - | - | - | 1116 |
AAC/GTT | 472 | 263 | 128 | 3 | - | - | - | 1 | - | 867 |
ATC/ATG | 413 | 209 | 100 | 4 | - | - | - | - | 1 | 727 |
Others | 1173 | 547 | 245 | 16 | - | 1 | - | 1 | - | 1983 |
Tetra-nucleotide (373) | ||||||||||
AAAT/ATTT | 94 | 4 | - | - | 1 | - | - | - | - | 99 |
AAAG/CTTT | 50 | 4 | - | - | - | - | - | - | - | 54 |
AAGG/CCTT | 27 | 1 | - | - | - | - | - | - | - | 28 |
AATG/ATTC | 18 | 3 | - | - | - | - | - | - | - | 21 |
Others | 143 | 27 | - | 1 | - | - | - | - | - | 171 |
Penta-nucleotide (40) | ||||||||||
AAAAG/CTTTT | 3 | - | - | - | - | - | - | - | - | 3 |
AAACC/GGTTT | 3 | - | - | - | - | - | - | - | - | 3 |
AACAC/GTGTT | 3 | - | - | - | - | - | - | - | - | 3 |
ACAGC/CTGTG | 3 | - | - | - | - | - | - | - | - | 3 |
Others | 24 | 3 | - | 1 | - | - | - | - | - | 28 |
Hexa-nucleotide (14) | ||||||||||
ACAGCC/CTGTGG | - | - | - | - | - | 1 | - | - | - | 1 |
ACCCTG/AGGGTC | - | - | - | - | - | 1 | - | - | - | 1 |
ACCTCC/AGGTGG | - | - | - | - | 1 | - | - | - | - | 1 |
Others | 5 | 6 | - | - | - | - | - | - | - | 11 |
Total | 3722 | 3823 | 2298 | 1437 | 1565 | 7293 | 3891 | 2878 | 8867 | 35,774 |
% | 10.4 | 10.69 | 6.42 | 4.02 | 4.37 | 20.39 | 10.88 | 8.04 | 24.79 | 100 |
Locus | ID | Repeat Motif | Forward Primer(5′-3′) | Reverse Primer(3′-5′) | Predicted Product Size (bp) | Product Size (bp) | SS Position | Tm (°C) | Size 1 | Na2 | Ho3 | He4 | PIC5 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
S01 | c102105_g1 | (ATA)6 | AGTCCCGCCCACAAAATCAT | CTGGTCAGTCATTCCCCCAC | 259 | 225–258 | Unknown | 60 | 60 | 8 | 0.45 | 0.79 | 0.75 |
S02 | c11754_g1 | (AAG)6 | GGTCCCTGACTCACTGAAGC | CAACCTCTCTCTGCAGAACCA | 269 | 254–290 | 5′UTR | 60 | 60 | 7 | 0.18 | 0.53 | 0.48 |
S03 | c1204_g1 | (ATA)6 | GCACGTGGTCAAAGCAATCA | ATGAGCCCCTTCTGCACTTC | 267 | 254–266 | Unknown | 60 | 60 | 3 | 0.23 | 0.67 | 0.59 |
S04 | c25868_g1 | (GAT)6 | GCTGTGGAGTCACGTTCTCA | TCCCCACAGAATCACAAGCC | 277 | 272–293 | 3′UTR | 60 | 60 | 6 | 0.42 | 0.60 | 0.54 |
S07 | c29390_g1 | (CCT)6 | GCCAATGACATAATGGGCGG | TGCAGAGAGTCAGGAGCTCT | 226 | 226–250 | CDS | 60 | 60 | 4 | 0.33 | 0.62 | 0.55 |
S08 | c31361_g1 | (TGT)6 | GGAAGAGAAATGGAGGGTAGCT | TGCCAGACAACCAGAATGCT | 245 | 299–320 | Unknown | 60 | 59 | 6 | 0.27 | 0.74 | 0.69 |
S09 | c33497_g1 | (CAT)6 | ACCCTCCTCCTCCACCTTTT | ACCGGCTTCAGTGATTGGTT | 228 | 224–254 | 5′UTR | 60 | 60 | 6 | 0.45 | 0.77 | 0.73 |
S10 | c40172_g1 | (TGC)7 | CACGTACCCAACCGTCAAGA | TCCGACGACCACCTAATCCT | 273 | 246–294 | 5′UTR | 60 | 42 | 5 | 0.52 | 0.54 | 0.50 |
S11 | c40452_g1 | (ATC)6 | AAAAAGCGAGGACTACGGCA | TGGAGAAGCAGTGCTCGTTT | 229 | 218–227 | Unknown | 60 | 60 | 3 | 0.18 | 0.64 | 0.56 |
S12 | c34672_g2 | (GAT)7 | GGTGAACAAGCTGGAGTGGA | AAGCCCAGCATCTAAACCCC | 270 | 259–277 | CDS | 60 | 60 | 4 | 0.37 | 0.44 | 0.40 |
S21 | c56000_g1 | (TCCC)6 | GAGCCTTGAGTTCACCTCCC | TTGGGTGTGAGATTGAGGGC | 248 | 230–250 | 5′UTR | 60 | 39 | 6 | 0.65 | 0.75 | 0.70 |
S22 | c53146_g1 | (TC)10 | CCACCGATCTTAACCTCCGG | ACTACAAGTGCGTGTGACCC | 255 | 230–282 | Unknown | 60 | 60 | 11 | 0.43 | 0.65 | 0.63 |
S23 | c56684_g2 | (TC)10 | TGGCGTTGACTTCCAGCATT | GAGCAGTGTCAGCATGATGC | 277 | 242–284 | 3′UTR | 60 | 60 | 7 | 0.05 | 0.50 | 0.41 |
S24 | c59001_g1 | (CTA)7 | GCTGCAAATGCCAGTGCTTA | CGCTGTTGTCAGTGCATTGG | 234 | 219–268 | Unknown | 60 | 60 | 8 | 0.25 | 0.77 | 0.74 |
S26 | c60831_g5 | (GTT)7 | CCAATCCCACCAGTGAGGAG | GCAGCACCTCTGAGACAAGT | 244 | 223–262 | CDS | 60 | 60 | 4 | 0.05 | 0.48 | 0.38 |
S27 | c49315_g1 | (TAC)7 | GAACCTTTCCTTCTGCGCCT | CCTATGAAGCGTGTGCATGC | 265 | 260–272 | 3′UTR | 60 | 60 | 4 | 0.25 | 0.73 | 0.67 |
S28 | c63495_g1 | (TAC)7 | ACAGCATTTGTGTTTGTGCA | CAGCTGCGCTCTCATTCCTA | 249 | 201–249 | Unknown | 60 | 60 | 3 | 0.12 | 0.62 | 0.54 |
S29 | c57231_g1 | (TAT)7 | TCCCCGTTCCTCTCTCTCAG | GGACTGTCACATGGCACTCA | 152 | 141–174 | 5′UTR | 60 | 60 | 6 | 0.22 | 0.76 | 0.71 |
S30 | c48304_g3 | (TGT)7 | TGCCTTGATCCGCTGAGATC | TCCCAAAATCGATGCAAAGCA | 250 | 240–258 | 5′UTR | 59 | 60 | 6 | 0.35 | 0.65 | 0.58 |
Mean | 5.89 | 0.30 | 0.64 | 0.59 |
Locus | D. odorifera | D. tonkinensis | D. cochinchinensis | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Size 1 | Na2 | Ho3 | He4 | PIC5 | Size 1 | Na2 | Ho3 | He4 | PIC5 | Size 1 | Na2 | Ho3 | He4 | PIC5 | |||
S01 | 20 | 3 | 0.50 | 0.54 | 0.46 | 20 | 2 | 0.40 | 0.43 | 0.33 | 20 | 6 | 0.45 | 0.53 | 0.49 | ||
S02 | 20 | 2 | 0.00 | 0.10 | 0.09 | 20 | 2 | 0.05 | 0.05 | 0.05 | 20 | 5 | 0.5 | 0.49 | 0.45 | ||
S03 | 20 | 2 | 0.45 | 0.50 | 0.37 | 20 | 2 | 0.25 | 0.51 | 0.37 | 20 | 1 | \ | \ | \ | ||
S04 | 20 | 4 | 0.35 | 0.50 | 0.44 | 20 | 2 | 0.15 | 0.22 | 0.19 | 20 | 5 | 0.75 | 0.67 | 0.6 | ||
S07 | 20 | 2 | 0.55 | 0.50 | 0.37 | 20 | 1 | \ | \ | \ | 20 | 4 | 0.45 | 0.56 | 0.5 | ||
S08 | 20 | 4 | 0.35 | 0.35 | 0.33 | 19 | 3 | 0.47 | 0.51 | 0.44 | 20 | 1 | \ | \ | \ | ||
S09 | 20 | 4 | 0.50 | 0.63 | 0.56 | 20 | 3 | 0.35 | 0.56 | 0.44 | 20 | 2 | 0.5 | 0.47 | 0.35 | ||
S10 | 20 | 3 | 0.50 | 0.45 | 0.40 | 20 | 3 | 0.60 | 0.52 | 0.45 | 2 | 1 | \ | \ | \ | ||
S11 | 20 | 2 | 0.55 | 0.48 | 0.36 | 20 | 1 | \ | \ | \ | 20 | 1 | \ | \ | \ | ||
S12 | 20 | 2 | 0.20 | 0.18 | 0.16 | 20 | 2 | 0.30 | 0.26 | 0.22 | 20 | 3 | 0.6 | 0.66 | 0.57 | ||
S21 | 19 | 5 | 0.65 | 0.68 | 0.62 | 20 | 4 | 0.65 | 0.75 | 0.68 | \ | \ | \ | \ | \ | ||
S22 | 20 | 5 | 0.35 | 0.39 | 0.36 | 20 | 4 | 0.15 | 0.15 | 0.14 | 20 | 6 | 0.8 | 0.78 | 0.73 | ||
S23 | 20 | 2 | 0.00 | 0.10 | 0.09 | 20 | 2 | 0.05 | 0.05 | 0.05 | 20 | 4 | 0.1 | 0.15 | 0.14 | ||
S24 | 20 | 4 | 0.50 | 0.63 | 0.55 | 20 | 2 | 0.05 | 0.05 | 0.05 | 20 | 7 | 0.2 | 0.68 | 0.61 | ||
S26 | 20 | 2 | 0.05 | 0.05 | 0.05 | 20 | 2 | 0.05 | 0.05 | 0.05 | 20 | 2 | 0.05 | 0.05 | 0.05 | ||
S27 | 20 | 2 | 0.05 | 0.14 | 0.13 | 20 | 3 | 0.70 | 0.55 | 0.44 | 20 | 1 | \ | \ | \ | ||
S28 | 20 | 2 | 0.25 | 0.45 | 0.34 | 20 | 2 | 0.10 | 0.33 | 0.27 | 20 | 1 | \ | \ | \ | ||
S29 | 20 | 2 | 0.30 | 0.47 | 0.35 | 20 | 5 | 0.35 | 0.78 | 0.72 | 20 | 1 | \ | \ | \ | ||
S30 | 20 | 4 | 0.40 | 0.44 | 0.39 | 20 | 2 | 0.40 | 0.38 | 0.30 | 20 | 3 | 0.25 | 0.23 | 0.21 | ||
Mean | 20 | 2.95 | 0.34 | 0.40 | 0.34 | 20 | 2.47 | 0.27 | 0.32 | 0.31 | 18 | 3.00 | 0.29 | 0.33 | 0.43 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, F.-M.; Hong, Z.; Yang, Z.-J.; Zhang, N.-N.; Liu, X.-J.; Xu, D.-P. De Novo Transcriptome Analysis of Dalbergia odorifera T. Chen (Fabaceae) and Transferability of SSR Markers Developed from the Transcriptome. Forests 2019, 10, 98. https://doi.org/10.3390/f10020098
Liu F-M, Hong Z, Yang Z-J, Zhang N-N, Liu X-J, Xu D-P. De Novo Transcriptome Analysis of Dalbergia odorifera T. Chen (Fabaceae) and Transferability of SSR Markers Developed from the Transcriptome. Forests. 2019; 10(2):98. https://doi.org/10.3390/f10020098
Chicago/Turabian StyleLiu, Fu-Mei, Zhou Hong, Zeng-Jiang Yang, Ning-Nan Zhang, Xiao-Jin Liu, and Da-Ping Xu. 2019. "De Novo Transcriptome Analysis of Dalbergia odorifera T. Chen (Fabaceae) and Transferability of SSR Markers Developed from the Transcriptome" Forests 10, no. 2: 98. https://doi.org/10.3390/f10020098