Next Article in Journal
Aerobic Exercise Facilitates the Nuclear Translocation of SREBP2 by Activating AKT/SEC24D to Contribute Cholesterol Homeostasis for Improving Cognition in APP/PS1 Mice
Previous Article in Journal
Influential Serum Kinases (Non-sFlt-1) and Phosphatases in Preeclampsia—Systemic Review and Metanalysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 16
10.3390/ijms241612845
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117

by
Hui Li
1,2,
Xin Liu
2,
Junqing Zhang
2,
Longyu Chen
2,
Minghu Zhang
2,
Yongping Miao
2,
Pan Ma
2,
Ming Hao
2,
Bo Jiang
2,
Shunzong Ning
2,
Lin Huang
1,2,
Zhongwei Yuan
2,
Xuejiao Chen
2,
Xue Chen
2,
Dengcai Liu
1,2,
Hongshen Wan
3,4,* and
Lianquan Zhang
1,2,*
1
State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Chengdu 611130, China
2
Triticeae Research Institute, Sichuan Agricultural University, Chengdu 611130, China
3
Key Laboratory of Wheat Biology and Genetic Improvement on Southwestern China (Ministry of Agriculture and Rural Affairs), Crop Research Institute, Sichuan Academy of Agricultural Sciences, Chengdu 610066, China
4
Environment-Friendly Crop Germplasm Innovation and Genetic Improvement Key Laboratory of Sichuan Province, Chengdu 610066, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(16), 12845; https://doi.org/10.3390/ijms241612845
Submission received: 17 July 2023 / Revised: 12 August 2023 / Accepted: 14 August 2023 / Published: 16 August 2023
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Lodging is one of the most important factors affecting the high and stable yield of wheat worldwide. Solid-stemmed wheat has higher stem strength and lodging resistance than hollow-stemmed wheat does. There are many solid-stemmed varieties, landraces, and old varieties of durum wheat. However, the transfer of solid stem genes from durum wheat is suppressed by a suppressor gene located on chromosome 3D in common wheat, and only hollow-stemmed lines have been created. However, synthetic hexaploid wheat can serve as a bridge for transferring solid stem genes from tetraploid wheat to common wheat. In this study, the F1, F2, and F2:3 generations of a cross between solid-stemmed Syn-SAU-119 and semisolid-stemmed Syn-SAU-117 were developed. A single dominant gene, which was tentatively designated Su-TdDof and suppresses stem solidity, was identified in synthetic hexaploid wheat Syn-SAU-117 by using genetic analysis. By using bulked segregant RNA-seq (BSR-seq) analysis, Su-TdDof was mapped to chromosome 7DS and flanked by markers KASP-669 and KASP-1055 within a 4.53 cM genetic interval corresponding to 3.86 Mb and 2.29 Mb physical regions in the Chinese Spring (IWGSC RefSeq v1.1) and Ae. tauschii (AL8/78 v4.0) genomes, respectively, in which three genes related to solid stem development were annotated. Su-TdDof differed from a previously reported solid stem suppressor gene based on its origin and position. Su-TdDof would provide a valuable example for research on the suppression phenomenon. The flanking markers developed in this study might be useful for screening Ae. tauschii accessions with no suppressor gene (Su-TdDof) to develop more synthetic hexaploid wheat lines for the breeding of lodging resistance in wheat and further cloning the suppressor gene Su-TdDof.

1. Introduction

Wheat is the largest cereal crop in the world, accounting for 220 million hectares with annual global production of 772 million tons [1]. The world’s population is expected to increase by nearly 2 billion over the next 30 years [2], and there will be greater demand for global wheat production. Therefore, we must strive to increase wheat yield. However, with the continuous improvement of wheat yield and the increase in fertilizer application, lodging has become an important factor affecting the high and stable yield of wheat [3,4,5,6,7]. Plant dwarfing can effectively alleviate the lodging damage of wheat [8]; however, severe dwarfism leads to inadequate biomass accumulation and lower yield potential [9]. Increasing the mechanical strength of the stem is another breeding strategy [3]. The ratio of stem wall thickness to stem diameter and the content of mechanical tissue in solid-stemmed wheat were found to be significantly higher than those in common wheat [10,11,12]. Therefore, compared with common wheat, solid-stemmed wheat has higher stem strength and lodging resistance, which play an important role in wheat lodging resistance breeding [11].
To date, two candidate genes, TraesCS3B01G608800 and TRITD3BV1G280530, have been reported for stem solidity in hexaploid wheat and durum wheat, respectively. The differentially expressed gene TraesCS3B01G608800 (KAF7034036.1) showed copy number variations associated with stem solidity in different hexaploid wheat cultivars [13]. However, TRITD3BV1G280530 was confirmed as a candidate gene in SSt1 in durum wheat, and the copy numbers of TRITD3BV1G280530 in solid-stemmed and hollow-stemmed durum wheat were different. The protein encoded by TRITD3BV1G280530 is a zinc finger protein, and its physical location is 829.1 Mb on chromosome 3BL of the durum wheat genome v1.0 [14]. Liu et al. [15] found that a QTL for pith thickness in wheat was previously discovered on 3BL in a double haploid population of ‘Westonia’ × ‘Kauz’. A putative vacuolar processing enzyme gene TaVPE3cB was screened out as a potential pith-thickness candidate gene in Australian ‘Westonia’ wheat [15].
There are many solid-stemmed varieties, landraces, and old varieties in durum wheat (Triticum turgidum L. ssp. durum, AABB, 2n = 4x = 28) [16]. Durum wheat has greater stem firmness and more stable genetic characteristics than those of common wheat varieties [17,18,19]. Beginning in the 1940s, breeders tried to transfer the solid stem gene from Golden Ball to hexaploid wheat by crossing, but the solid stem trait was suppressed, and only hollow-stemmed lines were created [17,20,21]. Then, it was found that the expression of the solid stem gene was suppressed, and the suppressor gene was presumed to be located on chromosome 3D in common wheat [17]. Suppression is a common phenomenon in nature. For example, suppression of disease resistance is especially frequent in the expression genes for resistance to fungal plant pathogens causing stem rust, leaf rust, and powdery mildew [22,23,24,25,26,27,28]. Inhibition often occurs, especially during the transfer of foreign genes from diploid and tetraploid ancestors to hexaploid wheat [22,23,24,27,29,30].
Synthetic hexaploid wheat was an effective bridge for transferring the solid stem gene from durum wheat to hexaploid wheat. A synthetic hexaploid wheat (P89-77-1 F4) derived from crosses between solid-stemmed Golden Ball durum wheat and Ae. squarrosa L. expressed pith in the culm lumen [31]. Then, two solid-stemmed hexaploid spring wheat lines (PI 633,737 and PI 633,738) were developed and released by backcrossing P89-77-1 F4 with the hollow-stemmed hexaploid wheat cultivar AC Elsa [31,32]. In our previous study, the expression of a solid second internode at the base of the stem was stable for two synthetic hexaploid wheat lines (Syn-SAU-117 and Syn-SAU-119), which were developed from a cross of the semidwarf solid-stemmed durum wheat line Ma as the female parent and two different Ae. tauschii accessions (AS92 and AS96) as the male parent [33]. The second internode at the base of the stem of Syn-SAU-117 (pedigree: Ma × AS92) was semisolid, while that of Syn-SAU-119 (pedigree: Ma × AS96) was solid in both the greenhouse and field. It was indicated that the D genome of Ae. tauschii AS92 suppressed the expression of the solid stem gene from the 3B chromosome in Syn-SAU-117 [33]. The objective of this study was to identify and map the solid stem suppressor gene in Syn-SAU-117 by using bulked segregant RNA-seq (BSR-seq) analysis.

2. Results

2.1. Differential Expression of the TdDof Gene in Different Materials

The gene expression levels of TdDof were determined in two synthetic wheat cultivars, Syn-SAU-117 and Syn-SAU-119, and two durum wheat cultivars, Ma (solid) and Cocorit (hollow), as solid- and hollow-stemmed contrasts during early internode elongation (Zadoks stage 32 and Zadoks stage 34). The expression level of TdDof was higher in Syn-SAU-119 than in Syn-SAU-117 in both periods (Figure 1a,b).

2.2. Genetic Analysis of the Solid Stem Suppressor Gene Su-TdDof

According to Pauw et al. [34], synthetic hexaploid wheat Syn-SAU-119 was solid-stemmed (solidity = 5.0; on 1–5 scale) (Figure 2a), and Syn-SAU-117 was semisolid-stemmed (solidity = 4.2; on 1–5 scale) (Figure 2c). Syn-SAU-117 and Syn-SAU-119 were hybridized to obtain F1, F2, and F2:3 populations for the genetic analysis of solid stem inhibition in Syn-SAU-117. The solidity of stems of all F1 plants was similar to that of Syn-SAU-117 plants (solidity = 4.0) (Figure 2b). The F2 population was segregated into 36 solid-stemmed (solidity = 5) and 120 semisolid-stemmed (1 < solidity < 5) plants, fitting a 1S: 3SS ratio (χ2 = 0.308, p = 0.579) (Figure 2e) (Table 1), indicating that the inhibition of solid stems was conferred by a single dominant gene that was tentatively designated as Su-TdDof. At Zadoks stage 34, the anatomical structure of the stalks of the synthetic hexaploid wheat showed that the Syn-SAU-119 parenchyma was complete (Figure 3a), and the parenchyma of Syn-SAU-117 and Syn-SAU-117 × Syn-SAU-119 F1 showed a similar degree of apoptosis (Figure 3b,c). In the Syn-SAU-117 × Syn-SAU-119 F2 population, the parenchyma of some plants was complete (Figure 3d), while that of other plants showed apoptosis (Figure 3e). The segregation rate of the F2:3 population composed of 134 families was 35 (homozygous solid): 67 (heterozygous): 32 (homozygous semisolid) (χ1:2:12 = 0.134, p = 0.935), which was consistent with the segregation results for the F2 population (Table 1).

2.3. BSR-Seq Analysis of the RNA of Bulks with Contrasting Stem Solidity

The RNA samples of the solid bulk and the semisolid bulk were subjected to RNA-seq analysis, which generated 56,746,340 and 82,341,750 raw reads, respectively. After quality control, 56,740,782 and 82,334,750 high-quality reads from the solid bulk and semisolid bulk, respectively, were uniquely mapped to the Chinese Spring genome (IWGSC RefSeq v1.1). A total of 8581 SNPs (p <  1 × 10−8 and AFD > 0.6) were identified from these reads by using the GATK v4.0 software (Figure 4). One hundred and twenty-three SNPs were located in an 8 Mb genomic interval (4–11 Mb) on the short arm of chromosome 7D in the Chinese Spring genome (IWGSC RefSeq v1.1), and these were regarded as candidate SNPs linked to Su-TdDof (Figure 5).

2.4. Molecular Mapping of Su-TdDof

Fifty-one out of the 123 clustered SNPs on 7DS were chosen to develop KASP markers. Four of them were successfully converted into KASP markers (KASP-533, KASP-669, KASP-1055, KASP-1166) (Table 2) and scored reliably on the parents, as well as the solid and semisolid bulks. All tested markers exhibited identical haplotypes between Syn-SAU-117 and its male parent AS92 but were distinct from those of Syn-SAU-119 and its male parent AS96 (Table 3). Subsequently, these KASP markers were used to genotype 134 F2 plants derived from the cross between solid-stemmed Syn-SAU-119 and semisolid-stemmed Syn-SAU-117 plants. Linkage analysis indicated that KASP-669 was potentially mapped 1.88 cM distally, and KASP-1055 was placed 2.65 cM proximally to Su-TdDof (Figure 6).

2.5. Gene Analysis of the Genomic Region of Su-TdDof

The sequences of the closely linked markers KASP-669 and KASP-1055 were blasted against the Chinese Spring genome and the Ae. tauschii genome to obtain their physical positions. Su-TdDof was physically mapped to a 3.86 Mb region between the 6.69 Mb and 10.55 Mb regions of the Chinese Spring 7DS chromosome (IWGSC RefSeq v1.1) and between the 6.58 Mb to 8.87 Mb regions (2.29 Mb) in the Ae. tauschii AL8/78 7DS chromosome (Ae. tauschii AL8/78 v4.0) (Figure 6). There were 180 and 125 predicted genes in the target physical regions in Chinese Spring and Ae. tauschii AL8/78, respectively (IWGSC RefSeq v1.1; Ae. tauschii AL8/78 v4.0; Supplementary Tables S1 and S2). In the Chinese Spring genome, ten genes may be associated with the growth and development of plant stems, including six zinc-finger-protein-related genes (TraesCS7D02G015800, TraesCS7D02G019600LC, TraesCS7D02G022000LC, TraesCS7D02G023300LC, TraesCS7D02G023400LC, TraesCS7D02G024900LC), two biofunction inhibitor genes (TraesCS7D02G020000, TraesCS7D02G020100), one pectin lyase-like superfamily protein gene (TraesCS7D02G016300), and one homeobox-like protein BEL1 gene (TraesCS7D02G019800). Five genes, including two zinc-finger-protein-related genes (AET7Gv20034800, AET7Gv20042400), one 36.4 kDa proline-rich protein gene (AET7Gv20040700), one transcription factor gene (AET7Gv20036400), and one homeobox-like protein BEL1 gene, were found in the Ae. tauschii genome, which had a good collinear relationship with those of Chinese Spring (Figure S1). Transcriptome analysis revealed a total of 43,362 differentially expressed genes, including 341 upregulated genes, 227 downregulated genes, and 42,794 nondifferentially expressed genes (Figure 7). There were 12 and 7 significantly differentially expressed genes in the target physical regions in the Chinese Spring genome and Ae. tauschii genome (Supplementary Tables S3 and S4, Figure S1). Among them, the annotations of TraesCS7D02G016300, AET7Gv20040000, and AET7Gv20040700 were probably associated with the growth and development of plant pith [14,35,36,37,38,39,40,41]. TraesCS7D02G016300 was a gene encoding pectin lyase superfamily proteins (PG) that acted on pectin and lignin in the cell wall and promoted cell wall degradation and shedding, thus promoting cell apoptosis (Supplementary Table S3). The homologous genes of TraesCS7D02G016300 were two polygalacturonase genes (AET7Gv20034200 and AET7Gv20034900) in the Ae. tauschii genome (Ae. tauschii AL8/78 v4.0), and their gene annotations were not correlated with the inhibition of solid stems (Supplementary Tables S3 and S4). AET7Gv20040700 and AET7Gv20040000 in the Ae. tauschii genome (Ae. tauschii AL8/78 v4.0) had a good collinear relationship with those of Chinese Spring (Figure S1). AET7Gv20040000 was annotated as a homeobox-like protein BEL1 gene (Supplementary Table S4). The homologous gene of AET7Gv20040000 in Chinese Spring was TraesCS7D02G019800, and its functional annotation was a homeobox-like protein BEL1 gene (Supplementary Table S1), which was the same as AET7Gv20040000 in the Ae. tauschii AL8/78 genome. AET7Gv20040700 was annotated as a 36.4 kDa proline-rich protein gene (Supplementary Table S4). The homologous gene of AET7Gv20040700 in Chinese Spring was TraesCS7D02G020100, and its functional annotation was that of a bifunctional (protease/α-amylase) inhibitor/plant lipid transfer protein/seed storage helical domain (Supplementary Table S1).

3. Discussion

To date, lodging is still a problem in wheat-growing regions worldwide, despite scientists having made great efforts to solve it for many years. The selection of excellent germplasms with alternative semidwarf genes or good stem mechanical strength may be an effective way to solve this problem [42]. Solid-stemmed wheat has strong lodging resistance due to its higher stalk strength [11,43]. The pith is composed of undifferentiated parenchymatous cells in the solid stems, which accounted for 11% of the total stem dry weight 10–14 days after anthesis and contributed 13% of ethanol-soluble carbohydrates in the entire stem [44]. Water-soluble carbohydrates (WSCs), including sugars, such as fructans, sucrose, glucose, and fructose, are stored in the stems [45,46], and they could be remobilized and transported to the developing grains [47], thus playing an important role in buffering grain yield [48,49]. Stem solidness was reported to be negatively correlated with yield in a few older reports [50,51]. However, later studies showed no such association of the variation of solid stem traits with a decrease in wheat yield [52]. Moreover, the development of high-yielding solid-stemmed cultivars is not related to the degree of stem solidness [53,54,55,56,57].
Durum wheat has many solid-stemmed varieties, landraces, and old varieties [16]. However, attempts to transfer solid stem genes to hexaploid wheat via direct crossing have been unsuccessful because the expression of solid stem genes is suppressed by the suppressor gene on chromosome 3D in common wheat [10,20,21]. In this study, a new solid stem suppressor gene, Su-TdDof, was identified in the synthetic hexaploid wheat Syn-SAU-117 and mapped on chromosome arm 7DS; it was flanked by the markers KASP-669 and KASP-1055 within a 4.53 cM genetic interval corresponding to the 3.86 Mb physical region in the Chinese Spring genome (IWGSC RefSeq v1.1). In addition, the expression of the solid stem gene TdDof in Syn-SAU-117 was lower than that in Syn-SAU-119, thus confirming the existence of the solid stem suppressor gene Su-TdDof.
In common wheat, the existence of many suppressor genes affects the normal expression of some important genes and the utilization of excellent foreign genes [28,43,58,59,60,61,62]. To date, many disease resistance genes and corresponding suppressor genes have been found in the D genome of common wheat and the D genome donor Ae. tauschii [43,61,63,64], such as the leaf rust suppressor gene Su-Lr23 on chromosome 2DS [62] and the stem rust suppressor gene SuSr-D1 on chromosome 7DL of the hexaploid wheat cultivar ‘Canthatch’ (CTH) [65,66,67,68]. A recent study showed that the gene SuSr-D1 encoded Med15, a subunit of the Mediator complex that suppressed the expression of stem rust resistance [28]. In the present study, Su-TdDof was from Ae. tauschii, which was different from the suppressor gene presumed to be located on chromosome 3D in common wheat found by Larson et al. [10].
Su-TdDof was physically mapped to the region between 6.58 Mb and 8.87 Mb (2.29 Mb) on the Ae. tauschii AL8/78 7DS chromosome (Ae. tauschii AL8/78 v4.0) (Figure 6). Based on the gene functional annotation and screening of differentially expressed genes in the transcriptome, there were two protein-coding genes, AET7G20040000 and AET7Gv20040700, in the target physical regions in the Ae. tauschii genome (Supplementary Tables S3 and S4, Figure S1). AET7Gv20040000 was annotated as a homeobox-like protein BEL1 gene, and the homologous gene of AET7Gv20040000 in Chinese Spring was TraesCS7D02G019800. Its functional annotation was the same as that of AET7Gv20040000. The genes of the BEL1 protein family play an important role in the growth and development of plant stems, leaves, flowers, and other organs [36,38]. For example, in Arabidopsis thaliana, the specific interaction between the BEL1 protein-like family genes BLH6 and KNAT7 inhibits the transcription factor REVOLUTA (REV), affecting growth and development in the stem of Arabidopsis inflorescences and, thereby, regulating secondary cell wall development [37]. AET7Gv20040700 was annotated as a 36.4 kDa proline-rich protein gene, and the homologous gene of AET7Gv20040700 in Chinese Spring was TraesCS7D02G020100. Its functional annotation was that of a bifunctional (protease/α-amylase) inhibitor/plant lipid transfer protein/seed storage helical domain. Studies have shown that the formation of pith in the stem is related to starch [14,35,39]. AET7Gv20040700 may inhibit the hydrolysis of starch and affect the formation of pith. These two genes, AET7Gv20040000 and AET7Gv20040700, will be cloned and sequenced in future studies to further develop markers for verification.
During the introduction of foreign genes into common wheat, with the increase in ploidy, the expression of superior genes decreased or was completely inhibited because of the existence of suppressor genes [43,58]. Therefore, exploring new suppressor genes, screening accessions without suppressor genes, or carrying out artificial mutation of suppressor genes can enable breeders to break through this restriction and provide beneficial help for the introduction of foreign genes into common wheat [69]. The flanking markers KASP-669 and KASP-1055 developed in this study could be used as molecular markers to screen recombinant heterozygous plants, construct secondary F2 populations and develop markers, and further narrow the location interval to finely map and clone Su-TdDof. The flanking markers KASP-669 and KASP-1055 were also used to screen Ae. tauschii accessions with no suppressor gene (Su-TdDof) to develop more synthetic hexaploid wheat lines with solid stems for the breeding of lodging resistance. Solid-stemmed synthetic hexaploid wheat can be used as a bridge to cross with elite wheat cultivars [70]. Combined with molecular-marker-assisted selection, the transfer of solid stem genes from tetraploid wheat into common wheat cultivars and the breeding of new wheat cultivars with solid stems will provide new materials for the breeding of lodging resistance in wheat.

4. Materials and Methods

4.1. Plant Materials

Two synthetic hexaploid wheat lines (Syn-SAU-117 and Syn-SAU-119), two different durum wheats (Ma and Cocorit), and two different Ae. tauschii (2n = 2x = 14, DD) accessions (AS92 and AS96) were used in this study. Syn-SAU-117 and Syn-SAU-119 were generated via natural chromosome doubling of Ma × AS92 F1 and Ma × AS96 F1, respectively. Syn-SAU-117 and Syn-SAU-119 were identified by using FISH with the oligonucleotide probes Oligo-pSc119.2-1 and Oligo-pTa535-1 [33]. Plants with 42 chromosomes were used in this study. The durum wheats Ma (solid-stem) and Cocorit (hollow-stem) were supplied by George Fedak at the Ottawa Research and Development Center for Agriculture and Agri-Food (Ottawa, ON, Canada). The lines with the AS code were stored in our institute. All materials used in this study were kept at the Triticeae Research Institute of Sichuan Agricultural University.

4.2. Population Construction and Phenotypic Investigation

Two synthetic hexaploid wheat lines were sown in the greenhouse in July 2020, and Syn-SAU-117/Syn-SAU-119 F1 plants were subsequently generated. These F1 seeds were sown in a greenhouse in March 2021. Syn-SAU-117/Syn-SAU-119 F2 seeds were sown in the greenhouse in July 2021. Syn-SAU-117/Syn-SAU-119 F2:3 plants were sown in the field in November 2021. Each plant was 10 cm apart within rows, 30 cm apart between rows, and 1.5 m in length. The stems were sampled according to the method of Kong et al. [11]. More than ten stems from the main tiller were randomly selected after flowering and were cross-sectionally cut at the center of each internode. The level of stem solidity was rated as 1–5 (1 for hollow and 5 for solid) following Pauw et al. [34].

4.3. Observation of the Anatomical Structures of Stems

The internodes were numbered consecutively from the base to the top of the stem. At the jointing stage, the main tiller was selected. The center of the second internode of the wheat stem base was cut into 1 cm pieces and then soaked in FAA fixative for more than 24 h [43]. The samples were sent to Wuhan CVI Biotechnology Co., Ltd. (Wuhan, China) (https://www.servicebio.cn/ accessed on 10 July 2022) for the preparation of paraffin sections. CaseViewer 2.3 (https://www.3dhistech.com/solutions/caseviewer/ accessed on 20 July 2022, Budapest, Hungary) was used to view the results of the paraffin section analysis.

4.4. Solid Stem Gene Expression Analysis

A quantitative reverse transcription polymerase chain reaction (qRT-PCR) system (Bio-Rad, Shanghai, China) was used to analyze the gene expression of TdDof [13]. The D1 probe primers (D1_F: GTTCCTGCACGCCATGGAC; D1_R: TCCCCCATCGTCGCCATTA) were specifically designed to distinguish differences in expression levels between different plants, and the housekeeping gene GAPDH was used as a reference for gene expression analysis. The main stems of three plants were sampled at Zadoks Stage 32 and Zadoks Stage 34 when the first two and four nodes were present on the stem. Approximately 0.5 cm of the stem was sampled, measuring from the bottom of the lowermost node toward the uppermost node. Total RNA extraction was performed by using the Tiangen DP441 RNA prep Pure RNA Extraction Kit according to the manufacturer’s protocol. The quality of RNA was assessed by using polyacrylamide gel electrophoresis, and RNA reverse transcription was performed by using the Fermentas K1622 RT Reverse Transcription Kit (Thermo Scientific, Waltham, MA, USA).

4.5. Bulked Segregant RNA-Seq (BSR-Seq)

Solid and semisolid RNA pools for RNA-Seq were constructed by using the F2 generations with different stem solidity in the greenhouse. Equal amounts of RNA from 20 homozygous solid-stemmed and 20 semisolid-stemmed generations were pooled to conduct bulked segregant analysis [71]. The RNA samples were sequenced on the platform of Chengdu Tiancheng Future Technology Co., Ltd. (https://www.tcuni.com/, accessed on 27 December 2021). Sequence quality control was performed by using the fastp software v0.19.5 [72]. RNA reads of the solid stem and semisolid stem bulks were aligned to the reference genome sequence of Chinese Spring v1.1 [13] and Ae. tauschii AL8/78 v4.0 by using the STARv2.5.1b software [73]. The unique and confident alignments were applied to call SNP variants by using the GATK v3.6 software [74]. The SNP variants with p-values from Fisher’s exact test (FET) of <1 × 10−8 and an allele frequency difference (AFD) of >0.6 were considered to be associated with solid stem suppression and further used as templates for developing SNP markers [71].

4.6. Kompetitive Allele-Specific PCR (KASP) Assays

The solidity-related SNPs and the 500 bp flanking sequences were used to design the KASP primers and test polymorphisms on the parental lines and the solid and semisolid stem DNA bulks. Polymorphic markers that could be reliably scored were genotyped on the F2 population of Syn-SAU-117 × Syn-SAU-119. For each KASP assay, a 10 µL reaction volume containing 5 µL of 2 KASP master mix (Biosearch Technologies, Shanghai, China), 1.4 µL of primer mix (mixture of 0.168 µM each forward A1 and A2 primers and 0.42 µM of reverse primer), 100 ng of genomic DNA, and 2.6 µL of ddH2O was prepared. The CFX96Touch™ real-time PCR detection system (Bio-Rad, USA) was used for amplification under the following conditions: 15 min at 94 °C, 10 touchdown cycles of 20 s at 94 °C, 60 s at 65–57 °C (decreasing by 0.8 °C per cycle), and 32 cycles of 20 s at 94 °C, followed by 60 s at 57 °C.

4.7. Data Analysis

Chi-square (χ2) tests were used to determine the goodness of fit for the observed segregation and expected ratios of the F2 and F2:3 populations. Linkage analysis was performed by using MAPMAKER/EXP v3.0b [75]. The Kosambi function was used to convert recombination values into genetic distances [76]. A logarithmic odds (LOD) ratio of 3.0 and a maximum distance of 50.0 cM were set as thresholds for the declaration of linkage. The genetic linkage map was drawn by using the Mapdraw v2.1 software [77].

4.8. Candidate Gene Analysis

The sequences of the KASP-669 and KASP-1055 markers linked to Su-TdDof were used for BLAST against the genomes of Chinese Spring v1.1 [13] and Ae. tauschii AL8/78 v4.0 [78]. Gene annotations between the flanking markers of the two genomes were retrieved from the Ensembl Plants (http://plants.ensembl.org/index.html, accessed on 12 November 2022) and Swiss-Prot (http://www.gpm-aw.com/html/swi-ss-prot.html, accessed on 12 November 2022) databases. Furthermore, the differentially expressed genes within the interval were screened and analyzed based on the results of RNA-seq with the screening criteria of FDR < 0.05 and |LogFC| > 1. Collinearity analysis was performed on the differentially expressed genes related to the function of solid stems among parents and mixed pools.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms241612845/s1.

Author Contributions

L.Z., D.L. and H.W. designed the research and supervised the study. H.L., X.L., J.Z., L.C., M.Z., Y.M., P.M., X.C. (Xuejiao Chen) and X.C. (Xue Chen) performed the experiments. H.L., L.Z., D.L., H.W., M.H., B.J., S.N., L.H. and Z.Y. analyzed the results and wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Major Program of National Agricultural Science and Technology of China (NK20220607), the Key Research and Development Program of Sichuan Province, China (2021YFYZ0002), the Open Fund of the Key Laboratory of Wheat Biology and Genetic Improvement in Southwestern China (ZWS2022001), and the Sichuan Provincial Finance Department (1+9KJGG001; 2022ZZCX006).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAOSTAT. Food and Agricultural Organization of the United Nations. 2022. Available online: https://www.fao.org/faostat/en/ (accessed on 28 January 2022).
  2. UN (United Nations, Department of Economic and Social Affairs, Population Division). World Population Prospects: The 2015 Revision, Key Findings and Advance Tables; United Nations: New York, NY, USA, 2015. [Google Scholar]
  3. Keller, M.; Karutz, C.; Schmid, J.E.; Stamp, P.; Winzeler, M.; Keller, B.; Messmer, M.M. Quantitative trait loci for lodging resistance in a segregating wheat× spelt population. Theor. Appl. Genet. 1999, 98, 1171–1182. [Google Scholar] [CrossRef]
  4. Islam, M.S.; Peng, S.B.; Visperas, R.; Ereful, N.; Bhuiya, M.S.; Julfiquar, A.W. Lodging-related morphological traits of hybrid rice in a tropical irrigated ecosystem. Field Crop Res. 2007, 101, 240–248. [Google Scholar] [CrossRef]
  5. Acreche, M.M.; Slafer, G.A. Lodging yield penalties as affected by breeding in Mediterranean wheats. Field Crop Res. 2011, 122, 40–48. [Google Scholar] [CrossRef]
  6. Berry, P.M.; Spink, J. Predicting yield losses caused by lodging in wheat. Field Crop Res. 2012, 137, 19–26. [Google Scholar] [CrossRef]
  7. Peake, A.S.; Huth, N.I.; Carberry, P.S.; Raine, S.R.; Smith, R.J. Quantifying potential yield and lodging-related yield gaps for irrigated spring wheat in sub-tropical Australia. Field Crop Res. 2014, 158, 1–14. [Google Scholar] [CrossRef]
  8. Flintham, J.E.; Börner, A.; Worland, A.J.; GALE, M.D. Optimizing wheat grain yield: Effects of Rht (gibberellin-insensitive) dwarfing genes. J. Agr. Sci. 1997, 128, 11–25. [Google Scholar] [CrossRef]
  9. Hirano, K.; Ordonio, R.L.; Matsuoka, M. Engineering the lodging resistance mechanism of post-Green Revolution rice to meet future demands. Proc. Jpn. Acad. Ser. B 2017, 93, 220–233. [Google Scholar] [CrossRef]
  10. Larson, R.I.; MacDonald, M.D. Inheritance of the type of solid stem in Golden Ball (Triticum durum). III. The effect of selection for solid stem beyond F5 in hexaploid segregates of the hybrid Rescue (T. aestivum) × Golden Ball. Can. J. Genet. Cytol. 1963, 5, 437–444. [Google Scholar] [CrossRef]
  11. Kong, E.Y.; Liu, D.C.; Guo, X.L.; Yang, W.L.; Sun, J.Z.; Li, X.; Zhan, K.H.; Cui, D.Q.; Lin, J.X.; Zhang, A.M. Anatomical and chemical characteristics associated with lodging resistance in wheat. Crop J. 2013, 1, 43–49. [Google Scholar] [CrossRef]
  12. Beres, B.L.; Cárcamo, H.A.; Byers, J.R.; Clarke, F.R.; Pozniak, C.J.; Basu, S.K.; DePauw, R.M. Host plant interactions between wheat germplasm source and wheat stem sawfly Cephus cinctus Norton (Hymenoptera: Cephidae) I. Commercial cultivars. Can. J. Plant Sci. 2013, 93, 607–617. [Google Scholar] [CrossRef]
  13. International Wheat Genome Sequencing Consortium (IWGSC); Appels, R.; Eversole, K.; Stein, N.; Feuillet, C.; Keller, B.; Rogers, J.; Pozniak, C.; Choulet, F.; Distelfeld, A.; et al. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar]
  14. Nilsen, K.T.; Walkowiak, S.; Xiang, D.Q.; Gao, P.; Quilichini, T.D.; Willick, L.R.; Byrns, B.; Diaye, A.N.; Ens, J.; Wiebe, K.; et al. Copy number variation of TdDof controls solid-stemmed architecture in wheat. Proc. Natl. Acad. Sci. USA 2020, 117, 28708–28718. [Google Scholar] [CrossRef]
  15. Liu, Q.; Zhao, Y.; Rahman, S.J.; She, M.; Zhang, J.J.; Yang, R.C.; Islam, S.; O’Hara, G.; Varshney, R.; Liu, H.; et al. The putative vacuolar processing enzyme gene TaVPE3cB is a candidate gene for wheat stem pith-thickness. Theor. Appl. Genet. 2023, 136, 138. [Google Scholar] [CrossRef]
  16. Damania, A.B.; Pecetti, L.; Qualset, C.O.; Humeid, B. Diversity and geographic distribution of stem solidness and environmental stress tolerance in a collection of durum wheat landraces from Turkey. Genet. Resour. Crop Evol. 1997, 44, 101–108. [Google Scholar] [CrossRef]
  17. Platt, A.; Farstad, C.W. Breeding spring wheats for resistance to wheat stem sawfly attack. In Proceedings of the 7th Pacific Science Congress, Christchurch, New Zealand, 2 February–4 March 1949; Volume 4, pp. 215–220. [Google Scholar]
  18. Clarke, F.R.; Clarke, J.M.; Knox, R.E. Inheritance of stem solidness in eight durum wheat crosses. Can. J. Plant Sci. 2002, 82, 661–664. [Google Scholar] [CrossRef]
  19. Singh, A.K.; Clarke, J.M.; Knox, R.E.; Depauw, R.M.; McCaig, T.N.; Cuthbert, R.D.; Clarke, F.R.; Fernandez, M.R. AAC Raymore durum wheat. Can. J. Plant Sci. 2014, 94, 1289–1296. [Google Scholar] [CrossRef]
  20. Larson, R.I. Inheritance of the type of solid stem in Golden Ball (Triticum durum): I. early generations of a hybrid with Rescue (T. aestivum). Can. J. Bot. 1959, 37, 889–896. [Google Scholar] [CrossRef]
  21. Larson, R.I. Inheritance of the type of solid stem in Golden Ball (Triticum durum): II. Cytogenetics of the relation between solid stem and other morphological characters in hexaploid F5 lines of a hybrid with Rescue (T. aestivum). Can. J. Bot. 1959, 37, 1207–1216. [Google Scholar] [CrossRef]
  22. Baker, E.P. Basic studies relating to the transference of genetic characters from Triticum monococcum L. to hexaploid wheat. Aust. J. Biol. Sci. 1975, 28, 189–200. [Google Scholar]
  23. Bai, D.; Knott, D.R. Suppression of rust resistance in bread wheat (Triticum aestivum L.) by D-genome chromosomes. Genome 1992, 35, 276–282. [Google Scholar] [CrossRef]
  24. Innes, R.L.; Kerber, E.R. Resistance to wheat leaf rust and stem rust in Triticum tauschii and inheritance in hexaploid wheat of resistance transferred from T. tauschii. Genome 1994, 37, 813–822. [Google Scholar] [CrossRef]
  25. Kema, G.H.J.; Lange, W.; Van Silfhout, C.H. Differential suppression of stripe rust resistance in synthetic wheat hexaploids derived from Triticum turgidum subsp. dicoccoides and Aegilops squarrosa. Phytopathology 1995, 85, 425–429. [Google Scholar]
  26. Hanušová, R.; Hsam, S.L.K.; Bartoš, P.; Zeller, F.J. Suppression of powdery mildew resistance gene Pm8 in Triticum aestivum L. (common wheat) cultivars carrying wheat-rye translocation T1BL·1RS. Heredity 1996, 77, 383–387. [Google Scholar] [CrossRef]
  27. Nelson, J.C.; Singh, R.P.; Autrique, J.E.; Sorrells, M.E. Mapping genes conferring and suppressing leaf rust resistance in wheat. Crop Sci. 1997, 37, 1928–1935. [Google Scholar] [CrossRef]
  28. Hiebert, C.W.; Moscou, M.J.; Hewitt, T.; Steuernagel, B.; Hernández-Pinzón, I.; Green, P.; Pujol, V.; Zhang, P.; Rouse, M.N.; Jin, Y.; et al. Stem rust resistance in wheat is suppressed by a subunit of the mediator complex. Nat. Commun. 2020, 11, 1123. [Google Scholar] [CrossRef]
  29. Assefa, S.; Fehrmann, H. Evaluation of Aegilops tauschii Coss. for resistance to wheat stem rust and inheritance of resistance genes in hexaploid wheat. Genet. Resour. Crop Evol. 2004, 51, 663–669. [Google Scholar] [CrossRef]
  30. Liu, W.; Danilova, T.V.; Rouse, M.N.; Bowden, B.L.; Friebe, B.; Gill, B.S.; Pumphrey, M.O. Development and characterization of a compensating wheat-Thinopyrum intermedium Robertsonian translocation with Sr44 resistance to stem rust (Ug99). Theor. Appl. Genet. 2013, 126, 1167–1177. [Google Scholar] [CrossRef]
  31. Clarke, F.R.; DePauw, R.M.; Aung, T. Registration of sawfy resistant hexaploid spring wheat germplasm lines derived from durum. Crop Sci. 2005, 45, 1665–1666. [Google Scholar] [CrossRef]
  32. Clarke, J.M.; DePauw, R.M.; McCaig, T.N.; Fernandez, M.R.; Knox, R.E.; McLeod, J.G. AC Elsa hard red spring wheat. Can. J. Plant Sci. 1997, 77, 661–663. [Google Scholar] [CrossRef]
  33. Liang, D.Y.; Zhang, M.H.; Liu, X.; Li, H.; Jia, Z.J.; Wang, D.H.; Peng, T.; Hao, M.; Liu, D.C.; Jiang, B.; et al. Development and identification of four new synthetic hexaploid wheat lines with solid stems. Sci. Rep. 2022, 12, 4898. [Google Scholar] [CrossRef]
  34. Pauw, R.M.D.; Read, D.W.L. The effect of nitrogen and phosphorus on the expression of stem solidness in Canuck wheat at four locations in southwestern Saskatchewan. Can. J. Plant Sci. 1982, 62, 593–598. [Google Scholar] [CrossRef]
  35. Oiestad, A.J.; Martin, J.M.; Cook, J.; Giroux, M.J. Identification of candidate genes responsible for stem pith production using expression analysis in solid-stemmed wheat. Plant Genome 2017, 10, plantgenome2017-02. [Google Scholar] [CrossRef] [PubMed]
  36. Rutjens, B.; Bao, D.; Van Eck-Stouten, E.V.; Brand, M.; Smeekens, S.; Proveniers, M. Shoot apical meristem function in Arabidopsis requires the combined activities of three BEL1-like homeodomain proteins. Plant J. 2009, 58, 641–654. [Google Scholar] [CrossRef] [PubMed]
  37. Tao, Y.; Chen, M.; Shu, Y.J.; Zhu, Y.J.; Wang, S.; Huang, L.Y.; Yu, X.W.; Wang, Z.K.; Qian, P.P.; Gu, W.H.; et al. Identification and functional characterization of a novel BEL1-LIKE homeobox transcription factor GmBLH4 in soybean. Plant Cell Tiss. Org. 2018, 134, 331–344. [Google Scholar] [CrossRef]
  38. Smith, H.M.S.; Ung, N.; Lal, S.; Courtier, J. Specification of reproductive meristems requires the combined function of SHOOT MERISTEMLESS and floral integrators FLOWERING LOCUS T and FD during Arabidopsis inflorescence development. J Exp. Bot. 2011, 62, 583–593. [Google Scholar] [CrossRef]
  39. Fujimoto, M.; Sazuka, T.; Oda, Y.; Kawahigashi, H.; Wu, J.Z.; Takanashi, H.; Ohnishi, T.; Yoneda, J.; Ishimori, M.; Kajiya-Kanegae, H.; et al. Transcriptional switch for programmed cell death in pith parenchyma of sorghum stems. Proc. Natl. Acad. Sci. USA 2018, 115, E8783–E8792. [Google Scholar] [CrossRef]
  40. Ma, Q.H. The expression of caffeic acid 3-O-methyltransferase in two wheat genotypes differing in lodging resistance. J. Exp. Bot. 2009, 60, 2763–2771. [Google Scholar] [CrossRef]
  41. Tu, Y.; Rochfort, S.; Liu, Z.Q.; Ran, Y.D.; Griffith, M.; Badenhorst, P.; Louie, G.V.; Bowman, M.E.; Smith, K.F.; Noel, J.P.; et al. Functional analyses of caffeic acid O-methyltransferase and cinnamoyl-CoA-reductase genes from perennial ryegrass (Lolium perenne). Plant Cell 2010, 22, 3357–3373. [Google Scholar] [CrossRef]
  42. Miller, C.N.; Harper, A.L.; Trick, M.; Werner, P.; Waldron, K.; Bancroft, I. Elucidation of the genetic basis of variation for stem strength characteristics in bread wheat by Associative Transcriptomics. BMC Genom. 2016, 17, 500. [Google Scholar] [CrossRef]
  43. Chen, H.H.; Li, J.; Wan, H.S.; Wang, L.L.; Peng, Z.S.; Yang, W.Y. Microsatellite markers for culm wall thickness and anatomical features of solid stem wheat 86-741. Acta Agron. Sin. 2008, 34, 1381–1385. [Google Scholar] [CrossRef]
  44. Ford, M.A.; Blackwell, R.D.; Parker, M.L.; Austin, R.B. Association between stem solidity, soluble carbohydrate accumulation and other characters in wheat. Ann. Bot. 1979, 44, 731–738. [Google Scholar] [CrossRef]
  45. Pollock, C.J. Fructans and the metabolism of sucrose in vascular plants. New Phytol. 1986, 104, 1–24. [Google Scholar] [CrossRef] [PubMed]
  46. Xue, G.P.; McIntyre, C.L.; Jenkins, C.L.D.; Glassop, D.; van Herwaarden, A.F.; Shorter, R. Molecular dissection of variation in carbohydrate metabolism related to water-soluble carbohydrate accumulation in stems of wheat. Plant Physiol. 2008, 146, 441–454. [Google Scholar] [CrossRef]
  47. Gebbing, T. The enclosed and exposed part of the peduncle of wheat (Triticum aestivum): Spatial separation of fructan storage. New Phytol. 2003, 159, 245–252. [Google Scholar] [CrossRef]
  48. Blum, A. Improving wheat grain filling under stress by stem reserve mobilisation. Euphytica 1998, 100, 77–83. [Google Scholar] [CrossRef]
  49. Wardlaw, I.F.; Willenbrink, J. Mobilization of fructan reserves and changes in enzyme activities in wheat stems correlate with water stress during kernel filling. New Phytol. 2000, 148, 413–422. [Google Scholar] [CrossRef] [PubMed]
  50. Weiss, M.; Morrill, W. Wheat stem sawfy (Hymenoptera: Cephidae) revisited. Am. Entomol. 1992, 38, 241–245. [Google Scholar] [CrossRef]
  51. McNeal, F.H.; Watson, C.A.; Berg, M.A.; Wallace, L.E. Relationship of stem solidness to yield and lignin content in wheat selections. Agron. J. 1965, 57, 20–21. [Google Scholar] [CrossRef]
  52. Cook, J.; Wichman, D.; Martin, J.; Bruckner, P.; Talbert, L. Identification of microsatellite markers associated with a stem solidness locus in wheat. Crop Sci. 2004, 44, 1397–1402. [Google Scholar]
  53. Bainsla, N.; Yadav, R.; Sharma, R.K.; Sharma, A.; Gaikwad, K.B.; Kumar, A.; Singh, V.; Vyas, P.; Sharma, A. Mechanistic understanding of lodging in spring wheat (Triticum aestivum): An Indian perspective. Indian J Agr. Sci. 2018, 88, 1483–1495. [Google Scholar] [CrossRef]
  54. Hayat, M.A.; Martin, J.M.; Lanning, S.P.; McGuire, C.F.; Talbert, L.E. Variation for stem solidness and its association with agronomic traits in spring wheat. Can. J. Plant Sci. 1995, 75, 775–780. [Google Scholar] [CrossRef]
  55. Bruckner, P.L.; Berg, J.E.; Kushnak, G.D.; Stougaard, R.N.; Eckhoff, J.L.; Carlson, G.R.; Wichman, D.M.; Kephart, K.D.; Riveland, N.; Nash, D.L. Registration of ‘Genou’ wheat. Crop Sci. 2006, 46, 982–984. [Google Scholar] [CrossRef]
  56. Carlson, G.R.; Berg, J.E.; Stougaard, R.N.; Kephart, K.D.; Riveland, N.; Kushnak, G.D.; Wichman, D.M.; Eckhoff, J.L.; Nash, D.L.; Davis, E.S.; et al. Registration of ‘Bynum’ Wheat. J. Plant Regist. 2007, 1, 16–17. [Google Scholar] [CrossRef]
  57. Lanning, S.P.; Carlson, G.R.; Lamb, P.F.; Nash, D.; Wichman, D.M.; Kephart, K.D.; Stougaard, R.N.; Miller, J.; Kushnak, G.D.; Eckhoff, J.L.; et al. Registration of ‘Duclair’ Hard Red Spring Wheat. J. Plant Regist. 2011, 5, 349. [Google Scholar] [CrossRef]
  58. Knott, D.R.; Ramanujam, S. Transfer of genes for rust resistance to wheat from related species. Therm Sci. 1978, 16, 513–525. [Google Scholar]
  59. Hurni, S.; Brunner, S.; Stirnweis, D.; Herren, G.; Peditto, D.; McIntosh, R.A.; Keller, B. The powdery mildew resistance gene Pm8 derived from rye is suppressed by its wheat ortholog Pm3. Plant J. 2014, 79, 904–913. [Google Scholar] [CrossRef] [PubMed]
  60. Wu, L.; Xia, X.C.; Rosewarne, G.M.; Zhu, H.Z.; Li, S.Z.; Zhang, Z.Y.; He, Z.H. Stripe rust resistance gene Yr18 and its suppressor gene in Chinese wheat landraces. Plant Breed. 2015, 134, 634–640. [Google Scholar] [CrossRef]
  61. Athiyannan, N.; Long, Y.; Kang, H.; Chandramohan, S.; Bhatt, D.; Zhang, Q.J.; Klindworth, D.L.; Rouse, M.N.; Friesen, T.L.; McIntosh, R.; et al. Haplotype variants of Sr46 in Aegilops tauschii, the diploid D genome progenitor of wheat. Theor. Appl. Genet. 2022, 135, 2627–2639. [Google Scholar]
  62. Jin, H.L.; Zhang, H.P.; Zhao, X.Y.; Long, L.; Guan, F.N.; Wang, Y.P.; Huang, L.Y.; Zhang, X.Y.; Wang, Y.Q.; Li, H.; et al. Identification of a suppressor for the wheat stripe rust resistance gene Yr81 in Chinese wheat landrace Dahongpao. Theor. Appl. Genet. 2023, 136, 67. [Google Scholar] [CrossRef]
  63. Huang, L.; Brooks, S.A.; Li, W.L.; Feller, J.P.; Trick, H.N.; Gill, B.S. Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics 2003, 164, 655–664. [Google Scholar] [CrossRef]
  64. Arora, S.; Steuernagel, B.; Gaurav, K.; Chandramohan, S.; Long, Y.M.; Matny, O.; Johnson, R.; Enk, J.; Periyannan, S.; Singh, N.; et al. Resistance gene cloning from a wild crop relative by sequence capture and association genetics. Nat. Biotechnol. 2019, 37, 139–143. [Google Scholar] [CrossRef]
  65. Kerber, E.R.; Green, G.J. Suppression of stem rust resistance in the hexaploid wheat cv. Canthatch by chromosome 7DL. Can. J. Bot. 1980, 58, 1347–1350. [Google Scholar] [CrossRef]
  66. Kerber, E.R. Stem-rust resistance in ‘Canthatch’ hexaploid wheat induced by a nonsuppressor mutation on chromosome 7DL. Genome 1991, 34, 935–939. [Google Scholar] [CrossRef]
  67. Williams, N.D.; Miller, J.D.; Klindworth, D.L. Induced mutations of a genetic suppressor of resistance to wheat stem rust. Crop Sci. 1992, 32, 612–616. [Google Scholar] [CrossRef]
  68. Talajoor, M.; Jin, Y.; Wan, A.; Chen, X.M.; Bhavani, S.; Tabe, L.; Lagudah, E.; Huang, L. Specificity of a rust resistance suppressor on 7DL in the spring wheat cultivar Canthatch. Phytopathology 2015, 105, 477–481. [Google Scholar] [CrossRef] [PubMed]
  69. Mclntosh, R.A. Genetics of resistance to pathogens and pests: Recent developments. In Proceedings of the 8th International Wheat Genetic Symposium, Beijing, China, 20–25 July 1993; Volume 2, pp. 889–896. [Google Scholar]
  70. Hao, M.; Zhang, L.Q.; Zhao, L.B.; Dai, S.F.; Li, A.L.; Yang, W.Y.; Xie, D.; Li, Q.C.; Ning, S.Z.; Yan, Z.H.; et al. A breeding strategy targeting the secondary gene pool of bread wheat: Introgression from a synthetic hexaploid wheat. Theor. Appl. Genet. 2019, 132, 2285–2294. [Google Scholar] [CrossRef]
  71. Li, Y.H.; Shi, X.H.; Hu, J.H.; Wu, P.P.; Qiu, D.; Qu, Y.F.; Xie, J.Z.; Wu, Q.H.; Zhang, H.J.; Yang, L.; et al. Identification of a recessive gene PmQ conferring resistance to powdery mildew in wheat landrace Qingxinmai using BSR-Seq analysis. Plant Dis. 2020, 104, 743–751. [Google Scholar] [CrossRef]
  72. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
  73. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-Seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
  74. McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabrielet, S.; Daly, M.; et al. The genome analysis toolkit: A mapreduce framework for analyzing next-generation DNA sequencing data. Genome Re. 2010, 20, 1297–1303. [Google Scholar] [CrossRef]
  75. Lander, E.S.; Green, P.; Abrahamson, J.; Barlow, A.; Daly, M.J.; Lincoln, S.E.; Newburg, L. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1987, 1, 174–181. [Google Scholar] [CrossRef] [PubMed]
  76. Kosambi, D.D. The estimation of map distances from recombination values. In Selected Works in Mathematics and Statistics; Springer: New Delhi, India, 2016; pp. 125–130. [Google Scholar]
  77. Liu, R.H.; Meng, J.L. MapDraw: A microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data. Hereditas 2003, 25, 317–321. [Google Scholar] [PubMed]
  78. Luo, M.C.; Gu, Y.Q.; Puiu, D.; Wang, H.; Twardziok, S.V.; Deal, K.R.; Huo, N.X.; Zhu, T.T.; Wang, L.; Wang, Y.; et al. Genome sequence of the progenitor of the wheat D genome Aegilops tauschii. Nature 2017, 551, 498–502. [Google Scholar] [CrossRef] [PubMed]
Ijms 24 12845 g001
Figure 1. The expression differences of the TdDof gene in Ma, Syn-SAU-119, Syn-SAU-117, and Cocorit at Zadoks Stage 32 and Zadoks Stage 34: (a) expression differences in the TdDof gene at the Zadoks Stage 32; (b) expression differences in the TdDof gene at the Zadoks Stage 34.
Figure 1. The expression differences of the TdDof gene in Ma, Syn-SAU-119, Syn-SAU-117, and Cocorit at Zadoks Stage 32 and Zadoks Stage 34: (a) expression differences in the TdDof gene at the Zadoks Stage 32; (b) expression differences in the TdDof gene at the Zadoks Stage 34.
Ijms 24 12845 g001
Ijms 24 12845 g002
Figure 2. The stem solidity of Syn-SAU-119 and Syn-SAU-117 and the individual plants of F1 and F2 in the greenhouse: (a) Syn-SAU-119; (b) Syn-SAU-117 × Syn-SAU-119 F1; (c) Syn-SAU-117; (d) solid F2 plant; (e) semisolid F2 plant.
Figure 2. The stem solidity of Syn-SAU-119 and Syn-SAU-117 and the individual plants of F1 and F2 in the greenhouse: (a) Syn-SAU-119; (b) Syn-SAU-117 × Syn-SAU-119 F1; (c) Syn-SAU-117; (d) solid F2 plant; (e) semisolid F2 plant.
Ijms 24 12845 g002
Ijms 24 12845 g003
Figure 3. Anatomical structure of the stems of Syn-SAU-119 and Syn-SAU-117 and individual plants of F1 and F2 in the greenhouse: (a) Syn-SAU-119; (b) Syn-SAU-117 × Syn-SAU-119 F1; (c) Syn-SAU-117; (d) solid F2 plant; (e) semisolid F2 plant.
Figure 3. Anatomical structure of the stems of Syn-SAU-119 and Syn-SAU-117 and individual plants of F1 and F2 in the greenhouse: (a) Syn-SAU-119; (b) Syn-SAU-117 × Syn-SAU-119 F1; (c) Syn-SAU-117; (d) solid F2 plant; (e) semisolid F2 plant.
Ijms 24 12845 g003
Ijms 24 12845 g004
Figure 4. Distribution of SNPs (AFD > 0.6, p-value < 1 × 10−8) on 21 chromosomes.
Figure 4. Distribution of SNPs (AFD > 0.6, p-value < 1 × 10−8) on 21 chromosomes.
Ijms 24 12845 g004
Ijms 24 12845 g005
Figure 5. The enrichment of SNPs within a window size of 1 Mb on wheat chromosomes. The green arrow indicates the high-density SNP enrichment that occurred on chromosome 7DS.
Figure 5. The enrichment of SNPs within a window size of 1 Mb on wheat chromosomes. The green arrow indicates the high-density SNP enrichment that occurred on chromosome 7DS.
Ijms 24 12845 g005
Ijms 24 12845 g006
Figure 6. Genetic linkage map of the Su-TdDof gene on chromosome 7DS showing the physical location of Su-TdDof: (a) linkage map of Su-TdDof; (b) the physical interval (blue part) where the four KASP markers linked to Su-TdDof were anchored in Chinese Spring, with orange dots represent centromeres, dotted lines indicating the physical positions of each marker; (c) physical intervals anchored by markers linked to Su-TdDof in Aegilops tauschii.
Figure 6. Genetic linkage map of the Su-TdDof gene on chromosome 7DS showing the physical location of Su-TdDof: (a) linkage map of Su-TdDof; (b) the physical interval (blue part) where the four KASP markers linked to Su-TdDof were anchored in Chinese Spring, with orange dots represent centromeres, dotted lines indicating the physical positions of each marker; (c) physical intervals anchored by markers linked to Su-TdDof in Aegilops tauschii.
Ijms 24 12845 g006
Ijms 24 12845 g007
Figure 7. Volcano map of differentially expressed genes.
Figure 7. Volcano map of differentially expressed genes.
Ijms 24 12845 g007
Table 1. Genetic analysis of solid stem suppressor genes in the F1, F2, and F2:3 families of Syn-SAU-117 × Syn-SAU-119.
Table 1. Genetic analysis of solid stem suppressor genes in the F1, F2, and F2:3 families of Syn-SAU-117 × Syn-SAU-119.
Parents and CrossGeneration aNo. of Plants/FamiliesObserved Ratio bActual RatioExpected Ratioχ2p-Value
SSegSs
Syn-SAU-117PSs20 20
Syn-SAU-119PS2020
PSs × PSF120 20
F215636 1200.9:31:30.3080.579
F2:31343567321.04:2:0.961:2:10.1340.935
a PSs: semisolid parent Syn-SAU-117; PS: solid parent Syn-SAU-119. b S: homozygous solid; Seg: segregating within F2:3 families; Ss: homozygous semisolid.
Table 2. Primer sequences of KASP markers used for the genetic mapping of Su-TdDof.
Table 2. Primer sequences of KASP markers used for the genetic mapping of Su-TdDof.
MarkerPhysical Position (bp)Allele 1 Primer aAllele 2 Primer bCommon/Reverse Primer
KASP-5335,336,907TCAGCTTCAATTTCGGCAGCTCAGCTTCAATTTCGGCAGTAGAAGCTGAACGTGCGGAAG
KASP-6696,695,986GTCGGATTCGGTTACTTTGACGTCGGATTCGGTTACTTTGATAGAGGTGCATGGTGTCGT
KASP-105510,558,194TCTTTCTCCTTCAGCCTCTTATCTTTCTCCTTCAGCCTCTTGGCCTGATTGTAGTACATTATG
KASP-116611,664,145AACGAGGTCCCGCGCTCCTCCCAACGAGGTCCCGCGCTCCTCCGGTGTGAAGAGCGCTTCTGC
a A1 primer labeled with FAM: GAAGGTGACCAAGTTCATGCT; b A2 primer labeled with HEX: GAAGGTCGGAGTCAACGGATT.
Table 3. Genotyping of AS92, Syn-SAU-117, Syn-SAU-119, and AS96 by using KASP markers linked to Su-TdDof.
Table 3. Genotyping of AS92, Syn-SAU-117, Syn-SAU-119, and AS96 by using KASP markers linked to Su-TdDof.
ParentsMarker Genotype a
KASP-533KASP-669KASP-1055KASP-1166
AS92CCCCAACC
Syn-SAU-117CCCCAACC
Syn-SAU-119TTTTGGGG
AS96TTTTGGGG
a AA, CC, GG, and TT represent the haplotype results of SNP genotyping.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, H.; Liu, X.; Zhang, J.; Chen, L.; Zhang, M.; Miao, Y.; Ma, P.; Hao, M.; Jiang, B.; Ning, S.; et al. Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117. Int. J. Mol. Sci. 2023, 24, 12845. https://doi.org/10.3390/ijms241612845

AMA Style

Li H, Liu X, Zhang J, Chen L, Zhang M, Miao Y, Ma P, Hao M, Jiang B, Ning S, et al. Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117. International Journal of Molecular Sciences. 2023; 24(16):12845. https://doi.org/10.3390/ijms241612845

Chicago/Turabian Style

Li, Hui, Xin Liu, Junqing Zhang, Longyu Chen, Minghu Zhang, Yongping Miao, Pan Ma, Ming Hao, Bo Jiang, Shunzong Ning, and et al. 2023. "Identification of the Solid Stem Suppressor Gene Su-TdDof in Synthetic Hexaploid Wheat Syn-SAU-117" International Journal of Molecular Sciences 24, no. 16: 12845. https://doi.org/10.3390/ijms241612845

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop