Next Article in Journal
Rapid Biodistribution of Fluorescent Outer-Membrane Vesicles from the Intestine to Distant Organs via the Blood in Mice
Previous Article in Journal
DNA Interaction with Coordination Compounds of Cd(II)containing 1,10-Phenanthroline
Previous Article in Special Issue
Vx-809, a CFTR Corrector, Acts through a General Mechanism of Protein Folding and on the Inflammatory Process
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 3
10.3390/ijms25031816
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells

by
Monica De Paoli
1,
Deep Shah
1,
Alexander Zakharia
1,
Zil Patel
1,
Zinal Patel
1,2,
Pakhi Pakhi
1 and
Geoff H. Werstuck
1,2,*
1
Department of Medicine, Faculty of Health Sciences, McMaster University, 1280 Main Street W, Hamilton, ON L8S 4L8, Canada
2
Thrombosis and Atherosclerosis Research Institute, 237 Barton Street E, Hamilton, ON L8L 2X2, Canada
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(3), 1816; https://doi.org/10.3390/ijms25031816
Submission received: 13 November 2023 / Revised: 18 January 2024 / Accepted: 31 January 2024 / Published: 2 February 2024
(This article belongs to the Special Issue Research on Protein Misfolding)
Browse Figures
Versions Notes

Abstract

:
Diabetes mellitus is clinically defined by chronic hyperglycemia. Sex differences in the presentation and outcome of diabetes exist with premenopausal women having a reduced risk of developing diabetes, relative to men, or women after menopause. Accumulating evidence shows a protective role of estrogens, specifically 17-beta estradiol, in the maintenance of pancreatic beta cell health; however, the mechanisms underlying this protection are still unknown. To elucidate these potential mechanisms, we used a pancreatic beta cell line (BTC6) and a mouse model of hyperglycemia-induced atherosclerosis, the ApoE−/−:Ins2+/Akita mouse, exhibiting sexual dimorphism in glucose regulation. In this study we hypothesize that 17-beta estradiol protects pancreatic beta cells by modulating the unfolded protein response (UPR) in response to endoplasmic reticulum (ER) stress. We observed that ovariectomized female and male ApoE−/−:Ins2+/Akita mice show significantly increased expression of apoptotic UPR markers. Sham operated female and ovariectomized female ApoE−/−:Ins2+/Akita mice supplemented with exogenous 17-beta estradiol increased the expression of adaptive UPR markers compared to non-supplemented ovariectomized female ApoE−/−:Ins2+/Akita mice. These findings were consistent to what was observed in cultured BTC6 cells, suggesting that 17-beta estradiol may protect pancreatic beta cells by repressing the apoptotic UPR and enhancing the adaptive UPR activation in response to pancreatic ER stress.

1. Introduction

Diabetes mellitus is a metabolic disorder characterized by the inability of pancreatic beta cells to secrete sufficient insulin to adequately regulate blood glucose levels [1]. This condition is associated with a variety of vascular disorders including an increased risk of developing atherosclerosis, the underlying cause of cardiovascular diseases [2]. The prevalence and incidence of diabetes mellitus has been increasing worldwide due to a more sedentary lifestyle and an increased prevalence of obesity. As a result, diabetes has become a significant burden on health care and health care costs [1].
Sex differences in the prevalence and development of diabetes mellitus, and the associated cardiovascular complications, are known to exist. Premenopausal women are significantly less likely to develop these conditions relative to men, or women after menopause [3,4]. Accumulating data suggest that estrogens, particularly 17-beta estradiol which is the predominant and biologically active estrogen in premenopausal women [5], exert a protective effect in pancreatic beta cell health and function [6,7,8,9,10]. However, the mechanisms underlying this protection are still unknown.
Chronic hyperglycemia promotes insulin biosynthesis in pancreatic beta cells. Secreted proteins, like insulin, are co-translationally translocated and folded in the endoplasmic reticulum (ER). If increased protein demand overloads the ER, and the folding capacity of the ER is exceeded, unfolded or misfolded proteins can accumulate causing a condition known as ER stress [11]. Cells have developed mechanisms to restore ER homeostasis through the activation of the adaptive unfolded protein response (UPR) [12]. The adaptive UPR relieves ER stress by increasing protein folding capacity by inducing the synthesis of molecular chaperones and/or increasing the ER associated degradation (ERAD) of terminally misfolded proteins [12]. When there is protracted ER stress and homeostasis cannot be restored, the apoptotic UPR is activated, increasing the synthesis of pro-apoptotic pathways to eliminate the cell [12,13]. Secretory cells, such as pancreatic beta cells, traffic a relatively high percentage of protein synthesis to the ER and are therefore susceptible to ER stress. Several studies have shown an association between diabetes/hyperglycemia and pancreatic beta cell ER stress and apoptosis [11,14,15,16].
In this study, we investigate the effect of 17-beta estradiol on the beta cell UPR using a mouse model of hyperglycemia-induced atherosclerosis, the ApoE−/−:Ins2+/Akita mouse, which exhibits sexual dimorphism in terms of glucose regulation and atherosclerosis progression [17]. Male ApoE−/−:Ins2+/Akita mice are chronically hyperglycemic, whereas female ApoE−/−:Ins2+/Akita mice are transiently hyperglycemic, with blood glucose levels normalizing by five weeks of age, which represents the time when they reach sexual maturity. Ovariectomized female ApoE−/−:Ins2+/Akita mice are chronically hyperglycemic; however, supplementation with exogenous 17-beta estradiol restores glucose homeostasis [18]. To conduct mechanistic studies on the role of 17-beta estradiol in modulating the UPR response, we also use a murine pancreatic beta cell line, BTC6, able to secrete insulin in response to increasing glucose concentrations [19].
We hypothesize that 17-beta estradiol protects pancreatic beta cell health and function by modulating the UPR specifically by enhancing the adaptive UPR and by repressing the apoptotic UPR.

2. Results

2.1. UPR Activation in Isolated Pancreatic Islets from ApoE−/− and ApoE−/−:Ins2+/Akita Mice

We previously reported sex differences in the control of glucose homeostasis in the ApoE−/−:Ins2+/Akita mouse model [18], with male mice developing chronic hyperglycemia, and female mice showing normalized glucose levels by five weeks of age, corresponding to the age when they reach sexual maturity (Figure 1).
To determine if these changes in glucose regulation correspond to modifications in the activation of the UPR, pancreatic islets were isolated from four and eight week old male and female ApoE−/−:Ins2+/Akita mice and ApoE−/− controls. Four weeks of age corresponds to a time where both male and female ApoE−/−:Ins2+/Akita mice are hyperglycemic, and eight weeks of age corresponds to a time when male ApoE−/−:Ins2+/Akita mice are hyperglycemic whereas glucose levels have normalized in females. Total RNA was isolated from the islets and the expression of specific UPR genes was quantified. We observed that 8 week old female ApoE−/−:Ins2+/Akita mice present with a significant increase in the expression of markers of the adaptive UPR, compared to four week old female ApoE−/−:Ins2+/Akita mice or age matched ApoE−/− controls (Figure 2). The adaptive markers include Grp78, an ER resident chaperone involved in protein folding [20], and ER-associated protein degradation-enhancing alpha-mannosidase-like protein (Edem), which is involved in the process of endoplasmic reticulum-associated protein degradation (ERAD) [21]. In addition, protein disulfide isomerase (Pdi) isoforms Pdia1, Pdia3, Pdia4, Pdia6, which are known to play a role in cell survival under conditions of ER stress, were analyzed [22]. Pdia3 and Pdia6 are also significantly induced in 8 week old female ApoE−/−:Ins2+/Akita mice relative to 4 week old female mice. No significant changes were detected in the expression of the examined adaptive UPR markers from male ApoE−/−:Ins2+/Akita mice (Figure 2). In contrast, the markers of the apoptotic UPR, Atf4 and Gadd153/Chop, are not induced in female ApoE−/−:Ins2+/Akita mice (Figure 2), but are significantly increased in male ApoE−/−:Ins2+/Akita mice at 4 and 8 weeks of age, respectively (Figure 2).

2.2. UPR Activation in Pancreatic Islets from ApoE−/− and ApoE−/−:Ins2+/Akita Mice

We previously reported the effects of estrogen depletion and 17-beta estradiol supplementation on glucose regulation in the ApoE−/−:Ins2+/Akita mouse model [18]. Specifically, ovariectomized female ApoE−/−:Ins2+/Akita mice remain chronically hyperglycemic, compared to sham operated female ApoE−/−:Ins2+/Akita mice and ApoE−/− controls further confirmed in Figure 1. Ovariectomized female ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol have normalized blood glucose levels, compared to sham operated female ApoE−/−:Ins2+/Akita mice and ApoE−/− controls. Blood glucose levels are only transiently improved in male ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol. In our previous study, we reported that the changes in fasting blood glucose levels are consistent with differences in pancreatic beta cell mass and glucose tolerance [18]. Specifically, ovariectomized female ApoE−/−:Ins2+/Akita mice show a significant reduction in pancreatic beta cell mass and impaired glucose tolerance, compared to sham operated female ApoE−/−:Ins2+/Akita mice, and 17-beta estradiol supplementation is able to rescue this phenotype. Male ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol do not preserve beta cell mass; however, glucose tolerance is improved, compared to male ApoE−/−:Ins2+/Akita mice not supplemented with 17-beta estradiol.
Metabolic parameters are consistent with our previous analysis, as we observed no significant differences in body weight across the male experimental groups as well as the female experimental group (Table 1 and Table 2) [18].
To determine the effects of 17-beta estradiol supplementation on UPR activation, male and ovariectomized female ApoE−/−:Ins2+/Akita mice were implanted with a slow release 17-beta estradiol pellet at four weeks of age and pancreata were harvested at eighteen weeks of age. The expression of the adaptive UPR markers GRP78/GRP94 in sham operated female and ovariectomized female ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol is significantly increased, compared to ovariectomized female ApoE−/−:Ins2+/Akita mice (Figure 3). No significant differences are observed in male ApoE−/−:Ins2+/Akita mice. PDI expression was significantly induced in the ovariectomized female ApoE−/−:Ins2+/Akita mice, compared to the other female experimental groups (Figure 4), whereas no significant differences were observed in the expression of this adaptive UPR marker across the male experimental groups.
The apoptotic UPR marker ATF4 was significantly increased in the ovariectomized female ApoE−/−:Ins2+/Akita mice, but supplementation with17-beta estradiol in ovariectomized female ApoE−/−:Ins2+/Akita mice significantly downregulates the expression of this marker to levels comparable to sham operated ApoE−/−:Ins2+/Akita mice and the ApoE−/− controls (Supplementary Figure S1). No significant differences in ATF4 expression were observed in male ApoE−/−:Ins2+/Akita mice in the presence or absence of supplemented 17-beta estradiol, relative to the ApoE−/− controls. Similarly to what was observed with ATF4, the expression of GADD153/CHOP is significantly induced in the ovariectomized female ApoE−/−:Ins2+/Akita mice (Figure 5). Ovariectomized female ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol do not show an increase in the expression of this apoptotic UPR marker. The expression of GADD153/CHOP was significantly higher in male ApoE−/−:Ins2+/Akita mice compared to ApoE−/− controls. Supplementation with 17-beta estradiol reduced GADD153/CHOP to levels comparable to ApoE−/− controls.

2.3. Effects of 17-Beta Estradiol in the Modulation of the Adaptive UPR in a Pancreatic Beta Cell Line

To determine if 17-beta estradiol has an effect on BTC6 viability, cells were exposed to increasing concentrations of this hormone. There were no significant differences in cell viability for any concentrations analyzed (Supplementary Figure S2), therefore a concentration of 1 µM 17-beta estradiol was selected for further analysis.
To explore the mechanistic aspect of the effects of 17-beta estradiol in the presence of ER stress, BTC6 cells were pretreated with 17-beta estradiol for 24 h and subsequently challenged for 4 or 8 h with ER stress inducers; glucose (increasing concentrations of 11 mM, 25 mM, and 35 mM), tunicamycin (0.125 µM), or thapsigargin (0.25 µg/mL). Mannitol (30 mM) was used as an osmotic control. Cells were exposed to ER stress inducers for 4 or 8 h to evaluate the effects of these treatments on both adaptive and apoptotic UPR activation. We previously observed that BTC6 cells exposed to high glucose concentrations showed increased expression of UPR markers (Supplementary Figure S3).
After 8 h of exposure to 11 mM glucose, 17-beta estradiol pretreatment significantly increases the expression of Grp78 in BTC6 cells (Figure 6). In cells challenged with ER stress inducers tunicamycin and thapsigargin, 17-beta estradiol treatment increases the expression of this adaptive UPR marker after 4 h of exposure. At 8 h exposure, Grp78 is still significantly induced in cells supplemented with 17-beta estradiol and exposed to thapsigargin; however, a reduction in this marker’s expression can be observed in cells pretreated with 17-beta estradiol and challenged with tunicamycin.
The expression of other adaptive UPR markers such as the Pdi isoforms (Pdia1, Pdia3, Pdia4, Pdia6) and Edem was also analyzed (Supplementary Figures S4–S8). Pdia1 and Pdia3 isoforms are significantly induced in cells pretreated with 17-beta estradiol and exposed to 25 mM glucose, tunicamycin and thapsigargin. Glucose did not induce the expression of the Pdia4 isoform whereas a significant increase can be observed in cells pretreated with 17-beta estradiol and challenged with tunicamycin at 4 h of exposure, and with thapsigargin at both time points analyzed.
17-beta estradiol significantly increases the expression of the Pdia6 isoform in cells exposed to 11 mM glucose or after 4 h of exposure to thapsigargin, relative to those not receiving the hormone pretreatment. Tunicamycin does not seem to induce the expression of Pdia6 isoforms.
No significant differences in the expression of Edem were observed in pancreatic BTC6 cells challenged with increasing glucose concentrations or tunicamycin. After 8 h of exposure, Edem was significantly induced in cells challenged with thapsigargin; however, 17-beta estradiol did not appear to have any effect on this induction.

2.4. Effects of 17-Beta Estradiol in the Modulation of the Apoptotic UPR in a Pancreatic Beta Cell Line

To assess the effects of 17-beta estradiol on the apoptotic UPR, the expression of Atf4 and Gadd153/Chop was analyzed. Increasing glucose concentrations, tunicamycin, and thapsigargin do not induce significant differences in the expression of the apoptotic UPR marker Atf4 after 4 h of exposure (Supplementary Figure S9). After 8 h, 17-beta estradiol pretreatment significantly increases the expression of Atf4 in pancreatic BTC6 cells challenged with 25 mM glucose. ATF4 is significantly increased in pancreatic beta TC6 cells challenged with thapsigargin for 8 h, compared to the controls and to cells pretreated with 17-beta estradiol and challenged with this ER stress inducer.
The expression of the apoptotic UPR marker Gadd153/Chop is significantly reduced by pretreatment with 17-beta estradiol in pancreatic BTC6 cells exposed to 35 mM glucose after 4 h of exposure (Figure 6). No significant differences in the expression of Gadd153/Chop are observed after 8 h of exposure to increasing glucose concentrations. 17-beta estradiol pretreatment significantly reduces the expression of Gadd153/Chop after 4 h of exposure to both tunicamycin and thapsigargin, relative to the controls.

3. Discussion

Sex differences in the development of diabetes do exist, with premenopausal women appearing to be protected from diabetes compared to men and postmenopausal women. This suggests that estrogens, and perhaps other sex hormones, play a protective role [23]. At least part of this protective effect appears to be linked to estrogen’s ability to modulate the UPR and alleviate ER stress, a condition that can be found in pancreatic beta cells under conditions of chronic hyperglycemia, such as diabetes [24]. We hypothesize that 17-beta estradiol, the predominant estrogen in premenopausal women, protects pancreatic beta cell health and function by enhancing the adaptive UPR and repressing the apoptotic UPR.
To test this hypothesis we used a mouse model of hyperglycemia-induced atherosclerosis, the ApoE−/−:Ins2+/Akita mouse. This mouse strain contains the Akita mutation, which is characterized by a point mutation in one allele of the Ins2 gene (C96Y) that leads to insulin misfolding [17]. This mouse model is notable because it shows sexual dimorphism in glucose regulation, with male ApoE−/−:Ins2+/Akita mice remaining chronically hyperglycemic, and females being only transiently hyperglycemic [17,18]. Blood glucose levels in female ApoE−/−:Ins2+/Akita mice normalize by five weeks of age which, as previously reported by our group, represents the time when these mice become sexually mature, and 17-beta estradiol and other estrogens’ levels increase (Figure 1) [18].
We quantified the expression of UPR genes in isolated pancreatic islets from male and female ApoE−/−:Ins2+/Akita mice and age matched ApoE−/− controls at four and eight weeks of age, as these ages bracket the observed normalization of blood glucose levels and the attainment of sexual maturity observed in female ApoE−/−:Ins2+/Akita mice (Figure 2). We observed that the normalization of blood glucose levels in female ApoE−/−:Ins2+/Akita mice is associated with the activation of the adaptive UPR. Specifically, there is an increase in the expression of ER resident chaperone Grp78 involved in protein folding, Edem which is part of ERAD, and certain Pdi isoforms which are involved in the formation of disulfide bonds, a crucial step for the proper folding and processing of insulin. Conversely, in male ApoE−/−:Ins2+/Akita mice, the adaptive UPR is not significantly induced, but there is a significant increase in the apoptotic UPR markers Atf4 and Gadd153/Chop, compared to age-matched ApoE−/− controls. These findings are consistent with previous observations showing that male ApoE−/−:Ins2+/Akita mice have a significant loss of beta cell mass and are chronically hyperglycemic. This suggests that 17-beta estradiol levels could exert a protective effect on pancreatic beta cells preventing apoptosis by inhibiting the apoptotic UPR [18].
To investigate the effects of 17-beta estradiol depletion, mice were subjected to ovariectomy, a surgical procedure that significantly reduces the levels of circulating estrogens. Our results show that ovariectomy promotes a chronic hyperglycemic phenotype in female ApoE−/−:Ins2+/Akita mice (Figure 1). Consistent with results on gene expression analysis in the isolated pancreatic islets, pancreatic sections show that GRP78/94 proteins are significantly induced in sham operated female ApoE−/−:Ins2+/Akita mice, but not in the age-matched ovariectomized female ApoE−/−:Ins2+/Akita mice (Figure 3). Pancreatic sections of male ApoE−/−:Ins2+/Akita mice do not show significantly induced expression of GRP78/94, compared to age-matched controls. It is possible that the reduction in the expression of GRP78/94 in pancreatic sections of male and female ovariectomized ApoE−/−:Ins2+/Akita mice may be a result of pancreatic islet damage as previously reported by Li et al., who observed that ApoE−/− mice fed a high fat diet showed significant glucose impairment [25]. Further studies on this mouse model are needed to test this hypothesis. We also observed that the expression of PDI is significantly induced in the ovariectomized female ApoE−/−:Ins2+/Akita mice, but not in the sham operated or ovariectomized female ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol (Figure 4). This could be explained by the fact that PDI is directly involved in aiding in the formation of disulfide bonds, which is an important aspect of insulin processing and maturation. Furthermore, the antibody used is aimed at recognizing the PDI isoform PDIa1, which is known to play a role in proinsulin folding both in vivo and in vitro [22,26]. Ovariectomized female ApoE−/−:Ins2+/Akita mice are hyperglycemic, therefore the demand for insulin is significantly increased, compared to that of normoglycemic sham operated female, or female ovariectomized ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol. Hence, ovariectomized female ApoE−/−:Ins2+/Akita mice likely require an increased expression of PDI to normalize blood glucose levels. These results, along with our in vitro observations on PDI, show that the expression of PDI is differentially regulated relative to other UPR markers. Further studies are needed to test this hypothesis.
In terms of the apoptotic UPR, male ApoE−/−:Ins2+/Akita mice do show a significant increase in the expression of GADD153/CHOP, compared to ApoE−/−:Ins2+/Akita mice supplemented with 17-beta estradiol and ApoE−/− controls (Figure 5). Similar to male ApoE−/−:Ins2+/Akita mice, pancreatic sections of ovariectomized female ApoE−/−:Ins2+/Akita mice show increased expression of the apoptotic UPR markers, ATF4 and GADD153/CHOP, but supplementation of 17-beta estradiol downregulates this expression.
To more closely investigate the mechanisms and the pathways involved in this response, we carried out in vitro experiments in the cultured pancreatic beta cell line BTC6, exposing BTC6 cells to ER stress inducers for 4 or 8 h. Consistent with the in vivo findings, our studies in BTC6 cells show that 17-beta estradiol pretreatment significantly increases the expression of Grp78 in cells challenged with 11 mM glucose for 8 h (Figure 6). Consistent with a previous study characterizing this cell line, we observed the maximum glucose stimulated insulin release from these cells in the presence of 11 mM glucose (Supplementary Figure S10) [27]. This suggests that the necessity of synthesizing increased quantities of insulin in response to higher glucose concentrations might induce a status of protracted ER stress, which can be rescued by 17-beta estradiol. In accordance with these findings, pre-treatment with 17-beta estradiol significantly reduces the expression of the apoptotic UPR marker Gadd153/Chop in cells challenged with all ER stress inducers (Figure 6). Taken together, these findings indicate that 17-beta estradiol enhances the adaptive UPR in short-term exposure and inhibits the activation of the apoptotic UPR in conditions of protracted ER stress after 8 h of exposure.
Similar to what was observed in pancreatic islets, 17-beta estradiol significantly increased the expression of the isoforms Pdia3 and Pdia6, which are known to play a role in contributing to cell survival under conditions of ER stress [22,28]. We also observed that Pdia1, which in vitro has shown to aid in proper maturation of proinsulin [26], was also increased in cells pretreated with 17-beta estradiol and challenged with 25 mM glucose (Supplementary Figure S4). In contrast to what was observed in isolated pancreatic islets, no significant differences were observed in Edem expression in BTC6 cells (Supplementary Figure S8). This could be explained by the fact that the nature of the ER stress differed in the islets, derived from the ApoE−/−:Ins2+/Akita mice, compared to the BTC6 cell line, which does not present with the Akita mutation. Therefore, the amount of terminally misfolded insulin in the cell line is likely much less than what observed in mice, and not enough to trigger a significant increase in the ERAD. One limitation of this study was our inability to accurately measure insulin and C peptide levels in the ApoE−/−:Ins2+/Akita mouse model. Several attempts, using different ELISA and HTRF systems were not successful. It is likely that the mutation typical of this strain interferes with the detection of insulin and C peptide.
To further investigate the role of estrogen in alleviating protein misfolding and confirm the role of Pdi observed in our animal and cell experiments, further analysis using computer assisted molecular modeling methods, biophysical techniques such as thioflavin (ThT) fluorescence, or nuclear magnetic resonance spectroscopy (NMR), could shed more light on the process of protein misfolding in diabetes and how estradiol can modulate the UPR to alleviate this condition [29,30,31,32]. These techniques could provide more information on the effects of estrogen by measuring endoplasmic reticulum stress in real time in the case of ThT fluorescence and characterize possible interactions and potential alterations in protein structure as is the case of NMR [29,30,31,32].
It is notable that relatively high levels of glucose (35 mM) are required to induce ER stress in the BTC6 cell line. We also used supraphysiological concentrations of 17-beta estradiol to ensure the observation of the effects of this hormone on UPR activation in response to ER stress. This is likely due, at least in part, to the acute nature of experiments in cultured cells as well as the features of this cell line [19,27]. One interesting observation from the in vitro experiments is that the pretreatment with 17-beta estradiol did not significantly affect UPR gene expression in the absence of ER stress. Thus, it appears that 17-beta estradiol may modulate an aspect of the UPR pathway. Future experiments will investigate the effects of 17-beta estradiol on the three main UPR regulators (inositol-requiring protein 1, IRE1, PKR-like endoplasmic reticulum kinase, PERK, and activating transcription factor-6, ATF-6), as well as an analysis of which specific estrogen receptors are involved in this process. These studies may also shed light on the reasons for the transient protection that 17-beta estradiol confers to male ApoE−/−:Ins2+/Akita mice.
It is important to note that obesity is a strong risk factor for that type 2 diabetes mellitus and studies have shown that obesity is associated with conditions of ER stress [33,34,35,36]. In a clinical study, adipose biopsies showed a significant increase in the expression of ER stress markers, and that these correlate with increased body mass indexes and percent fat [33]. Interestingly, a recent clinical study showed that bariatric surgery ameliorated the expression of ER stress markers [36]. Our findings may suggest a potential role for 17-beta estradiol in reducing ER stress by enhancing the adaptive UPR and restoring homeostasis in the pancreas as well as other tissues involved in glucose homeostasis such as the adipose tissue. Further studies will be required to confirm the modulation of ER stress in the adipose tissue by 17-beta estradiol.
It should also be noted that prolactin is involved in the upregulation of pancreatic beta cell mass, stimulating pancreatic beta cell replication in pancreatic islets as well as insulinoma cells [37,38,39]. It has been reported that ovariectomy can impair the secretion of prolactin [40]. Further studies should be conducted to evaluate whether the female ovariectomized ApoE−/−:Ins2+/Akita mice show significant alterations in prolactin secretion, and whether this is associated with the loss of pancreatic beta cell mass and an impairment of glucose tolerance. In our previous analysis we observed that 17-beta estrogen supplementation in ovariectomized female ApoE−/−:Ins2+/Akita mice maintains beta cell mass and improves glucose tolerance, compared to ovariectomized female ApoE−/−:Ins2+/Akita mice [18].
Overall, our findings suggest that, under conditions that stimulate ER stress, such as chronic hyperglycemia, 17-beta estradiol exerts a protective effect by enhancing the adaptive UPR and repressing the apoptotic UPR. The results from our animal studies are consistent with various in vitro studies showing that 17-beta estradiol has a similar modulation of the adaptive and apoptotic UPR in different cell types. A study in a human gastric adenocarcinoma cell line treated with an ER stress inducer, tunicamycin, showed that those treated with 17-beta estradiol significantly reduced ER stress-induced apoptosis [41]. A similar result was also observed in another study using a mouse-derived osteoblast cell line, where ER stress was induced using another ER stress inducer, thapsigargin [42]. In this case, 17-beta estradiol was able to reduce ER stress by increasing the expression of the protein chaperone GRP78, as well as repressing apoptosis by inhibiting the caspase cascade. Finally, a study examining the pancreatic cell line INS1 showed that 17-beta estradiol was able to reduce the levels of ER stress in the presence of high glucose levels, protecting these cells from cell death [24].

4. Materials and Methods

  • Animal models
Male ApoE−/−:Ins2+/Akita mice were crossed with female ApoE−/−:Ins2+/+ mice to create the experimental ApoE−/−:Ins2+/Akita mouse strain. Genotypes were confirmed using PCR by methods previously described [17,18]. All experimental mice received a standard diet (2018 Teklad Global 18% Protein Rodent Diet, Harlan Teklad, Madison, WI, USA) ad libitum, with free access to water. Subsets of female ApoE−/−:Ins2+/Akita mice underwent ovariectomy at 4 weeks of age with the experimental endpoint at 25 weeks of age. Additional subsets of female ApoE−/−:Ins2+/Akita mice were ovariectomized at four weeks of age, and received a subcutaneous 17-beta estradiol pellet implant (0.1 mg, 90 days release, Innovative Research of America, Sarasota, FL, USA). A subset of male ApoE−/−:Ins2+/Akita mice also received the 17-beta estradiol pellet implant at four weeks of age. The pellet was implanted subcutaneously on the lateral side of neck between the ear and the shoulder of the mouse. This pellet continuously releases 17-beta estradiol at a dose of 0.1 mg/pellet for 90 days allowing the hormone to circulate at a physiological range [43,44,45]. The experimental endpoint for mice receiving the 17-beta estradiol pellet and their respective controls was 18 weeks of age. All animal procedures were pre-approved by the McMaster University Animal Research Ethics Board.
  • Ovariectomy
Ovariectomies were performed using methods previously described [17,46]. Mice at four weeks of age (n = 5–10 per experimental group) were anesthetized using isoflurane (5% induction, 2.5% maintenance of anaesthesia). A 3 × 3 cm incision area surrounding the iliac crest was shaved and cleaned, and a midline horizontal incision through the skin was performed. The ovary was identified, and an incision was made through the muscle layer to reach the abdominal cavity. The ovary was pulled out by gently removing the surrounding fat pad from the abdominal cavity. The uterine horn and vessels were double ligated (0.7 cm and 1 cm distally from the ovary), and the ovary was excised. The remaining tissue was put back in the abdominal cavity, and the incision was sutured. The contralateral ovary was removed in a similar fashion. The skin wound was closed using a wound clipper. Sham operated animals (n = 5–10 per experimental group) received the same incisions and isolation of ovaries; however, ovaries were not removed.
  • Tissue harvesting
Mice were anesthetized with isoflurane and euthanized by cervical dislocation. Vasculature was rinsed with phosphate-buffered saline. Pancreata were collected and fixed in 10% neutral-buffered formalin and stored at room temperature.
  • Analysis of the pancreas
Pancreata from male and female ApoE−/− and ApoE−/−:Ins2+/Akita mice were harvested at 18 or 25 weeks of age. Immunohistochemical or immunofluorescent staining for the following UPR markers was performed using the indicated antibodies at the reported dilutions: glucose-regulated protein 78/94, GRP78/GRP94 (monoclonal mouse KDEL antibody, ADI-SPA-827-J, Enzo/Cedarlane, Burlington, ON, Canada, 1:250 dilution), growth arrest and DNA damage-inducible gene/C/EBP Homologous Protein, GADD153/CHOP (monoclonal mouse GADD153 (B3) sc-7531, Santa Cruz Biotechnology, Dallas, TX, USA, 1:50 dilution), protein disulfide isomerase, PDI (monoclonal mouse antibody, ADI-SPA-891-F, Enzo/Cedarlane, Burlington, ON, Canada, 1:200 dilution), activating transcription factor 4, ATF4 (polyclonal rabbit antibody, 10835-1-AP, Thermo Fischer, Mississauga, ON, Canada, 1:200 dilution). Secondary antibodies used were goat anti-mouse biotinylated IgM (BA 2020, Vector, Burlington, ON, Canada), Alexa Fluor 488 goat anti-mouse IgG (A11001, Thermo Scientific, Middletown, VA, USA), Alexa Fluor 488 goat anti-rabbit IgG (A11008, Thermo Scientific, Middletown, VA, USA), at a dilution of 1:200 each. All immunofluorescent staining experiments were counterstained with 4′-6′-diamidino-2-phenylindole, DAPI (Invitrogen, Carlsbad, CA, USA, 1:5000 dilution). Separate sections were stained with pre-immune IgG instead of the primary antibody, to control for non-specific staining. Immunohistochemistry used the developer reagent DAB+ Substrate Chromogen System (DAKO, K3468, Agilent Technologies, Santa Clara, CA, USA) as directed by the manufacturer.
Staining was performed on paraffin-embedded sections of pancreas (6 µm thick) from male and female ApoE−/− and ApoE−/−:Ins2+/Akita mice. The entire pancreas was analyzed at 180 µm intervals for a comprehensive overview of the islets within the organ. A total of six sections per mouse were used to perform immunohistochemical and immunofluorescent analysis, and a total of n = 12–20 islets per mouse were selected for the intensity of fluorescence analysis. A total of n = 5–8 mice per experimental group were analyzed. Immunofluorescence intensity was visualized, and images were captured using a Leica STELLARIS 5 confocal microscope. Analysis was performed using ImageJ software 1.53k (NIH, Bethesda, MD, USA; http://imagej.nih.gov/ij, accessed date 28 June 2021). The intensity of fluorescence staining for each mouse was calculated as follows:
Intensity of fluorescence = (average intensity of fluorescence of the pancreatic islets per mouse adjusted for islet area) − (average intensity of fluorescence of the pancreatic islets of the negative control adjusted for islet area).
Immunohistochemical analysis was captured using a Leitz LABORLUX S microscope connected to a DP71 Olympus camera. Quantification of GADD153/CHOP was performed by counting the brown-stained nuclei versus the total number of nuclei in the islet (n = 12–20 islets per mouse; n = 4–8 mice per experimental group).
  • Islet isolation
Pancreatic islet isolation was carried out using established methods [47,48]. Pancreata were excised from 4 or 8 week old mice and placed in collagenase (Collagenase type XI, C7657, Sigma Aldrich, Oakville, ON, Canada) at 37 °C for digestion, and hand shaken regularly for 20 min. Islets were isolated on a histopaque gradient (Histopaque 1119, 11,191 and Histopaque 1077, 10,771, Sigma Aldrich, Oakville, ON, Canada), and washed with Hank’s Balanced Salt Solution (HBSS). Each islet sample represents pooled islets from 4–8 mice pancreata. A total of n = 3–6 samples per experimental group were analyzed.
  • Cell line and cell experiments
Cell experiments were performed using the adherent pancreatic beta cell line TC6 (BTC6, CRL-11506, ATCC, Manassas, VA, USA), which is capable of secreting insulin in response to increasing glucose concentrations (Supplementary Figure S10) [19,27]. BTC6 cells were determined to be of female origin (Supplementary Figure S11). BTC6 cells were cultured in an incubator at 37 °C, 95% air, 5% CO2 using the ATCC-formulated Dulbecco’s Modified Eagle’s medium, DMEM (ATCC 30-2002, ATCC, Manassas, VA, USA) supplemented with 15% heat-inactivated Fetal Bovine Serum, FBS (F2242, Sigma Aldrich, Oakville, ON, Canada), and 1% penicillin-streptomycin (PenStrep, 10,000 U/mL, GIBCO, Thermo Scientific, Middletown, VA, USA). Cells were passaged using trypsin-EDTA 0.05% with phenol red (25300054, Thermo Scientific, Middletown, VA, USA). All experiments were conducted using cells between passages 4 and 10. To eliminate extraneous estrogen and estrogen-like effects, all experiments were performed using phenol red free DMEM (DMEM 4.5 mM glucose with L-glutamine, 30-2002, Cedarlane, Burlington, ON, Canada) supplemented with 15% charcoal-stripped (CS) FBS, (F6765-500ML, Sigma Aldrich, Oakville, ON, Canada), and 1% penicillin-streptomycin.
Cell viability was determined by plating BTC6 cells (cell seeding 100,000 cells per well) in a 96 well. Cells were cultured with phenol red free-CS-DMEM for three days and medium was replaced with fresh phenol red free-CS-DMEM containing increasing concentrations of 17-beta estradiol (E2758-250MG, Sigma Aldrich, Oakville, ON, Canada), and 10% v/v Alamar blue reagent (alamarBlue®, BUF012A, Bio-Rad, Mississauga, ON, Canada). Cells were placed in an incubator at 37 °C in humidified 95% air, 5% CO2. Cell viability was measured at 24 h using a spectrophotometer (SpectraMax Plus 384 Microplate Reader, Molecular Devices, San Jose, CA, USA) with excitation at 570 nm and emission at 600 nm.
To determine the effects of 17-beta estradiol on UPR modulation, BTC6 cells were cultured in 24 well plates (cell seeding 300,000 cells/well) for three days with phenol red free-CS-DMEM in an incubator at 37 °C, 95% air, 5% CO2. Medium was replaced on the third day and cells were pretreated with 1 µM 17-beta estradiol in phenol red free-CS-DMEM for 24 h. Subsequently, subsets of cells were exposed to increased glucose concentrations (11 mM, 25 mM, or 35 mM), or ER stress inducers tunicamycin (0.125 µg/mL) or thapsigargin (0.25 µM), or the osmotic control mannitol (30 mM). Samples were collected after 4 and 8 h of exposure for gene expression analysis. For all in vitro experiments, n = 3–4 samples per experimental condition were used, and each sample was analyzed in duplicate.
A stock of 17-beta estradiol (100 mM) was diluted in 100% ethanol according to the manufacturer’s recommendations. Serial dilutions were prepared by diluting the 100 mM stock to 10 mM in 50% ethanol, and furthermore to 1 mM in sterile dH2O. Working concentrations of 1 µM 17-beta estradiol were prepared by serial diluting the 1 mM stock in phenol red-free-CS-DMEM. This method allows for ethanol concentration to be significantly reduced so that a vehicle control is not needed.
  • Gene expression analysis by qRT-PCR
Total RNA from pancreatic islets or harvested samples of BTC6 cells were isolated using TRIzol reagent (TRIzol®, 15596-018, Life Technologies, Burlington, ON, Canada). mRNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems, Foster City, CA, USA). Real time PCR amplification was performed using SYBR green (SensiFAST™ SYBR Hi-ROX kit, Bioline, Wolston, Warrington, UK) reagent. Transcript amplification was normalized to the reference gene beta actin. Primers sequences are listed in Table 3. Analysis of housekeeping genes was performed using previously described methods [49]. Beta actin was selected as the reference gene as it presented the least variability among experimental groups, compared to other reference genes tested, Cyclophilin A and Hprt1 (Supplementary Figures S12 and S13). Data were normalized to the internal control Beta actin and then further normalized to ApoE−/− controls (for transcripts of isolated pancreatic islets), or the untreated control (for BTC6). Controls are set to “1.0”.
Each islet sample represents pooled islets from 4–8 mice pancreata. A total of n = 3–6 samples per experimental group were analyzed. For all qRT-PCR analysis, all biological replicates were analyzed in technical duplicates, and each biological replicate represents the average of the technical duplicates.
  • Statistical Analysis
Statistical analysis of multiple groups was assessed using t-test, one-way or two-way analysis of variance (ANOVA), where appropriate. Data are presented as mean ± standard error of the mean (SEM). Analyses were performed using ImageJ. A value of p < 0.05 was considered statistically significant.

5. Conclusions

Taken together, these results could provide a possible explanation of why pre-menopausal women have a lower risk of developing diabetes than men or post-menopausal women [3,24,41,42,50]. Further research will be needed to determine the specific molecular mechanisms by which 17-beta estradiol enhances the adaptive UPR and represses the apoptotic UPR under conditions of ER stress such as those observed during protracted hyperglycemia.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25031816/s1.

Author Contributions

Conceptualization of study M.D.P. and G.H.W.; methodology, M.D.P.; validation, M.D.P., D.S., A.Z., Z.P. (Zil Patel), Z.P. (Zinal Patel) and P.P.; formal analysis, M.D.P., D.S., A.Z., Z.P. (Zil Patel), Z.P. (Zinal Patel) and P.P.; investigation, M.D.P., D.S., A.Z., Z.P. (Zil Patel), Z.P. (Zinal Patel) and P.P.; data curation, M.D.P., D.S., A.Z., Z.P. (Zil Patel), Z.P. (Zinal Patel) and P.P.; writing—original draft preparation, M.D.P.; writing—review and editing, M.D.P. and G.H.W.; visualization, M.D.P., D.S., A.Z., Z.P. (Zil Patel), Z.P. (Zinal Patel) and P.P.; supervision, G.H.W.; funding acquisition, G.H.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by operational grants from the Canadian Institutes for Health Research (CIHR, PJT-166092) and Heart and Stroke Foundation of Canada (HSFC, G21-0031494). GHW holds the ISTH-McMaster Chair in Thrombosis and Haemostasis Research and is supported by a HSFC Ontario Mid-Career Investigator Award.

Institutional Review Board Statement

All animal procedures were pre-approved by the McMaster University Animal Research Ethics Board (Animal Utilization Protocol number 21-02-07, date of approval 21 March 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

Supplementary data can be found at DOI 10.6084/m9.figshare.24201456 (https://figshare.com/articles/figure/supplementary_figures_De_Paoli_2023_pdf/24201456, accessed on 19 January 2024).

Acknowledgments

We acknowledge Yuanyuan Shi for the expert technical assistance on sex determination of BTC6 cells.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Sun, H.; Saeedi, P.; Karuranga, S.; Pinkepank, M.; Ogurtsova, K.; Duncan, B.B.; Stein, C.; Basit, A.; Chan, J.C.; Mbanya, J.C.; et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res. Clin. Pract. 2022, 183, 109119. [Google Scholar] [CrossRef]
  2. D’Souza, A.; Hussain, M.; Howarth, F.C.; Woods, N.M.; Bidasee, K.; Singh, J. Pathogenesis and pathophysiology of accelerated atherosclerosis in the diabetic heart. Mol. Cell Biochem. 2009, 331, 89–116. [Google Scholar] [CrossRef]
  3. Raparelli, V.; Morano, S.; Franconi, F.; Lenzi, A.; Basili, S. Sex Differences in Type-2 Diabetes: Implications for Cardiovascular Risk Management. Curr. Pharm. Des. 2017, 23, 1471–1476. [Google Scholar] [CrossRef]
  4. Appelman, Y.; van Rijn, B.B.; Ten Haaf, M.E.; Boersma, E.; Peters, S.A.E. Sex differences in cardiovascular risk factors and disease prevention. Atherosclerosis 2015, 241, 211–218. [Google Scholar] [CrossRef]
  5. Nilsson, S.; Mäkelä, S.; Treuter, E.; Tujague, M.; Thomsen, J.; Andersson, G.; Enmark, E.; Pettersson, K.; Warner, M.; Gustafsson, J.A. Mechanisms of estrogen action. Physiol. Rev. 2001, 81, 1535–1565. [Google Scholar] [CrossRef]
  6. Gupte, A.A.; Pownall, H.J.; Hamilton, D.J. Estrogen: An emerging regulator of insulin action and mitochondrial function. J. Diabetes Res. 2015, 2015, 916585. [Google Scholar] [CrossRef] [PubMed]
  7. Yamabe, N.; Kang, K.S.; Zhu, B.T. Beneficial effect of 17β-estradiol on hyperglycemia and islet β-cell functions in a streptozotocin-induced diabetic rat model. Toxicol. Appl. Pharmacol. 2010, 249, 76–85. [Google Scholar] [CrossRef] [PubMed]
  8. de Ritter, R.; de Jong, M.; Vos, R.C.; van der Kallen, C.J.H.; Sep, S.J.S.; Woodward, M.; Stehouwer, C.D.A.; Bots, M.L.; Peters, S.A.E. Sex differences in the risk of vascular disease associated with diabetes. Biol. Sex. Differ. 2020, 11, 1. [Google Scholar] [CrossRef]
  9. Kautzky-Willer, A.; Leutner, M.; Harreiter, J. Sex differences in type 2 diabetes. Diabetologia 2023, 66, 986–1002. [Google Scholar] [CrossRef]
  10. Tramunt, B.; Smati, S.; Grandgeorge, N.; Lenfant, F.; Arnal, J.-F.; Montagner, A.; Gourdy, P. Sex differences in metabolic regulation and diabetes susceptibility. Diabetologia 2020, 63, 453–461. [Google Scholar] [CrossRef] [PubMed]
  11. Cnop, M.; Toivonen, S.; Igoillo-Esteve, M.; Salpea, P. Endoplasmic reticulum stress and eIF2α phosphorylation: The Achilles heel of pancreatic β cells. Mol. Metab. 2017, 6, 1024–1039. [Google Scholar] [CrossRef] [PubMed]
  12. Rutkowski, D.T.; Kaufman, R.J. That which does not kill me makes me stronger: Adapting to chronic ER stress. Trends Biochem. Sci. 2007, 32, 469–476. [Google Scholar] [CrossRef] [PubMed]
  13. Iurlaro, R.; Muñoz-Pinedo, C. Cell death induced by endoplasmic reticulum stress. FEBS J. 2016, 283, 2640–2652. [Google Scholar] [CrossRef] [PubMed]
  14. Pandey, V.K.; Mathur, A.; Kakkar, P. Emerging role of Unfolded Protein Response (UPR) mediated proteotoxic apoptosis in diabetes. Life Sci. 2019, 216, 246–258. [Google Scholar] [CrossRef]
  15. Maamoun, H.; Abdelsalam, S.S.; Zeidan, A.; Korashy, H.M.; Agouni, A. Endoplasmic Reticulum Stress: A Critical Molecular Driver of Endothelial Dysfunction and Cardiovascular Disturbances Associated with Diabetes. Int. J. Mol. Sci. 2019, 20, 1658. [Google Scholar] [CrossRef]
  16. Ghosh, R.; Colon-Negron, K.; Papa, F.R. Endoplasmic reticulum stress, degeneration of pancreatic islet β-cells, and therapeutic modulation of the unfolded protein response in diabetes. Mol. Metab. 2019, 27, S60–S68. [Google Scholar] [CrossRef]
  17. Venegas-Pino, D.E.; Wang, P.-W.; Stoute, H.K.; Singh-Pickersgill, N.A.; Hong, B.Y.; Khan, M.I.; Shi, Y.; Werstuck, G.H. Sex-Specific Differences in an ApoE(−/−):Ins2(+/Akita) Mouse Model of Accelerated Atherosclerosis. Am. J. Pathol. 2016, 186, 67–77. [Google Scholar] [CrossRef]
  18. De Paoli, M.; Wood, D.W.; Bohn, M.K.; Pandey, A.K.; Borowitz, D.K.; Fang, S.; Patel, Z.; Venegas-Pino, D.E.; Shi, Y.; Werstuck, G.H. Investigating the protective effects of estrogen on β-cell health and the progression of hyperglycemia-induced atherosclerosis. Am. J. Physiol. Endocrinol. Metab. 2022, 323, E254–E266. [Google Scholar] [CrossRef]
  19. Skelin, M.; Rupnik, M.; Cencic, A. Pancreatic beta cell lines and their applications in diabetes mellitus research. ALTEX-Altern. Anim. Exp. 2010, 27, 105–113. [Google Scholar] [CrossRef]
  20. Ibrahim, I.M.; Abdelmalek, D.H.; Elfiky, A.A. GRP78: A cell’s response to stress. Life Sci. 2019, 226, 156–163. [Google Scholar] [CrossRef]
  21. Hosokawa, N.; Wada, I.; Natsuka, Y.; Nagata, K. EDEM accelerates ERAD by preventing aberrant dimer formation of misfolded alpha1-antitrypsin. Genes Cells 2006, 11, 465–476. [Google Scholar] [CrossRef]
  22. Tufo, G.; E Jones, A.W.; Wang, Z.; Hamelin, J.; Tajeddine, N.; Esposti, D.D.; Martel, C.; Boursier, C.; Gallerne, C.; Migdal, C.; et al. The protein disulfide isomerases PDIA4 and PDIA6 mediate resistance to cisplatin-induced cell death in lung adenocarcinoma. Cell Death Differ. 2014, 21, 685–695. [Google Scholar] [CrossRef] [PubMed]
  23. Kautzky-Willer, A.; Harreiter, J.; Pacini, G. Sex and Gender Differences in Risk, Pathophysiology and Complications of Type 2 Diabetes Mellitus. Endocr. Rev. 2016, 37, 278–316. [Google Scholar] [CrossRef] [PubMed]
  24. Kooptiwut, S.; Mahawong, P.; Hanchang, W.; Semprasert, N.; Kaewin, S.; Limjindaporn, T.; Yenchitsomanus, P.-T. Estrogen reduces endoplasmic reticulum stress to protect against glucotoxicity induced-pancreatic β-cell death. J. Steroid Biochem. Mol. Biol. 2014, 139, 25–32. [Google Scholar] [CrossRef] [PubMed]
  25. Li, J.; Wang, Q.; Chai, W.; Chen, M.-H.; Liu, Z.; Shi, W. Hyperglycemia in apolipoprotein E-deficient mouse strains with different atherosclerosis susceptibility. Cardiovasc. Diabetol. 2011, 10, 117. [Google Scholar] [CrossRef] [PubMed]
  26. Jang, I.; Pottekat, A.; Poothong, J.; Yong, J.; Lagunas-Acosta, J.; Charbono, A.; Chen, Z.; Scheuner, D.L.; Liu, M.; Itkin-Ansari, P.; et al. PDIA1/P4HB is required for efficient proinsulin maturation and ß cell health in response to diet induced obesity. eLife 2019, 8, e44528. [Google Scholar] [CrossRef] [PubMed]
  27. Poitout, V.; Stout, L.E.; Armstrong, M.B.; Walseth, T.F.; Sorenson, R.L.; Robertson, R.P. Morphological and functional characterization of beta TC-6 cells--an insulin-secreting cell line derived from transgenic mice. Diabetes 1995, 44, 306–313. [Google Scholar] [CrossRef] [PubMed]
  28. Lovat, P.E.; Corazzari, M.; Armstrong, J.L.; Martin, S.; Pagliarini, V.; Hill, D.; Brown, A.M.; Piacentini, M.; Birch-Machin, M.A.; Redfern, C.P. Increasing melanoma cell death using inhibitors of protein disulfide isomerases to abrogate survival responses to endoplasmic reticulum stress. Cancer Res. 2008, 68, 5363–5369. [Google Scholar] [CrossRef] [PubMed]
  29. Borrello, M.T.; Martin, M.B.; Pin, C.L. The unfolded protein response: An emerging therapeutic target for pancreatitis and pancreatic ductal adenocarcinoma. Pancreatology 2022, 22, 148–159. [Google Scholar] [CrossRef]
  30. Beriault, D.R.; Werstuck, G.H. Detection and quantification of endoplasmic reticulum stress in living cells using the fluorescent compound, Thioflavin, T. Biochim. Biophys. Acta 2013, 1833, 2293–2301. [Google Scholar] [CrossRef]
  31. Jin, L.; Liu, C.; Zhang, N.; Zhang, R.; Yan, M.; Bhunia, A.; Zhang, Q.; Liu, M.; Han, J.; Siebert, H.-C. Attenuation of Human Lysozyme Amyloid Fibrillation by ACE Inhibitor Captopril: A Combined Spectroscopy, Microscopy, Cytotoxicity, and Docking Study. Biomacromolecules 2021, 22, 1910–1920. [Google Scholar] [CrossRef]
  32. Kar, R.K.; Gazova, Z.; Bednarikova, Z.; Mroue, K.H.; Ghosh, A.; Zhang, R.; Ulicna, K.; Siebert, H.-C.; Nifantiev, N.E.; Bhunia, A. Evidence for Inhibition of Lysozyme Amyloid Fibrillization by Peptide Fragments from Human Lysozyme: A Combined Spectroscopy, Microscopy, and Docking Study. Biomacromolecules 2016, 17, 1998–2009. [Google Scholar] [CrossRef]
  33. Sharma, N.K.; Das, S.K.; Mondal, A.K.; Hackney, O.G.; Chu, W.S.; Kern, P.A.; Rasouli, N.; Spencer, H.J.; Yao-Borengasser, A.; Elbein, S.C. Endoplasmic reticulum stress markers are associated with obesity in nondiabetic subjects. J. Clin. Endocrinol. Metab. 2008, 93, 4532–4541. [Google Scholar] [CrossRef]
  34. Cnop, M.; Foufelle, F.; Velloso, L.A. Endoplasmic reticulum stress, obesity and diabetes. Trends Mol. Med. 2012, 18, 59–68. [Google Scholar] [CrossRef]
  35. Kawasaki, N.; Asada, R.; Saito, A.; Kanemoto, S.; Imaizumi, K. Obesity-induced endoplasmic reticulum stress causes chronic inflammation in adipose tissue. Sci. Rep. 2012, 2, 799. [Google Scholar] [CrossRef]
  36. Ferraz-Bannitz, R.; Welendorf, C.R.; Coelho, P.O.; Salgado, W.; Nonino, C.B.; Beraldo, R.A.; Foss-Freitas, M.C. Bariatric surgery can acutely modulate ER-stress and inflammation on subcutaneous adipose tissue in non-diabetic patients with obesity. Diabetol. Metab. Syndr. 2021, 13, 19. [Google Scholar] [CrossRef]
  37. Auffret, J.; Freemark, M.; Carré, N.; Mathieu, Y.; Tourrel-Cuzin, C.; Lombès, M.; Movassat, J.; Binart, N. Defective prolactin signaling impairs pancreatic β-cell development during the perinatal period. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E1309–E1318. [Google Scholar] [CrossRef] [PubMed]
  38. Shrivastava, V.; Lee, M.; Lee, D.; Pretorius, M.; Radford, B.; Makkar, G.; Huang, C. Beta cell adaptation to pregnancy requires prolactin action on both beta and non-beta cells. Sci. Rep. 2021, 11, 10372. [Google Scholar] [CrossRef] [PubMed]
  39. Brelje, T.C.; Bhagroo, N.V.; Stout, L.E.; Sorenson, R.L. Prolactin and oleic acid synergistically stimulate β-cell proliferation and growth in rat islets. Islets 2017, 9, e1330234. [Google Scholar] [CrossRef]
  40. Grattan, D.R.; Jasoni, C.L.; Liu, X.; Anderson, G.M.; Herbison, A.E. Prolactin regulation of gonadotropin-releasing hormone neurons to suppress luteinizing hormone secretion in mice. Endocrinology 2007, 148, 4344–4351. [Google Scholar] [CrossRef] [PubMed]
  41. Fu, Z.; Zou, F.; Deng, H.; Zhou, H.; Liu, L. Estrogen protects SGC7901 cells from endoplasmic reticulum stress-induced apoptosis by the Akt pathway. Oncol. Lett. 2014, 7, 560–564. [Google Scholar] [CrossRef] [PubMed]
  42. Guo, Y.S.; Sun, Z.; Ma, J.; Cui, W.; Gao, B.; Zhang, H.Y.; Han, Y.H.; Hu, H.M.; Wang, L.; Fan, J.; et al. 17β-Estradiol inhibits ER stress-induced apoptosis through promotion of TFII-I-dependent Grp78 induction in osteoblasts. Lab. Investig. 2014, 94, 906–916. [Google Scholar] [CrossRef] [PubMed]
  43. Song, X.; Li, G.; Vaage, J.; Valen, G. Effects of sex, gonadectomy, and oestrogen substitution on ischaemic preconditioning and ischaemia-reperfusion injury in mice. Acta Physiol. Scand. 2003, 177, 459–466. [Google Scholar] [CrossRef] [PubMed]
  44. Elhage, R.; Arnal, J.F.; Pieraggi, M.T.; Duverger, N.; Fiévet, C.; Faye, J.C.; Bayard, F. 17 beta-estradiol prevents fatty streak formation in apolipoprotein E-deficient mice. Arterioscler. Thromb. Vasc. Biol. 1997, 17, 2679–2684. [Google Scholar] [CrossRef] [PubMed]
  45. Gérard, C.; Gallez, A.; Dubois, C.; Drion, P.; Delahaut, P.; Quertemont, E.; Noël, A.; Pequeux, C. Accurate Control of 17β-Estradiol Long-Term Release Increases Reliability and Reproducibility of Preclinical Animal Studies. J. Mammary Gland. Biol. Neoplasia 2017, 22, 1–11. [Google Scholar] [CrossRef] [PubMed]
  46. Ström, J.O.; Theodorsson, A.; Ingberg, E.; Isaksson, I.-M.; Theodorsson, E. Ovariectomy and 17β-estradiol Replacement in Rats and Mice: A Visual Demonstration. J. Vis. Exp. 2012. [Google Scholar] [CrossRef]
  47. Carter, J.D.; Dula, S.B.; Corbin, K.L.; Wu, R.; Nunemaker, C.S. A Practical Guide to Rodent Islet Isolation and Assessment. Biol. Proced. Online 2009, 11, 3–31. [Google Scholar] [CrossRef]
  48. Stull, N.D.; Breite, A.; McCarthy, R.; Tersey, S.A.; Mirmira, R.G. Mouse Islet of Langerhans Isolation using a Combination of Purified Collagenase and Neutral Protease. J. Vis. Exp. 2012, 64, e4013. [Google Scholar] [CrossRef]
  49. Dheda, K.; Huggett, J.F.; Bustin, S.A.; Johnson, M.A.; Rook, G.; Zumla, A. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques 2004, 37, 112–114, 116, 118–119. [Google Scholar] [CrossRef]
  50. Rossetti, C.L.; de Oliveira Costa, H.M.; Barthem, C.S.; da Silva, M.H.; de Carvalho, D.P.; da-Silva, W.S. Sexual dimorphism of liver endoplasmic reticulum stress susceptibility in prepubertal rats and the effect of sex steroid supplementation. Exp. Physiol. 2019, 104, 677–690. [Google Scholar] [CrossRef]
Ijms 25 01816 g001
Figure 1. (A) Fasting blood glucose levels are lower in female ApoE−/−:Ins2+/Akita mice, compared to age-matched male ApoE−/−:Ins2+/Akita mice. Fasting blood glucose levels were determined in female and age-matched male ApoE−/− and ApoE−/−:Ins2+/Akita. n = 4–7 mice per experimental group; female male ApoE−/−:Ins2+/Akita mice. Bars represent standard error of the mean (SEM). (B) Ovariectomy increases and estrogen supplementation decreases fasting blood glucose levels in female ApoE−/−:Ins2+/Akita mice. Fasting blood glucose levels were determined in sham operated female, ovariectomized (ovx) female, ovx female supplemented with 17-beta estradiol (E2), age-matched male ApoE−/−:Ins2+/Akita mice supplemented with estrogen or not, and male and female ApoE−/− controls. A transient reduction in blood glucose was observed in age-matched male ApoE−/−:Ins2+/Akita mice supplemented with estrogen. n = 5 mice per experimental group. **** p < 0.0001 male ApoE−/−:Ins2+/Akita mice vs. age matched male and female ApoE−/− controls. ** p < 0.01 male ApoE−/−:Ins2+/Akita mice vs. age matched sham operated female ApoE−/−:Ins2+/Akita mice. ## p < 0.01 ovx female ApoE−/−:Ins2+/Akita mice vs. ovx female ApoE−/−:Ins2+/Akita mice + E2. Bars represent standard error of the mean (SEM).
Figure 1. (A) Fasting blood glucose levels are lower in female ApoE−/−:Ins2+/Akita mice, compared to age-matched male ApoE−/−:Ins2+/Akita mice. Fasting blood glucose levels were determined in female and age-matched male ApoE−/− and ApoE−/−:Ins2+/Akita. n = 4–7 mice per experimental group; female male ApoE−/−:Ins2+/Akita mice. Bars represent standard error of the mean (SEM). (B) Ovariectomy increases and estrogen supplementation decreases fasting blood glucose levels in female ApoE−/−:Ins2+/Akita mice. Fasting blood glucose levels were determined in sham operated female, ovariectomized (ovx) female, ovx female supplemented with 17-beta estradiol (E2), age-matched male ApoE−/−:Ins2+/Akita mice supplemented with estrogen or not, and male and female ApoE−/− controls. A transient reduction in blood glucose was observed in age-matched male ApoE−/−:Ins2+/Akita mice supplemented with estrogen. n = 5 mice per experimental group. **** p < 0.0001 male ApoE−/−:Ins2+/Akita mice vs. age matched male and female ApoE−/− controls. ** p < 0.01 male ApoE−/−:Ins2+/Akita mice vs. age matched sham operated female ApoE−/−:Ins2+/Akita mice. ## p < 0.01 ovx female ApoE−/−:Ins2+/Akita mice vs. ovx female ApoE−/−:Ins2+/Akita mice + E2. Bars represent standard error of the mean (SEM).
Ijms 25 01816 g001
Ijms 25 01816 g002aIjms 25 01816 g002b
Figure 2. Expression of adaptive and apoptotic UPR markers in RNA transcripts of isolated pancreatic islets. Transcripts from isolated pancreatic islets were analyzed for the expression of the adaptive UPR markers Grp78, Edem, Pdia1, Pdia3, Pdia4, Pdia6 in (A) female and (B) male ApoE−/− and ApoE−/−:Ins2+/Akita mice at 4 and 8 weeks of age. Expression of the apoptotic UPR markers Gadd153/Chop and Atf4 in transcripts from isolated pancreatic islets of female (C) and male (D) ApoE−/− and ApoE−/−:Ins2+/Akita mice at 4 and 8 weeks of age. RNA transcripts isolated from pancreata from female ApoE−/−:Ins2+/Akita mice show significantly increased expression of adaptive UPR markers, while transcripts from male ApoE−/−:Ins2+/Akita mice show a significant increase in apoptotic UPR markers. Each sample represents pooled islets from n = 4–8 mice. n = 3–6 samples per experimental group, analyzed in technical duplicates. * p < 0.05, NS, not significant. Bars represent standard error of the mean (SEM).
Figure 2. Expression of adaptive and apoptotic UPR markers in RNA transcripts of isolated pancreatic islets. Transcripts from isolated pancreatic islets were analyzed for the expression of the adaptive UPR markers Grp78, Edem, Pdia1, Pdia3, Pdia4, Pdia6 in (A) female and (B) male ApoE−/− and ApoE−/−:Ins2+/Akita mice at 4 and 8 weeks of age. Expression of the apoptotic UPR markers Gadd153/Chop and Atf4 in transcripts from isolated pancreatic islets of female (C) and male (D) ApoE−/− and ApoE−/−:Ins2+/Akita mice at 4 and 8 weeks of age. RNA transcripts isolated from pancreata from female ApoE−/−:Ins2+/Akita mice show significantly increased expression of adaptive UPR markers, while transcripts from male ApoE−/−:Ins2+/Akita mice show a significant increase in apoptotic UPR markers. Each sample represents pooled islets from n = 4–8 mice. n = 3–6 samples per experimental group, analyzed in technical duplicates. * p < 0.05, NS, not significant. Bars represent standard error of the mean (SEM).
Ijms 25 01816 g002aIjms 25 01816 g002b
Ijms 25 01816 g003
Figure 3. Expression of adaptive UPR markers GRP78/94 in pancreatic sections. Immunofluorescence staining was performed to measure the expression of adaptive UPR markers GRP78/GRP94 in pancreatic islet sections of sham-operated, ovariectomized, ovariectomized supplemented with 17-beta estradiol (E2) female (A,B) ApoE−/−:Ins2+/Akita and female ApoE−/− mice; and male (C,D) male ApoE−/−:Ins2+/Akita supplemented with estrogen (E2) or not. Ovariectomy significantly reduces the expression of GRP78/94 in female ApoE−/−:Ins2+/Akita mice, while no significant differences are observed in male experimental groups. n = 4–5 per group. * p < 0.05, ** p < 0.01, NS, not significant. Bars represent standard error of the mean (SEM).
Figure 3. Expression of adaptive UPR markers GRP78/94 in pancreatic sections. Immunofluorescence staining was performed to measure the expression of adaptive UPR markers GRP78/GRP94 in pancreatic islet sections of sham-operated, ovariectomized, ovariectomized supplemented with 17-beta estradiol (E2) female (A,B) ApoE−/−:Ins2+/Akita and female ApoE−/− mice; and male (C,D) male ApoE−/−:Ins2+/Akita supplemented with estrogen (E2) or not. Ovariectomy significantly reduces the expression of GRP78/94 in female ApoE−/−:Ins2+/Akita mice, while no significant differences are observed in male experimental groups. n = 4–5 per group. * p < 0.05, ** p < 0.01, NS, not significant. Bars represent standard error of the mean (SEM).
Ijms 25 01816 g003
Ijms 25 01816 g004
Figure 4. Expression of adaptive UPR marker PDI in pancreatic islets. Immunofluorescent staining was performed to evaluate the expression of adaptive UPR marker PDI in pancreatic islet sections of sham-operated, ovariectomized, ovariectomized supplemented with 17-beta estradiol (E2) female (A,B) ApoE−/−:Ins2+/Akita and age matched female ApoE−/− mice; and male (C,D) male ApoE−/−:Ins2+/Akita supplemented with 17-beta estradiol or not. n = 4–5 per group. * p < 0.05, ** p < 0.01, NS, not significant. Bars represent standard error of the mean (SEM).
Figure 4. Expression of adaptive UPR marker PDI in pancreatic islets. Immunofluorescent staining was performed to evaluate the expression of adaptive UPR marker PDI in pancreatic islet sections of sham-operated, ovariectomized, ovariectomized supplemented with 17-beta estradiol (E2) female (A,B) ApoE−/−:Ins2+/Akita and age matched female ApoE−/− mice; and male (C,D) male ApoE−/−:Ins2+/Akita supplemented with 17-beta estradiol or not. n = 4–5 per group. * p < 0.05, ** p < 0.01, NS, not significant. Bars represent standard error of the mean (SEM).
Ijms 25 01816 g004
Ijms 25 01816 g005
Figure 5. Expression of apoptotic UPR marker GADD153/CHOP in pancreatic sections. Immunostaining was performed to measure the expression of apoptotic UPR marker GADD153/CHOP in pancreatic islet sections of sham-operated, ovariectomized, ovariectomized supplemented with 17-beta estradiol (E2) female (A,B) ApoE−/−:Ins2+/Akita and female ApoE−/− mice; and male (C,D) ApoE−/−:Ins2+/Akita supplemented with estrogen (E2) or not, compared to age matched ApoE−/− controls. Data are expressed as percentage of brown-stained nuclei versus total nuclei in the islet. Ovariectomy significantly increases the expression of the apoptotic marker GADD153/CHOP in female ApoE−/−:Ins2+/Akita mice to levels similar to those observed in male ApoE−/−:Ins2+/Akita mice. n = 4–5 per group. * p < 0.05, Bars represent standard error of the mean (SEM).
Figure 5. Expression of apoptotic UPR marker GADD153/CHOP in pancreatic sections. Immunostaining was performed to measure the expression of apoptotic UPR marker GADD153/CHOP in pancreatic islet sections of sham-operated, ovariectomized, ovariectomized supplemented with 17-beta estradiol (E2) female (A,B) ApoE−/−:Ins2+/Akita and female ApoE−/− mice; and male (C,D) ApoE−/−:Ins2+/Akita supplemented with estrogen (E2) or not, compared to age matched ApoE−/− controls. Data are expressed as percentage of brown-stained nuclei versus total nuclei in the islet. Ovariectomy significantly increases the expression of the apoptotic marker GADD153/CHOP in female ApoE−/−:Ins2+/Akita mice to levels similar to those observed in male ApoE−/−:Ins2+/Akita mice. n = 4–5 per group. * p < 0.05, Bars represent standard error of the mean (SEM).
Ijms 25 01816 g005
Ijms 25 01816 g006
Figure 6. Expression of Grp78 and Gadd153/Chop in BTC6 cells pretreated with estrogen. Transcripts from BTC6 cells pretreated with 17-beta estradiol (E2) were analyzed for expression of the adaptive UPR marker Grp78 after (A) 4 h or (B) 8 h of exposure to glucose (11 mM, 25 mM, 35 mM), tunicamycin (0.125 µg/mL), or thapsigargin (0.25 µM). Mannitol (30 mM) was used as osmotic control. Transcripts of similarly treated BTC6 cells were analyzed for the expression of the apoptotic UPR marker Gadd153/Chop after (C) 4 h or (D) 8 h of exposure to ER stress. Exposure to 17-beta estradiol promotes an adaptive UPR response and reduces apoptotic UPR activation. n = 3–5 samples per experimental group, each sample has been analyzed in duplicate. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001, NS, not significant. Bars represent standard error of the mean (SEM).
Figure 6. Expression of Grp78 and Gadd153/Chop in BTC6 cells pretreated with estrogen. Transcripts from BTC6 cells pretreated with 17-beta estradiol (E2) were analyzed for expression of the adaptive UPR marker Grp78 after (A) 4 h or (B) 8 h of exposure to glucose (11 mM, 25 mM, 35 mM), tunicamycin (0.125 µg/mL), or thapsigargin (0.25 µM). Mannitol (30 mM) was used as osmotic control. Transcripts of similarly treated BTC6 cells were analyzed for the expression of the apoptotic UPR marker Gadd153/Chop after (C) 4 h or (D) 8 h of exposure to ER stress. Exposure to 17-beta estradiol promotes an adaptive UPR response and reduces apoptotic UPR activation. n = 3–5 samples per experimental group, each sample has been analyzed in duplicate. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001, NS, not significant. Bars represent standard error of the mean (SEM).
Ijms 25 01816 g006
Table 1. Male mouse body weights ± standard deviation, SD. n = 5 mice per experimental group.
Table 1. Male mouse body weights ± standard deviation, SD. n = 5 mice per experimental group.
ApoE−/−ApoE−/−:Ins2+/AkitaApoE−/−:Ins2+/Akita + 17-Beta Estradiol
28.04 ± 0.6325.70 ± 2.1127.50 ± 1.77
Table 2. Female mouse body weights ± standard deviation, SD. n = 5 mice per experimental group.
Table 2. Female mouse body weights ± standard deviation, SD. n = 5 mice per experimental group.
ApoE−/−ApoE−/−:Ins2+/AkitaApoE−/−:Ins2+/Akita
Ovx		ApoE−/−:Ins2+/Akita Ovx + 17-Beta Estradiol
20.94 ± 0.9223.10 ± 2.3823.18 ± 1.7723.16 ± 2.58
Table 3. Mouse primer sequences for qRT-PCR.
Table 3. Mouse primer sequences for qRT-PCR.
TargetForward (5′→3′)Reverse (5′→3′)
Mouse Beta actinGGCACCACACCTTTACAATGGGGGTGTTGAAGGTCTCAAAC
Mouse Cyclophilin ATGTGCCAGGGTGGTGACTTTACTGGGAACCGTTTGTGTTTGG
Mouse Hprt1AGATGTCATGAAGGAGATGGTACAGTAGCTCTTCAGTCTG
Mouse Grp78CTGGGTACATTTGATCTGACTGGGCATTCTGGTGGCTTTCCAGCCATTC
Mouse EdemCTACCTGCGAAGAGGCCGGTTCATGAGCTGCCCACTGA
Mouse Pdia1CAAGATCAAGCCCCACCTGATAGTTCCCCCCAACCAGTACTT
Mouse Pdia3GATGGAATTGTCAGCCACTTGGGTGTGTGCAAATCGGTAGTT
Mouse Pdia4AGCTCCTTGGCAGCTTTCTCTGCAGACATTATTTTGGTGGA
Mouse Pdia6CTAGCAGTCAGCGGTCTGTATCACAGGCCGTCACTCTGAAT
Mouse Atf4ATGGCCGGCTATGGATGATCGAAGTCAAACTCTTTCAGATCCATT
Mouse Gadd153/ChopTATCTCATCCCCAGGAAACGCTGCTCCTTCTCCTTCATGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

De Paoli, M.; Shah, D.; Zakharia, A.; Patel, Z.; Patel, Z.; Pakhi, P.; Werstuck, G.H. Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells. Int. J. Mol. Sci. 2024, 25, 1816. https://doi.org/10.3390/ijms25031816

AMA Style

De Paoli M, Shah D, Zakharia A, Patel Z, Patel Z, Pakhi P, Werstuck GH. Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells. International Journal of Molecular Sciences. 2024; 25(3):1816. https://doi.org/10.3390/ijms25031816

Chicago/Turabian Style

De Paoli, Monica, Deep Shah, Alexander Zakharia, Zil Patel, Zinal Patel, Pakhi Pakhi, and Geoff H. Werstuck. 2024. "Investigating the Role of 17-Beta Estradiol in the Regulation of the Unfolded Protein Response (UPR) in Pancreatic Beta Cells" International Journal of Molecular Sciences 25, no. 3: 1816. https://doi.org/10.3390/ijms25031816

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop