Next Article in Journal
Caching Behavior of Large Prey by Eurasian Lynx: Quantifying the Anti-Scavenging Benefits
Previous Article in Journal
Conservation Biogeography of Tenebrionid Beetles: Insights from Italian Reserves
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 12
Issue 9
10.3390/d12090349
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tuber mesentericum and Tuber aestivum Truffles: New Insights Based on Morphological and Phylogenetic Analyses

by
Giorgio Marozzi
1,*,
Gian Maria Niccolò Benucci
2,
Edoardo Suriano
3,
Nicola Sitta
4,
Lorenzo Raggi
1,
Hovirag Lancioni
5,
Leonardo Baciarelli Falini
1,
Emidio Albertini
1 and
Domizia Donnini
1
1
Department of Agricultural, Food and Environmental Science, University of Perugia, 06121 Perugia, Italy
2
Department of Plant, Soil and Microbial Sciences, Michigan State University, East Lansing, MI 48824, USA
3
Via F.lli Mazzocchi 23, 00133 Rome, Italy
4
Loc. Farné 32, Lizzano in Belvedere, 40042 Bologna, Italy
5
Department of Chemistry, Biology and Biotechnology, University of Perugia, 06123 Perugia, Italy
*
Author to whom correspondence should be addressed.
Diversity 2020, 12(9), 349; https://doi.org/10.3390/d12090349
Submission received: 10 August 2020 / Revised: 7 September 2020 / Accepted: 8 September 2020 / Published: 10 September 2020
Browse Figures
Versions Notes

Abstract

:
Tuber aestivum, one of the most sought out and marketed truffle species in the world, is morphologically similar to Tuber mesentericum, which is only locally appreciated in south Italy and north-east France. Because T. aestivum and T. mesentericum have very similar ascocarp features, and collection may occur in similar environments and periods, these two species are frequently mistaken for one another. In this study, 43 T. aestivum and T. mesentericum ascocarps were collected in Italy for morphological and molecular characterization. The morphological and aromatic characteristics of the fresh ascocarps were compared with their spore morphology. Afterwards, we amplified and sequenced the elongation factor 1-α (EF1α) locus and built maximum likelihood trees to assess phylogenetic similarities between the two species. Tuber aestivum and T. mesentericum sequences cluster into different clades, with T. mesentericum sequences divided into three different sub-clades. According to their morphological features, three samples (T7, T8 and T12) were classified as T. mesentericum. However, when fresh, these ascocarps lacked the typical phenolic aromatic note. These specimens fall into the sub-clade III of the T. mesentericum phylogeny, which has the lowest genetic distance from the T. aestivum clade.

Graphical Abstract

1. Introduction

Among species belonging to genus Tuber, the summer truffle (Tuber aestivum Vittad.), is one of the most marketed and cultivated in Europe. This truffle is less valued than the Périgord black truffle (Tuber melanosporum Vittad.) and the white truffle (Tuber magnatum Pico), but its soil and climatic requirements make it capable of colonizing many different areas, even outside its geographical center of distribution [1]. These features make the summer truffle the easiest species to cultivate. Interest in this species also derives from the long ripening period that goes from May to September (T. aestivum) and from September to nearly all through winter (T. aestivum var. uncinatum (Chatin) I.R. Hall, P.K. Buchanan, Y. Wang & Cole) [2,3,4], prolonging the supply to the market. Nowadays, T. aestivum mycorrhized seedlings are routinely produced by specialized nurseries, favoring its cultivation to spread all over Europe and more recently in Australia and New Zealand [1,5,6,7,8,9,10,11,12].
Tuber aestivum is morphologically similar to Tuber mesentericum Vittad., also known as the “black truffle of Bagnoli Irpino”, a species only locally appreciated in southern Italy and in north eastern France. This truffle is well-distributed in Europe; it can be collected in summer, but the peak of production is between the end of autumn and the beginning of winter. Because of the low market request, the cultivation of this truffle has never taken place. Nevertheless, proof of successful mycorrhization has been provided, opening new possibilities for T. mesentericum cultivation [13]. In the wholesale market, and for industrial use, T. aestivum is sold in large quantities at prices generally lower than 100 €/kg. While at the retail level, big ascocarps of T. aestivum var. uncinatum can reach up to 600 €/kg [11]. Tuber mesentericum commerce consists of lower quantities than T. aestivum. Locally, it can be sold at a price ranging from 100 to 200 €/kg [14]. Differences in prices between the two truffle species are mainly determined by their different aroma. Indeed, the strong and pungent aroma of T. mesentericum, frequently associated with an unpleasant note of phenol, tar, and/or iodine, is not commonly appreciated [14].
Tuber aestivum and T. mesentericum ascocarps are often mistaken for one another because of their very similar morphology and because the aroma of T. mesentericum can, sometimes, lack the phenolic smell that is a unique trait of this species. Moreover, T. aestivum var. uncinatum and T. mesentericum can occur in the same environment and ripen at the same time of the year [15], so a mix of these species can be collected indistinguishably. The many overlapping morphological features of the ascocarps make it possible to refer to T. mesentericum and T. aestivum as a “species-complex” [16]. The transverse streaks in the peridium wart faces can not be considered a distinguishing feature between the two species because they are shown to be present in both T. mesentericum and T. aestivum, even if they are less evident and frequent in T. mesentericum [14]. Similarly, the presence of a basal depression or cavity is not a valid taxonomic trait to distinguish T. mesentericum because ascocarps of T. aestivum with the basal cavity, and T. mesentericum without it, have been described in the literature [14]. The color of the gleba can be considered a more reliable morphological feature to distinguish the two species. The Tuber mesentericum gleba is typically dark grey or brown, often with violet shades and with numerous white intensively winding veins at full maturity. In contrast, the color of the T. aestivum gleba ranges from yellowish or light brown to ochre, but never dark brown with violet shades [17,18]. The high intra and inter-specific variability between these two truffles also involves spore size and morphology. In both species the epispore is reticulate–alveolate with polygonal meshes often containing a crest on the inside. In T. aestivum, the spore meshes are larger, and basically regular and complete, whereas they are generally incomplete and irregular in T. mesentericum. However, also in the latter species (and sometimes even in the same ascocarp), spores with complete meshes, similar to those of T. aestivum, can be observed [14]. In both species, spore shape can vary from ellipsoid to perfectly globose and this variability can be found in the same ascocarp. Ellipsoid ascospores are predominant, with a small but variable percentage of spherical and sub-spherical ascospores that are more frequent in “typical” T. mesentericum ascocarps [17,18]. The spherical and sub-spherical ascospores can be predominant in some specimens that, based on this feature, have been attributed to distinct species such as Tuber bellonae Quél. (synonym: Tuber bituminatum var. sphaerosporum Ferry de la Bellone) and Tuber sinoaestivum J.P. Zhang & P.G. Liu [19,20]. The existence of a unique group for the T. aestivum–T. mesentericum complex, which also includes T. bellonae, is suggested by recent studies based on molecular data [20]. Whereas specific PCR primers to selectively amplify the T. aestivum internal transcribed spacer (ITS) region of the nuclear ribosomal DNA (nrDNA) have been developed [21], a similar molecular tool to characterize the whole genotypic diversity of T. mesentericum is still lacking due to the high similarity of the two species at that locus [22,23].
Collections of mature T. mesentericum specimens (on the order of some tens of kilos), absolutely free of a phenolic aromatic component, are frequently observed from Salento (Puglia, southern Italy) and the province of Rome in late spring and early summer (E.S., personal communication). These sites of collection are characterized by a Mediterranean climate and are dominated by Quercus ilex L. and other Quercus host species. These harvests are normally identified by truffle hunters as T. aestivum, mostly because they ripen early in the season compared to T. mesentericum and because of the absence of the phenolic smell. However, the dark color of the gleba and the morphology of the spores suggest that these specimens are T. mesentericum.
In this work we aimed to: (1) expand the molecular and ecological characterization of Tuber aestivum and Tuber mesentericum and investigate their genotypic diversity using the elongation factor 1-α (EF1α) locus; (2) compare the molecular data with the detailed morphological characterization of the truffle specimens to confirm the existence of a “Tuber aestivum–mesentericum complex” and with ecological data to investigate genotype-site relationships; and (3) study T. mesentericum ascocarps, which have the aroma most similar to T. aestivum, and evaluate their potential in cultivation and trade.

2. Materials and Methods

At the end of 2014, a total of 43 truffles belonging to T. aestivum and T. mesentericum were collected from 10 different Italian regions (Figure 1). For each truffle, the following information was stored in a database: truffle hunter, place and date of collection, the species name attributed by the hunter, and remarkable features. In particular, we registered if the truffle hunters detected the presence of the phenolic component in the fresh truffles.
From each truffle, eight gleba cubes of around 0.25 g each were sampled and stored in a 1.5 mL Eppendorf tube containing 70% ethanol (v/v) to preserve the DNA for further analysis. At the same time, a portion of fresh gleba was scratched with a scalpel from each truffle and mounted on a microscopic slide with glycerol to perform spore morphological analysis. Details about the truffle samples analyzed in this study are reported in Table 1. The morphological characterization of T. aestivum and T. mesentericum spores was performed with a light microscope (Leica Leitz DMRB), photographs were taken with a Leica DFC320 digital camera (Figure 2) [24]. Twenty-seven truffles were chosen as representative of the collection sites and used for genetic analysis in order to compare the molecular information with the other available data (morphological analysis of the spores and characterization of the perceived aroma). For each sampled truffle, total DNA was extracted from about 100 mg of grinded material by using the MagCore® Automated Nucleic Acid Extractor and following the protocol for the MagCore Genomic DNA Plant kit (RBC Bioscience, Taipei, Taiwan). DNA samples were quantified, and quality checked using the NanoDrop (Thermo Scientific, Waltham, MA, USA). The elongation factor (EF1α) was PCR amplified with a set of primers with enhanced specificity for Tuberaceae [25]. Each 45 μL PCR reaction consisted of 1× DreamTaq Buffer, 10 µg bovine serum albumin (BSA), 0.2 mM dNTPs, 10 µM of EF1α Tuber_f (5′ AGCGTGAGCGTGGTATCAC 3′—forward) and EF1α Tuber_r (5′ GAGACGTTCTTGACGTTGAAG 3′—reverse) primers, 2 U DreamTaq DNA Polymerase (Thermo Scientific, Waltham, MA, USA) and ultrapure water up to the final volume. DNA in all samples was higher than 10 ng/μL and 5 μL was used to get a satisfactory amplification.
The PCR thermal profile included 5 min at 95 °C, followed by 30 cycles of 30 s at 94 °C, 30 s at 60 °C and 45 s at 72 °C and a final extension of 7 min at 72 °C. Three microliters of each PCR product were added to 1× DNA Gel Loading Dye and analyzed on a 1.8% (w/v) agarose gel stained with ethidium bromide. The PCR products were then purified using the EuroGOLD Cycle-Pure kit (EUROCLONE, Pero, Italy), Sanger sequenced using the BigDye terminator V.3.1 kit (Thermo Scientific, Waltham, MA, USA), and analyzed on a ABI PRISM 3130xl genetic analyzer (Applied Biosystems, Foster City, CA, USA).
Assembled sequence contigs (Geneious v10.2.6) were used as queries against the GenBank [26] database using Basic Local Alignment Search Tool (BLAST) algorithm [27] available on the NCBI [28] portal (Table 1). The resulting contigs were also published in NCBI with accession numbers from MH992040 to MH992066.
All the available EF1α sequences of T. mesentericum and T. aestivum were also downloaded from GenBank (Table S1). Sequences were aligned using the ClustalW algorithm then the phylogenetic tree reconstruction was performed using the maximum likelihood method based on the Kimura 2-parameter model [29]. Two phylogenetic trees were constructed: the first one, included sequences produced in this work; the second one, included also sequences downloaded from GenBank. Both trees were supported by bootstrap (999 replicates) and EF1α sequences from Tuber magnatum Pico [25] were included as an outgroup in the first tree. The model used for the phylogenetic reconstruction was computed using the statistical J Model Test. All these analyses were conducted in MEGA7 [30]. The second tree was visualized with iTOL [31].
For sequences produced in this work, the number of base substitutions per site, from averaging over all sequence pairs, between groups identified in the phylogenetic analysis were calculated together with relative standard errors. The within groups average number of base substitutions per site were also calculated.
To assess the level of correspondence between the phylogenetic and the ecological traits (Table S2) of the samples, we performed a tanglegram analysis using the “dendextend” package in R [32,33]. This represents a simple method to visually compare distance matrices having the same set of samples [34]. The quality of the alignment of the two trees is measured via the entanglement that varies between 1 (full entanglement) and 0 (no entanglement); a lower entanglement coefficient corresponds to a good alignment. Penalty was assessed using L = 1, whereby increased L results in an increased penalty for sharp angles. A Mantel test was performed in “vegan” R package [35] to assess the correlation between phylogenetic and ecological distance matrices.

3. Results and Discussion

Our study started from the analysis of truffle specimens (samples T7, T8 and T12) collected in three different Italian regions. The aroma, the collection period, and ecological characteristics of the site where these truffles were collected were similar to those of T. aestivum. However their macroscopic and microscopic morphological features corresponded to those of T. mesentericum. Since these two truffle species usually live in the same soil environment, characterized by calcareous soils with sub-alkaline or neutral pH, their ascocarps are frequently mistaken for one another by collectors [2,36]. To better investigate the morphological and genetic variability of this truffle species, we gathered 43 samples of T. mesentericum and T. aestivum var. uncinatum from 10 more regions across Italy. The collected samples were classified by the truffle hunters as T. aestivum or T. mesentericum on the basis of main ascocarp characteristics, such as phenolic aromatic component, gleba color, presence of a basal depression or cavity, and the environmental characteristics of the collection site. The 43 truffles were subsequently classified according to their spore morphology [17,37]: 14 specimens were classified as T. aestivum and 26 as T. mesentericum, whereas three truffles were labeled as “uncertain” because their spore meshes were not well formed and they were not referable for certain to one of the two species (Table 1 and Figure 2). Sometimes, truffles that are not fully mature can have an incomplete episporium [38] that, in this case, can not be attributed to either T. mesentericum or T. aestivum spore types. According to our morphological analyses of the spores, truffle hunters misidentified eight truffles (Table 1). In particular, seven T. mesentericum ascocarps had been classified as T. aestivum while only one T. aestivum var. uncinatum ascocarp had been recognized as T. mesentericum.
All the DNA sequences from the 27 truffles showed a BLAST match ≥99% to T. aestivum or T. mesentericum. DNA sequencing confirmed the results provided by morphological analysis in 26 truffles, including those labeled as “uncertain” that had been correctly classified as T. mesentericum by the truffle hunters (Table 1). According to the DNA analysis, only one sample was wrongly identified by the spore morphology analysis (T32). In two other cases (T5 and T40), the DNA analysis agreed with the results of spore morphology analysis while confirming the incorrect identification made by truffle hunters. Our results confirmed how difficult it is to correctly identify T. aestivum and T. mesentericum truffles, even for experienced truffle hunters. It is worth highlighting that truffle hunters misidentified the samples because of the lack of the phenolic component in the aroma of the fresh ascocarps. It has been largely shown that truffle gleba represents a restricted habitat where bacteria, filamentous fungi, and yeasts can be harbored [39,40,41,42,43,44,45]. Although the role of microorganisms in truffle aroma was proven for T. aestivum [46], the same is not demonstrated for the phenolic component of T. mesentericum. Splivallo et al. [47] showed that certain bacteria promote the formation of thiophene derivatives, odorants unique to T. borchii. Recent findings showed that factors shaping the microbiome of T. aestivum ascocarps might differ based on local conditions, but unlike in other fungi, ascocarp maturation did not seem to influence the microbiome [48]. We hypothesize that, in addition to the truffle development stage, specific site conditions may also play a role in aroma definition, particularly for the presence of the phenolic component of T. mesentericum. Further study is necessary to define the relationships between the phenolic component in the truffle aroma and the ecology of T. mesentericum collection sites.
The EF1α sequences produced in this study were used in two phylogenetic reconstructions. The first phylogenetic tree was constructed using only the sequences generated in this study (Figure 3), whereas in the second tree, all T. aestivum and T. mesentericum EF1α sequences available in GenBank [26] were included (Figure 4).
Topology of the evolutionary tree in Figure 3 suggests the presence of two main clades: one grouping all T. mesentericum samples and the other clustering all T. aestivum samples; as expected, both clades are clearly separated from the T. magnatum outgroup. No sub-clades are evident in the Tuber aestivum clade, whereas three distinct sub-clades are marked in the T. mesentericum clade: sub-clade I and II belong to the same basal lineage, whereas sub-clade III is well separated from the other two. This evidence confirms what was proposed by Benucci et al. [14], who showed the presence of three distinct sub-clades in an ITS-based phylogeny of T. mesentericum. It is noteworthy that samples T7, T8, and T12 all belong to the T. mesentericum sub-clade III. Within-groups pairwise genetic distances were also calculated and compared considering both clade and sub-clade separation of samples. Results of the analysis (Table 2) showed that T. aestivum and T. mesentericum “sub-clade III” is the least diverse clade and sub-clade, respectively. In general, fairly low diversity was observed in all clades and sub-clades, while no diversity was observed in the T. magnatum one (data not shown).
The mantel test showed no significant correlation between the genetic distances between the truffles and the ecological data (Mantel r = −0.025, p = 0.585, permutations = 9999). The entanglement between the truffle phylogeny and the ecological dissimilarities was high (0.396) and the tanglegram showed almost no correspondence between the two trees besides sample T7 and T8 that fell in the same clade in both dendrograms (Figure 5).
In order to better resolve the truffle phylogeny, we built a second maximum likelihood tree including all T. mesentericum and T. aestivum sequences available in GenBank [26]. Whereas a large number of EF1α sequences of T. aestivum are present in GenBank, only 11 sequences of T. mesentericum exist. Both trees revealed the same topology, with two major clades that clearly separate T. aestivum from T. mesentericum. The latter included three main sub-clades. Sequences produced in this study cluster together with those with the highest similarity found in the GenBank database. In particular, sequences named AF516778 and AF516777 cluster together with samples T7, T8 and T12. Unfortunately, it was impossible to find out more information on the ascocarps that those two sequences belong to. Overall, information about the sampling location is lacking for most of the T. mesentericum downloaded sequences. This information was available only for sequence JX022595, which was isolated from a truffle collected in Sweden as reported by Bonito et al. [25] (Table S1). More information is needed regarding the aroma and morphological traits of the two truffles that grouped in sub-clade III in order to explore the potential reasons for the low genetic distance within the T. aestivum clade. In both T. aestivum and T. mesentericum clades, sequences obtained from samples collected in the same site cluster in different subclades, showing no geographic structure of the molecular data based on the selected locus (Figure 4). For example, T. mesentericum sub-clades I and II include sequences obtained from samples collected in Abruzzo, Lombardia, Basilicata, Campania, Emilia-Romagna, Lazio and Trentino Alto Adige (AY170358-AY170360, AF516769, AF516775-AF516776, JX022595).
Since the first ITS primers were published by White et al. [49], the ITS region of nrDNA has become the reference barcode region for the identification of fungi and phylogenetic studies [50,51,52]. A variety of species-specific primers were built for this region for the identification of Tuber spp. [21,53,54]. Nevertheless, ITS is difficult to align, which restricts its utility for phylogenetic reconstruction [55]. Therefore, new molecular markers were introduced for truffle multigene phylogeny studies [25,56], including the genetic locus elongation factor 1-α (EF1α). To the best of our knowledge, this is the first study on Tuber spp. where the EF1α locus is used to build a phylogeny of T. mesentericum and T. aestivum.
This study also confirms the high morphological and genetic similarity among T. aestivum and T. mesentericum, recommending the use of molecular tools for the characterization of these species. Currently, the high variability of the ITS region in T. mesentericum makes it impossible to design primers that are able to characterize all the genotypes of this species.
Bonito and colleagues [25], showed that T. mesentericum and T. aestivum cluster into one clade, together with Tuber panniferum Tul. & C. Tul. and T. magnatum in the ITS phylogeny of the Tuber genus. We showed that T. mesentericum and T. aestivum also have a high genetic variability in the EF1α locus, corroborating previous findings on the presence of a “Tuber aestivum–mesentericum species complex”.
Moreover, we investigated the possible correspondence between the phylogenetic diversity of truffles and the ecological differences present at sampling sites using tanglegram analysis (Figure 5) and found no evident concordance. These results were corroborated by a non-significant Mantel test result.
The evidence shown in this work suggests that within the species complex, there are ecomorphs with intermediate morphological features located in a well-defined sub-clade. A wider collection of samples and a strong aroma characterization would help to more deeply investigate this species complex using, for example, a multiple gene phylogeny strategy. Moreover, studies on the T. mesentericum microbiome and aroma should be carried out to verify the influence of environmental conditions on the presence of the phenolic component. In future experiments, soil (e.g., soil texture, chemistry, temperature) as well as ecological (e.g., temperature, rain) traits of the sites where the truffles are collected should be included to possibly identify correlations between truffle genotypes and their ecology. Tuber mesentericum is not easily marketed because of its aroma and lack of mycorrhized seedlings with this truffle in the market. In the future, the design of species-specific primers on EF1α or other loci could provide a tool for ascocarp characterization and truffle-inoculated seedling certification. This could also represent an opportunity to improve its cultivation. Finally, selecting T. mesentericum ascocarps with an aroma more similar to T. aestivum, could open up new prospects for the market of this species.

Supplementary Materials

The following are available online at https://www.mdpi.com/1424-2818/12/9/349/s1, Table S1: GenBank accession information for downloaded EF1α sequences, Table S2: Ecological information used in the tanglegram analysis.

Author Contributions

Conceptualization, N.S., E.S., D.D. and G.M.N.B.; methodology, G.M.N.B., L.R. and G.M.; investigation, G.M., E.S., G.M.N.B. and N.S.; resources, N.S., E.S., E.A., H.L. and D.D.; data curation, G.M., G.M.N.B. and L.B.F.; formal analysis, G.M., L.R. and G.M.N.B.; writing—original draft preparation, G.M., G.M.N.B. and N.S.; writing—review and editing, G.M., G.M.N.B., N.S., E.S., L.R., H.L., L.B.F., E.A. and D.D.; supervision, D.D.; project administration, D.D.; funding acquisition, N.S. and G.M.N.B. All authors have read and agreed to the final version of the manuscript.

Funding

This research was supported by a contribution of 2500 € from “UrbaniTartufi srl”.

Acknowledgments

We thank Giammarco Urbani at Urbani Tartufi, the truffle hunters that collected the samples, and Gilberto Bragato who helped to characterize the soils where truffles were collected.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of the data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Stobbe, U.; Egli, S.; Tegel, W.; Peter, M.; Sproll, L.; Büntgen, U. Potential and limitations of Burgundy truffle cultivation. Appl. Microbiol. Biotechnol. 2013, 97, 5215–5224. [Google Scholar] [CrossRef] [PubMed]
  2. Chevalier, G.; Frochot, H. Ecology and possibility of culture in Europe of the Burgundy truffle (Tuber uncinatum Chatin). Agric. Ecosyst. Environ. 1990, 28, 71–73. [Google Scholar] [CrossRef]
  3. Chevalier, G.; Sourzat, P. Soils and Techniques for Cultivating Tuber melanosporum and Tuber aestivum in Europe. In Edible Ectomycorrhizal Mushrooms; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2012; pp. 163–189. [Google Scholar]
  4. Venturella, G.; Altobelli, E.; Bernicchia, A.; Di Piazza, S.; Donnini, D.; Gargano, M.L.; Gorjòn, S.P.; Granito, V.M.; Lantieri, A.; Lunghini, D.; et al. Fungal biodiversity and in situ conservation in Italy. Plant Biosyst. 2011, 145, 950–957. [Google Scholar] [CrossRef]
  5. Boni, C.; Gregori, G.; Puxeddu, M.; Tocci, A. The Tuber aestivum Vitt. in Sardinia: Ecology and Prospects of Cultivation. Plant Biosyst. 1994, 128, 393. [Google Scholar]
  6. Wedén, C.; Pettersson, L.; Danell, E. Truffle cultivation in Sweden: Results from Quercus robur and Corylus avellana field trials on the island of Gotland. Scand. J. For. Res. 2009, 24, 37–53. [Google Scholar] [CrossRef]
  7. Benucci, G.M.N.; Bonito, G.; Baciarelli Falini, L.; Bencivenga, M. Mycorrhization of Pecan trees (Carya illinoinensis) with commercial truffle species: Tuber aestivum Vittad and Tuber borchii Vittad. Mycorrhiza 2012, 22, 383–392. [Google Scholar] [CrossRef]
  8. Donnini, D.; Gargano, M.L.; Perini, C.; Savino, E.; Murat, C.; Di Piazza, S.; Altobelli, E.; Salerni, E.; Rubini, A.; Rana, G.L.; et al. Wild and cultivated mushrooms as a model of sustainable development. Plant Biosyst. 2013, 147, 226–236. [Google Scholar] [CrossRef]
  9. Zambonelli, A.; Donnini, D.; Rana, G.L.; Fascetti, S.; Benucci, G.M.N.; Iotti, M.; Morte, A.; Khabar, L.; Bawadekji, A.; Piattoni, F.; et al. Hypogeous fungi in Mediterranean maquis, arid and semi-arid forests. Plant Biosyst. 2014, 148, 392–401. [Google Scholar] [CrossRef]
  10. Murat, C. Forty years of inoculating seedlings with truffle fungi: Past and future perspectives. Mycorrhiza 2015, 25, 77–81. [Google Scholar] [CrossRef]
  11. Molinier, V.; Peter, M.; Stobbe, U.; Egli, S. The Burgundy Truffle (Tuber aestivum syn. uncinatum): A Truffle Species with a Wide Habitat Range over Europe. In True Truffle (Tuber spp.) in the World; Springer: Berlin/Heidelberg, Germany, 2016; pp. 33–47. [Google Scholar]
  12. Hall, I.; Fitzpatrick, N.; Miros, P.; Zambonelli, A. Counter-season cultivation of truffles in the southern hemisphere: An update. Ital. J. Mycol. 2017, 46, 21–36. [Google Scholar]
  13. Marozzi, G.; Benucci, G.M.N.; Baciarelli Falini, L.; Albertini, E.; Donnini, D. Synthesis of Tuber mesentericum ectomycorrhizae with Quercus pubescens: A morphological review and DNA characterization. Sydowia 2018, 70, 81–88. [Google Scholar]
  14. Benucci, G.M.N.; Csorbai, A.G.; Baciarelli Falini, L.; Marozzi, G.; Suriano, E.; Sitta, N.; Donnini, D. Taxonomy, Biology and Ecology of Tuber macrosporum Vittad. and Tuber mesentericum Vittad. In True Truffle (Tuber spp.) in the World; Springer: Berlin/Heidelberg, Germany, 2016; pp. 69–86. [Google Scholar]
  15. Marozzi, G.; Baciarelli Falini, L.; Donnini, D. Aspetti biologici e genetici del tartufo mesenterico. In Tuber mesentericum Tartufo mesenterico; Associazione Tartufai del Friuli Venezia Giulia, Corvino edizioni: Udine, Italia, 2019; pp. 25–32. [Google Scholar]
  16. Pacioni, G.; Pomponi, G. Genotypic patterns of some Italian populations of the Tuber aestivum-T. mesentericum complex. Mycotaxon 1991, 42, 171–179. [Google Scholar]
  17. Montecchi, A.; Sarasini, M. Funghi Ipogei d’Europa; A.M.B. Fondazione: Trento, Italy, 2000. [Google Scholar]
  18. Ceruti, A.; Fontana, A.; Nosenzo, C. Le Specie Europee del Genere Tuber: Una Revisione Storica; Museo Reg. Scienze Nat.: Torino, Italy, 2003; Volume 37. [Google Scholar]
  19. Zhang, J.P.; Liu, P.G.; Chen, J. Tuber sinoaestivum sp. nov., an edible truffle from southwestern China. Mycotaxon 2012, 122, 73–82. [Google Scholar] [CrossRef]
  20. Mang, S.M.; Zotta, T.; Camele, I.; Racioppi, R.; D’Auria, M.; Rana, G.L. Morphological, physico-chemical and molecular investigations on Tuber bellonae from Basilicata-Italy. J. Anim. Plant Sci. 2017, 27, 528–541. [Google Scholar]
  21. Mello, A.; Cantisani, A.; Vizzini, A.; Bonfante, P. Genetic variability of Tuber uncinatum and its relatedness to other black truffles. Environ. Microbiol. 2002, 4, 584–594. [Google Scholar] [CrossRef]
  22. Gryndler, M.; Hršelová, H.; Soukupová, L.; Streiblová, E.; Valda, S.; Borovička, J.; Gryndlerová, H.; Gažo, J.; Miko, M. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers. FEMS Microbiol. Lett. 2011, 318, 84–91. [Google Scholar] [CrossRef]
  23. Sica, M.; Gaudio, L.; Aceto, S. Genetic structure of Tuber mesentericum Vitt. based on polymorphisms at the ribosomal DNA ITS. Mycorrhiza 2007, 17, 405–414. [Google Scholar] [CrossRef] [Green Version]
  24. Marozzi, G.; Sánchez, S.; Benucci, G.M.N.; Bonito, G.; Baciarelli Falini, L.; Albertini, E.; Donnini, D. Mycorrhization of pecan (Carya illinoinensis) with black truffles: Tuber melanosporum and Tuber brumale. Mycorrhiza 2017, 2, 303–309. [Google Scholar] [CrossRef]
  25. Bonito, G.; Smith, M.E.; Nowak, M.; Healy, R.A.; Guevara, G.; Cázares, E.; Kinoshita, A.; Nouhra, E.R.; Domínguez, L.S.; Tedersoo, L.; et al. Historical Biogeography and Diversification of Truffles in the Tuberaceae and Their Newly Identified Southern Hemisphere Sister Lineage. PLoS ONE 2013, 8, e52765. [Google Scholar] [CrossRef]
  26. Benson, D.A.; Cavanaugh, M.; Clark, K.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res. 2013, 41, D36–D42. [Google Scholar] [CrossRef] [Green Version]
  27. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  28. National Center for Biotechnology Information (NCBI) [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. 1988. Available online: https://www.ncbi.nlm.nih.gov/ (accessed on 6 June 2020).
  29. Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [PubMed]
  30. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 2019, 47, 256–259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Galili, T. dendextend: An R package for visualizing, adjusting and comparing trees of hierarchical clustering. Bioinformatics 2015, 31, 3718–3720. [Google Scholar] [CrossRef] [Green Version]
  33. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
  34. Benucci, G.M.N.; Burnard, D.; Shepherd, L.D.; Bonito, G.; Munkacsi, A.B. Evidence for co-evolutionary history of early diverging Lycopodiaceae plants with fungi. Front. Microbiol. 2020, 10, 2944. [Google Scholar] [CrossRef] [Green Version]
  35. Oksanen, J.; Guillaume Blanchet, F.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D. Vegan: Community Ecology Package; R Package Version 2.5-4. 2019. Available online: https://CRAN.R-project.org/package=vegan (accessed on 1 August 2020).
  36. Granetti, B.; De Angelis, A.; Materozzi, G. Umbria Terra di Tartufi; Umbriagraf: Terni, Italy, 2005. [Google Scholar]
  37. Breitenbach, J.; Kränzlin, F. Champignons de Suisse: Les Ascomycètes; Edition Mykologia: Lucerne, Switzerland, 1981; Volume 1. [Google Scholar]
  38. Read, N.D.; Beckett, A. Ascus and ascospore morphogenesis. Mycol. Res. 1996, 100, 1281–1314. [Google Scholar] [CrossRef]
  39. Zacchi, L.; Vaughan-Martini, A.; Angelini, P. Yeast distribution in a truffle-field ecosystem. Ann. Microbiol. 2003, 53, 275–282. [Google Scholar]
  40. Pacioni, G.; Leonardi, M.; Aimola, P.; Ragnelli, A.M.; Rubini, A.; Paolocci, F. Isolation and characterization of some mycelia inhabiting Tuber ascomata. Mycol. Res. 2007, 111, 1450–1460. [Google Scholar] [CrossRef]
  41. Rivera, C.S.; Blanco, D.; Oria, R.; Venturini, M.E. Diversity of culturable microorganisms and occurrence of Listeria monocytogenes and Salmonella spp. in Tuber aestivum and Tuber melanosporum ascocarps. Food Microbiol. 2010, 27, 286–293. [Google Scholar] [CrossRef]
  42. Stielow, B.; Menzel, W. Complete nucleotide sequence of TaV1, a novel totivirus isolated from a black truffle ascocarp (Tuber aestivum Vittad.). Arch. Virol. 2010, 155, 2075–2078. [Google Scholar] [CrossRef] [PubMed]
  43. Gryndler, M.; Soukupová, L.; Hršelová, H.; Gryndlerová, H.; Borovička, J.; Streiblová, E.; Jansa, J. A quest for indigenous truffle helper prokaryotes. Environ. Microbiol. Rep. 2013, 5, 346–352. [Google Scholar] [CrossRef] [PubMed]
  44. Benucci, G.M.N.; Bonito, G.M. The truffle microbiome: Species and geography effects on bacteria associated with fruiting bodies of hypogeous Pezizales. Microb. Ecol. 2016, 72, 4–8. [Google Scholar] [CrossRef] [PubMed]
  45. Leonardi, M.; Ascione, S.; Pacioni, G.; Cesare, P.; Pacioni, M.L.; Miranda, M. The challenge for identifying the fungi living inside mushrooms: The case of truffle inhabiting mycelia. Plant Biosyst. 2017, 152, 1002–1010. [Google Scholar] [CrossRef]
  46. Culleré, L.; Ferreira, V.; Chevret, B.; Venturini, M.E.; Sánchez-Gimeno, A.C.; Blanco, D. Characterisation of aroma active compounds in black truffles (Tuber melanosporum) and summer truffles (Tuber aestivum) by gas chromatography-olfactometry. Food Chem. 2010, 122, 300–306. [Google Scholar] [CrossRef]
  47. Splivallo, R.; Deveau, A.; Valdez, N.; Kirchhoff, N.; Frey-Klett, P.; Karlovsky, P. Bacteria associated with truffle-fruiting bodies contribute to truffle aroma. Environ. Microbiol. 2015, 17, 2647–2660. [Google Scholar] [CrossRef]
  48. Splivallo, R.; Vahdatzadeh, M.; Maciá-vicente, J.G.; Molinier, V.; Peter, M.; Egli, S.; Uroz, S.; Paolocci, F.; Deveau, A.; Huber, K.J. Orchard conditions and fruiting body characteristics drive the microbiome of the black truffle Tuber aestivum. Front. Microbiol. 2019, 10, 1437. [Google Scholar] [CrossRef]
  49. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  50. Wedén, C.; Danell, E.; Tibell, L. Species recognition in the truffle genus Tuber—The synonyms Tuber aestivum and Tuber uncinatum. Environ. Microbiol. 2005, 7, 1535–1546. [Google Scholar] [CrossRef]
  51. Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Bolchacova, E.; Voigt, K.; Crous, P.W.; et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [Green Version]
  52. Riccioni, C.; Rubini, A.; Türkoğlu, A.; Belfiori, B.; Paolocci, F. Ribosomal DNA polymorphisms reveal genetic structure and a phylogeographic pattern in the Burgundy truffle Tuber aestivum Vittad. Mycologia 2019, 111, 26–39. [Google Scholar] [CrossRef]
  53. Rubini, A.; Paolocci, F.; Granetti, B.; Arcioni, S. Single step molecular characterization of morphologically similar black truffle species. FEMS Microbiol. Lett. 1998, 164, 7–12. [Google Scholar] [CrossRef]
  54. Rubini, A.; Paolocci, F.; Granetti, B.; Arcioni, S. Morphological characterization of molecular-typed Tuber magnatum ectomycorrhizae. Mycorrhiza 2001, 11, 179–185. [Google Scholar] [CrossRef]
  55. Seifert, K.A. Progress towards DNA barcoding of fungi. Mol. Ecol. Resour. 2009, 9, 83–89. [Google Scholar] [CrossRef] [PubMed]
  56. Molinier, V.; van Tuinen, D.; Chevalier, G.; Gollotte, A.; Wipf, D.; Redecker, D. A multigene phylogeny demonstrates that Tuber aestivum and Tuber uncinatum are conspecific. Org. Divers. Evol. 2013, 13, 503–512. [Google Scholar] [CrossRef]
Diversity 12 00349 g001 550
Figure 1. Geographical sampling distribution.
Figure 1. Geographical sampling distribution.
Diversity 12 00349 g001
Diversity 12 00349 g002 550
Figure 2. Ascospores recognized as belonging to Tuber aestivum (a) and Tuber mesentericum (b); (c) ascospores with uncertain spore morphology.
Figure 2. Ascospores recognized as belonging to Tuber aestivum (a) and Tuber mesentericum (b); (c) ascospores with uncertain spore morphology.
Diversity 12 00349 g002
Diversity 12 00349 g003 550
Figure 3. Tuber mesentericum/aestivum maximum likelihood phylogenetic tree realized with the EF1α locus based on the Kimura two-parameter model [29]. Bootstrap values >60% are shown next to branching nodes. The tree is drawn to scale, with branch lengths measured in number of substitutions per site. The analysis involved 29 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 512 positions in the final dataset.
Figure 3. Tuber mesentericum/aestivum maximum likelihood phylogenetic tree realized with the EF1α locus based on the Kimura two-parameter model [29]. Bootstrap values >60% are shown next to branching nodes. The tree is drawn to scale, with branch lengths measured in number of substitutions per site. The analysis involved 29 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 512 positions in the final dataset.
Diversity 12 00349 g003
Diversity 12 00349 g004 550
Figure 4. Tuber mesentericum/aestivum maximum likelihood phylogenetic tree based on the Kimura two-parameter model [29]: bootstrap values are shown as symbols on the branches. A discrete Gamma distribution [+G] was used to model evolutionary rate differences among sites. The analysis involved 83 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 465 positions in the final dataset. Sequence accessions and species are reported in the phylogenetic tree.
Figure 4. Tuber mesentericum/aestivum maximum likelihood phylogenetic tree based on the Kimura two-parameter model [29]: bootstrap values are shown as symbols on the branches. A discrete Gamma distribution [+G] was used to model evolutionary rate differences among sites. The analysis involved 83 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 465 positions in the final dataset. Sequence accessions and species are reported in the phylogenetic tree.
Diversity 12 00349 g004
Diversity 12 00349 g005 550
Figure 5. Tanglegrams showing correspondence between ecological differences at sampling sites (i.e., dissimilarities) and truffle phylogeny.
Figure 5. Tanglegrams showing correspondence between ecological differences at sampling sites (i.e., dissimilarities) and truffle phylogeny.
Diversity 12 00349 g005
Table
Table 1. List of collected samples, including: sample ID, recognized species by ascocarp morphology (Tuber aestivum var. uncinatum = T. uncinatum), collection date, Italian region of collection, spore morphology classification and the closest species match in the GenBank database. The accession numbers of the 27 sequenced samples are reported in the first column and an asterisk (*) highlights samples that present a mismatch in one of the three attributes (ascocarp, spore morphology, consensus taxa).
Table 1. List of collected samples, including: sample ID, recognized species by ascocarp morphology (Tuber aestivum var. uncinatum = T. uncinatum), collection date, Italian region of collection, spore morphology classification and the closest species match in the GenBank database. The accession numbers of the 27 sequenced samples are reported in the first column and an asterisk (*) highlights samples that present a mismatch in one of the three attributes (ascocarp, spore morphology, consensus taxa).
Sample ID/Query Accession NumberRecognized Species (Ascocarp)Collection Date (Year)Collection Site (Italian Region)Spore Morphology ClassificationConsensus Taxa/GenBank Accession Number
T1/MH992040T. aestivum2013MoliseT. aestivumT. aestivum/AY226026
T2/MH992046T. aestivum2013SardegnaT. aestivumT. aestivum/AY226026
T3/MH992052T. aestivum2013SardegnaT. aestivumT. aestivum/AY170350
T4/MH992059T. aestivum2013Emilia RomagnaT. aestivumT. aestivum/AY226022
T5 */MH992063T. uncinatum2013Trentino Alto AdigeT. mesentericumT. mesentericum/AF516775
T6/MH992064T. uncinatum2014LazioT. aestivumT. aestivum/AY226022
T7/MH992065T. mesentericum2013PugliaT. mesentericumT. mesentericum/AF516778
T8/MH992066T. mesentericum2013LazioT. mesentericumT. mesentericum/AF516778
T9T. mesentericum2013LazioT. mesentericum
T10T. mesentericum2013LazioT. mesentericum
T11T. mesentericum2013LazioT. mesentericum
T12/MH992041T. mesentericum2013AbruzzoUncertainT. mesentericum/AF516778
T13T. mesentericum2013AbruzzoT. mesentericum
T14/MH992042T. mesentericum2013AbruzzoT. mesentericumT. mesentericum/AF516775
T15/MH992043T. mesentericum2013AbruzzoT. mesentericumT. mesentericum/AF516769
T16/MH992044T. mesentericum2013LazioT. mesentericumT. mesentericum/AF516775
T17/MH992045T. mesentericum2013LazioT. mesentericumT. mesentericum/AF516775
T18T. mesentericum2013LazioT. mesentericum
T19T. mesentericum2013LazioT. mesentericum
T20T. mesentericum2013Trentino Alto AdigeT. mesentericum
T21T. mesentericum2013Trentino Alto AdigeT. mesentericum
T22/MH992047T. mesentericum2013Trentino Alto AdigeT. mesentericumT. mesentericum/AF516775
T23/MH992048T. mesentericum2013Trentino Alto AdigeUncertainT. mesentericum/AF516775
T24T. mesentericum2013Trentino Alto AdigeT. mesentericum
T25T. mesentericum2013BasilicataT. mesentericum
T26/MH992049T. mesentericum2013BasilicataT. mesentericumT. mesentericum/AF516769
T27/MH992050T. mesentericum2013CampaniaT. mesentericumT. mesentericum/AF516769
T28/MH992051T. mesentericum2013LombardiaT. mesentericumT. mesentericum/AF516775
T29 *T. mesentericum2013Emilia RomagnaT. aestivum
T30 *T. mesentericum2013Emilia RomagnaT. aestivum
T31 *T. mesentericum2013Emilia RomagnaT. aestivum
T32*/MH992053T. mesentericum2013Emilia RomagnaT. aestivumT. mesentericum/AF516775
T33 *T. mesentericum2013Emilia RomagnaT. aestivum
T34T. mesentericum2014AbruzzoT. mesentericum
T35/MH992054T. mesentericum2014AbruzzoUncertainT. mesentericum/AF516775
T36/MH992055T. mesentericum2014AbruzzoT. mesentericumT. mesentericum/AF516769
T37/MH992056T. mesentericum2014LombardiaT. mesentericumT. mesentericum/AF516775
T38/MH992057T. mesentericum2014LombardiaT. mesentericumT. mesentericum/AF516769
T39/MH992058T. mesentericum2014LombardiaT. mesentericumT. mesentericum/AF516775
T40 */MH992060T. mesentericum2014LombardiaT. aestivumT. aestivum/AY226022
T41 *T. mesentericum2014LombardiaT. aestivum
T42/MH992061T. uncinatum2013LazioT. aestivumT. aestivum/AY226026
T43/MH992062T. aestivum2013SardegnaT. aestivumT. aestivum/AY226026
Table
Table 2. Estimates of evolutionary divergence over sequence pairs between groups. The number of base substitutions per site from averaging over all sequence pairs between groups are shown. Standard error estimate(s) are shown above the diagonal. Analyses were conducted using the Maximum Composite Likelihood model. The analysis involved 29 nucleotide sequences.
Table 2. Estimates of evolutionary divergence over sequence pairs between groups. The number of base substitutions per site from averaging over all sequence pairs between groups are shown. Standard error estimate(s) are shown above the diagonal. Analyses were conducted using the Maximum Composite Likelihood model. The analysis involved 29 nucleotide sequences.
T. aestivum CladeSub-Clade_III *Sub-Clade_I *Sub-Clade_II *Outgroup
T. aestivum clade-0.00770.00770.00880.0118
sub-clade_III *0.0334-0.00550.00660.0117
sub-clade_I *0.03380.0205-0.00630.0121
sub-clade_II *0.04090.02740.0225-0.0130
Outgroup0.06510.06250.06640.0708-
* Part of the Tuber mesentericum clade.

Share and Cite

MDPI and ACS Style

Marozzi, G.; Benucci, G.M.N.; Suriano, E.; Sitta, N.; Raggi, L.; Lancioni, H.; Baciarelli Falini, L.; Albertini, E.; Donnini, D. Tuber mesentericum and Tuber aestivum Truffles: New Insights Based on Morphological and Phylogenetic Analyses. Diversity 2020, 12, 349. https://doi.org/10.3390/d12090349

AMA Style

Marozzi G, Benucci GMN, Suriano E, Sitta N, Raggi L, Lancioni H, Baciarelli Falini L, Albertini E, Donnini D. Tuber mesentericum and Tuber aestivum Truffles: New Insights Based on Morphological and Phylogenetic Analyses. Diversity. 2020; 12(9):349. https://doi.org/10.3390/d12090349

Chicago/Turabian Style

Marozzi, Giorgio, Gian Maria Niccolò Benucci, Edoardo Suriano, Nicola Sitta, Lorenzo Raggi, Hovirag Lancioni, Leonardo Baciarelli Falini, Emidio Albertini, and Domizia Donnini. 2020. "Tuber mesentericum and Tuber aestivum Truffles: New Insights Based on Morphological and Phylogenetic Analyses" Diversity 12, no. 9: 349. https://doi.org/10.3390/d12090349

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop