Next Article in Journal
Ectopic Lipid Accumulation Correlates with Cellular Stress in Rabbit Blastocysts from Diabetic Mothers
Previous Article in Journal
CD44 Modulates Cell Migration and Invasion in Ewing Sarcoma Cells
Previous Article in Special Issue
N-Acetylaspartate and Choline Metabolites in Cortical and Subcortical Regions in Clinical High Risk Relative to Healthy Control Subjects: An Exploratory 7T MRSI Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 14
10.3390/ijms241411777
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Whole Genome Sequencing Revealed Inherited Rare Oligogenic Variants Contributing to Schizophrenia and Major Depressive Disorder in Two Families

by
I-Hang Chung
1,
Yu-Shu Huang
1,2,
Ting-Hsuan Fang
1 and
Chia-Hsiang Chen
1,*
1
Department of Psychiatry, Chang Gung Memorial Hospital—Linkou, Taoyuan 333, Taiwan
2
Department of Psychiatry, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(14), 11777; https://doi.org/10.3390/ijms241411777
Submission received: 4 May 2023 / Revised: 12 June 2023 / Accepted: 13 July 2023 / Published: 21 July 2023
(This article belongs to the Special Issue Molecular Mechanisms of Schizophrenia and Novel Targets 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Schizophrenia and affective disorder are two major complex mental disorders with high heritability. Evidence shows that rare variants with significant clinical impacts contribute to the genetic liability of these two disorders. Also, rare variants associated with schizophrenia and affective disorders are highly personalized; each patient may carry different variants. We used whole genome sequencing analysis to study the genetic basis of two families with schizophrenia and major depressive disorder. We did not detect de novo, autosomal dominant, or recessive pathogenic or likely pathogenic variants associated with psychiatric disorders in these two families. Nevertheless, we identified multiple rare inherited variants with unknown significance in the probands. In family 1, with singleton schizophrenia, we detected four rare variants in genes implicated in schizophrenia, including p.Arg1627Trp of LAMA2, p.Pro1338Ser of CSMD1, p.Arg691Gly of TLR4, and Arg182X of AGTR2. The p.Arg691Gly of TLR4 was inherited from the father, while the other three were inherited from the mother. In family 2, with two affected sisters diagnosed with major depressive disorder, we detected three rare variants shared by the two sisters in three genes implicated in affective disorders, including p.Ala4551Gly of FAT1, p.Val231Leu of HOMER3, and p.Ile185Met of GPM6B. These three rare variants were assumed to be inherited from their parents. Prompted by these findings, we suggest that these rare inherited variants may interact with each other and lead to psychiatric conditions in these two families. Our observations support the conclusion that inherited rare variants may contribute to the heritability of psychiatric disorders.

1. Introduction

Schizophrenia and affective disorders are two major psychiatric diseases without the fully elucidated pathogenesis essential for a more comprehensive treatment strategy. Both schizophrenia and affective disorders are complex disorders involving interactions between genetic and environmental factors. Genetic factors play a significant role in the pathogenesis of these two disorders. Affective disorders consist of major depressive disorder and bipolar disorders. The heritability of schizophrenia is 81% [1], while the heritability of major depressive disorder is 31–42% [2]. For bipolar disorders, the family-based heritability of bipolar disorder is 44%, while the twin-based heritability of bipolar disorder is between 60% and 90% [3]. Elucidating the genetic basis of schizophrenia and affective disorders would provide insight into the pathogenesis of schizophrenia and affective disorders.
Genome-wide association studies have identified many common single nucleotide polymorphisms (SNPs) with modest effects associated with schizophrenia and affective disorders [4,5,6,7]. However, common SNPs explain only a part of the heritability of schizophrenia and affective disorders. There is still missing heritability information for these two disorders. Recently, increasing evidence has indicated that rare genetic and genomic variants contribute to the missing heritability of schizophrenia and affective disorders. Rare variants associated with schizophrenia and affective disorders usually have significant clinical impacts and are closer to the biological pathogenesis of schizophrenia and affective disorders [6,8,9].
Rare variants associated with schizophrenia and affective disorders include chromosomal abnormalities, translocations, copy number variations (CNVs), small insertions and deletions (indels), and single nucleotide variants (SNVs) [8,10,11,12,13,14,15]. They may occur from de novo mutation in sporadic cases or be transmitted in the familial form of schizophrenia and affective disorders [12,16]. Collecting families for genetic analysis is essential to clarify the inheritance pattern of rare variants associated with psychiatric conditions [17]. Further, rare genetic variants associated with psychiatric disorders are usually personalized, specific to the affected individuals and families [18,19,20], and have pleiotropic clinical effects [15]. Identifying specific pathogenic variants related to schizophrenia and affective disorders can help establish the molecular diagnosis [21], understand the pathogenesis [22], and provide helpful genetic counseling for the affected patients and families [23].
Whole genome sequencing (WGS) is a new sequencing technology that can identify genetic variations at the genome-wide level [24]. We used this technology with family analysis to explore the genetic basis for families that joined our precision psychiatry study series. We identified several rare specific variants associated with schizophrenia [25,26], affective disorders [27,28], and intellectual disability [27,29] in our previous publications, supporting the utility of this approach. This paper reports the clinical and genetic findings in two families with schizophrenia and major depressive disorder.

2. Results

We obtained 30× of read depth, on average, from WGS experiments for each subject. After filtering the variants with the criteria described in the Section 4, we obtained multiple variants in several genes implicated in psychiatric conditions through a literature review. We also interpreted the clinical significance of these variants following the “Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology” [30].

2.1. Clinical Reports of Family 1

The genealogy of this family is shown in Figure 1. The female patient was in her forties. She was born at full term without unusual complications. She grew up normally, with no remarkable life events before her mental illness. She suffered from psychotic symptoms such as auditory hallucinations and delusions of persecution when she was twenty-five. She did not have disturbing behaviors or an unstable mood. Physical and neurological examinations and laboratory tests did not discover any abnormalities. She was diagnosed with paranoid schizophrenia at that time. Her parents and younger sister did not have any mental illness. After the treatment of various currently available antipsychotics, the severity of her auditory hallucinations and delusions improved, but they did not disappear completely. She feels annoyed by the persistent auditory hallucinations and residual delusions and cannot concentrate her attention. The residual hallucinations and delusions restricted her social and occupational activities. She tried repetitive transcranial magnetic stimulation therapy, but to no effect. She currently receives antipsychotics regularly at a psychiatric outpatient clinic.

2.2. Genetic Findings of Family 1

We obtained genomic DNA from the patient and her parents but could not obtain DNA from her younger sister for the study. We did not detect de novo pathogenic or likely pathogenic mutations associated with psychiatric disorders in the patient. Also, we did not find recessive homozygous or compound heterozygous variants associated with psychiatric disorders in this patient. Nevertheless, we detected four inherited rare variants of unknown significance in four respective genes implicated in psychiatric disorders in the patient, including p.Arg1627Trp of LAMA2, p.Arg691Gly of TLR4, p.Pro1338Ser of CSMD1, and Arg182X of AGTR2. These variants were classified as having unknown significance according to the ACMG standards and guidelines [30]. We verified the authenticity of these variants using Sanger sequencing and show the results in Figure 2. The p.Arg691Gly of TLR4 was inherited from her unaffected father, while the other three variants were inherited from her unaffected mother. The detailed genetic information of these four rare variants is listed in Table 1, including genomic positions, allele frequencies, and functional prediction.

2.3. Clinical Reports of Family 2

The genealogy of family 2 is shown in Figure 3. Both sisters were in their sixties. The elder sister was married and had a simple life until 54 years old. She suffered from a depressed mood with suicidal ideation and anxiety. She was diagnosed with major depressive disorder. Her younger sister was also married and had a simple life until she was fifty. She was diagnosed with a major depressive disorder, like her elder sister. Both sisters responded well to anti-depressants and anxiolytic treatment. Both sisters had unaffected sons who were in their thirties, respectively. They did not join this study. Their father was deceased, and their mother was in her eighties. Unfortunately, we could not obtain her agreement to join this study. Hence, we could not obtain her DNA for the family study.

2.4. Genetic Findings of Family 2

After analyzing the WGS data for these two sisters, we did not find de novo pathogenic or likely pathogenic mutations associated with psychiatric conditions in these two sisters. Also, we did not identify homozygous or compound heterozygous mutations related to psychiatric disorders in these two sisters. Nevertheless, we detected three rare variants shared by two sisters in three respective genes implicated in affective disorders, including p.Ala4551Gly of FAT1, p.Val231Leu of HOMER3, and p.Ile185Met of GPM6B. These variants were classified as having unknown significance according to the ACMG standards and guidelines [30]. We verified the authenticity of these variants using Sanger sequencing and show the results in Figure 4. These three variants were assumed to be inherited from their parents. The detailed genetic information of these three rare variants is summarized in Table 2, including genomic positions, allele frequencies, and functional predictions.

3. Discussion

These two families received CNV screening via chromosomal microarray analysis in our previous studies [31,32], but we did not detect rare pathogenic or likely pathogenic CNVs associated with their psychiatric conditions. Hence, they were further subjected to WGS analysis. In family 1, we did not detect pathogenic or likely pathogenic mutations associated with the mental illnesses in the proband. Nevertheless, we saw four rare inherited variants in four respective genes implicated in psychiatric disorders in the proband. The p.Arg691Gly of TLR4 was inherited from the father, while the other three variants were inherited from the mother. Both parents were unaffected. All four variants were predicted to be deleterious through in silico analysis.
The LAMA2 gene encodes the laminin subunit alpha 2, a member of the laminin protein complex. Laminin is an extracellular protein and a basement membrane member that interacts with other extracellular matrix proteins and mediates cellular attachment, migration, and organization during embryonic development. Pathogenic mutations of the LAMA2 gene usually cause autosomal recessive congenital muscular dystrophy [33]. Also, mutations of LAMA2 have been found in patients with severe childhood epilepsy [34] and malformations of cortical development [35]. Recently, a novel frameshift homozygous variant (p.Tyr1313LeufsTer4) in the LAMA2 gene was found in a patient with congenital muscular dystrophy who had autism-like behavior [36]. A genetic study of schizophrenia discovered that recurrent de novo mutations of LAMA2 were found significantly more often in schizophrenia than controls [37], suggesting that LAMA2 variants may be involved in neuropsychiatric disorders. The complete human LAMA2 protein structure is not available yet in the protein data bank of UniProt or in the AlphaFold protein structure database. Hence, it is hard to predict the impact of the Arg1627Trp mutant on the LAMA2 protein structure. We also searched for interacting factors with the LAMA2 in BioGRID and found a total of 16 proteins/genes interacting with LAMA2. Among them, SNAPIN physically interacts with LAMA2 and is implicated in the pathophysiology of schizophrenia [38,39,40]. Hence, we considered that the Arg1627Trp of LAMA2 detected in this family might contribute to the mental condition of the patient.
CSMD1 encodes the CUB and Sushi multiple domains 1 protein, a transmembrane protein that controls several cellular functions. CSMD1 has been linked to several diseases, such as cancer, Parkinson’s disease, and schizophrenia [41], indicating that CSMD1 dysfunction has various clinical effects. Several genetic studies reported that CSMD1 was associated with schizophrenia [42,43,44,45]. However, this finding was not replicated in a Chinese sample [46]. CSMD1 is also one of the genes shared by several major psychiatric disorders such as schizophrenia, bipolar disorder, major depressive disorder, autism spectrum disorder, attention deficit hyperactivity disorder, anxiety disorder, and posttraumatic stress disorder [47,48,49,50]. Further, mRNA and protein levels of the CSMD1 were significantly lower in the peripheral blood in schizophrenia, compared with controls [51,52,53]. These data support the idea that CSMD1 is likely a risk gene for major psychiatric disorders, including schizophrenia. According to the UniProt, the Pro1338Ser mutation is located at the CUB domain 8 of the CSMD1. Also, six proteins/genes interact with CSMD1, according to BioGRID. Among them, the BCL6 protein level in the cerebral spinal fluid was associated with an increased risk of schizophrenia in a study [54], supporting the idea that Pro1338Ser mutation might contribute to the mental illness of the patient in this family.
The TLR4 gene encodes the Toll-like receptor 4 protein, a member of the Toll-like receptor family. The Toll-like receptor family recognizes pathogen-associated molecules expressed on the infectious pattern and mediates the immune response. The dysregulation of the Toll-like receptor-mediated inflammation is considered a pathogenetic mechanism of schizophrenia [55,56,57]. Increased TLR4-mediated immune responses have been observed in patients with schizophrenia [58,59]. TLR4 expression in peripheral blood cells is significantly higher in drug-naïve schizophrenia patients than in controls [60]. Further, genetic polymorphisms of TLR4 have been associated with schizophrenia in several studies [59,61,62]. According to the UniProt, the Arg691Gly mutation is located at the TIR domain of TLR4. The TIR domain mediates interaction with the NOX4 [63]. A study showed significant increased expression of NOX4 in patients with schizophrenia [64]. These data support the idea that the p.Arg691Gly of TLR4 found in this study may contribute indirectly to the mental illness of the proband in family 1.
AGTR1 and AGTR2 are essential in developing kidney and urinary tract systems. AGTR1 and AGTR2 encode angiotensin II receptor type 1 and type 2, respectively. Both receptors are key components of the rennin-angiotensin system (RAS), which regulates blood pressure and electrolytes [65,66]. The aberrant function of RAS is essentially associated with hypertension and cardiovascular diseases [67,68]. Loss-of-function mutations of AGTR1 and AGTR2 contribute to the congenital anomalies of the kidney and urinary tract (CAKUT) [69]. Mutations of AGTR1 result in renal tubular dysgenesis, an autosomal recessive form of congenital kidney maldevelopment [70,71]. Nevertheless, increasing evidence indicates that aberrant RAS has expanding roles in health and diseases, including in psychiatric disorders [72,73,74].
Notably, mutations of AGTR2 were associated with X-linked intellectual disability (XLID) [75]. In that study, the authors detected the absence of the expression of AGTR2 in a female patient with an intellectual disability who had a balanced translocation between X and seven chromosomes. They further screened AGTR2 mutations in 590 male patients with intellectual disability and identified one frameshift and three missense mutations of AGTR2 in 8 patients. Thus, they suggested that AGTR2 might play a role in brain development and cognition [75]. Other studies further supported the association between AGTR2 mutations and intellectual disability. A study examined a sample of Finnish male patients with non-specific intellectual disabilities. The study discovered two missense mutations of AGTR2 in their subjects [76]. Also, a novel missense mutation of AGTR2 was identified in a Japanese male patient with severe intellectual disability, pervasive developmental disorder, and epilepsy [77]. Nevertheless, several other studies argued against the role of AGTR2 in intellectual disability [78,79,80,81]. The discrepancies between different studies need further clarification, but these findings indicate that AGTR2 may play a role in brain function. The proband in this family did not have hypertension, urinary tract dysfunction, or any intellectual disability except for schizophrenia. Thus, we suggest that schizophrenia might be one of the clinical phenotypes of AGTR2 mutations. The integral AGTR2 protein is a seven-transmembrane protein. According to the UniProt, the Arg182X mutation leads to a truncated protein of AGTR2, missing two extracellular domains, three transmembrane domains, and two cytoplasmic domains. Hence, the Arg182X mutant might affect its binding to angiotensin and other interacting factors. We further searched its interacting factors in BioGRID and found nine proteins/genes interacting with the AGTR2. Among them, PARP1 and ZBTB16 were implicated in the pathogenesis of schizophrenia. Parp1-deficient mice showed defective neurogenesis and maldevelopment of the brain, and manifested schizophrenia-like behavior [82,83]. Zbtb16-deficient mice showed social impairment, repetitive behaviors, risk-taking behaviors, and cognitive impairment [84]. A further mechanistic study found that the Zbtb16 transcriptome included genes involved in neocortical maturation and autism spectrum disorder, and schizophrenia pathobiology [84]. These data support the involvement of the Arg182X mutation of the ARTR2 in the patient’s mental condition.
In family 2, we also did not detect pathogenic or likely pathogenic mutations in the two affected sisters. Instead, we saw three rare variants that might be relevant to major depressive disorder, including p.Ala4551Gly of FAT1, p.Val231Leu of HOMER3, and p.Ile185Met of GPM6B. These three variants were present in the two sisters. Hence, these variants were assumed to be inherited from one of their parents. These variants may be present in the germline cells of their father or mother, or they may exist in mosaicism in the germline cell of their parents. However, we were not able to confirm these possibilities.
FAT1 gene encodes the FAT atypical cadherin 1 protein and belongs to the cadherin superfamily. FAT1 has an important function in the maintenance of organs and development. Also, it activates several signaling pathways. The aberrant dysfunction of FAT1 is primarily associated with tumor formation and growth [85,86]. However, these two sisters and their parents had no tumor history. Two studies reported that FAT1 is a susceptibility gene for bipolar disorder [87,88], although this association was not replicated in the other study [89]. Other studies reported that FAT1 was implicated in autism spectrum disorders [90,91,92]. These data suggest that genetic variants of FAT1 might be associated with psychiatric conditions. According to UniProt, FAT1 is a single-transmembrane protein consisting of 4588 amino acids. The Ala4551Gly mutation is located near the cytoplasmic C-terminal of the FAT1. Interestingly, UniProt also showed that FAT1 has binary interaction with the HOMER3 protein, in which we also found a rare mutation in these two sisters.
The HOMER3 gene encodes the homer scaffold protein 3, a member of the homer family of postsynaptic scaffold proteins. Homer family proteins mediate postsynaptic signaling and consist of HOMER1, -2, and -3 [93]. HOMER1 variants are associated with neuropsychiatric disorders, such as schizophrenia, Alzheimer’s disease, addiction, pain, intellectual disability, and traumatic brain injury [94]. HOMER2 is associated with alcohol and stress [95,96]. Also, HOMER2 is essential in normal human hearing; HOMER2 mutations are associated with hearing loss in humans [97,98]. There are few works in the literature about the relationship between HOMER3 and neuropsychiatric disorders. Studies have shown that the detection of anti-HOMER3 autoantibodies is associated with autoimmune cerebellar ataxia and impaired cognition [99,100]. Nevertheless, a whole-exome sequencing study of 184 samples with major depressive disorder discovered five cases carrying rare missense variants of HOMER3 [101], suggesting that rare genetic variants of HOMER3 might be associated with major depressive disorder. The detection of the rare HOMER3 mutation Val231Leu in this study is line with their findings. The HOMER3 protein consists of 361 amino acids. The Val231Leu mutation is located at the coiled coil domain of the HOMER3 protein, according to the UniProt. As mentioned before, HOMER3 and FAT1 have binary interaction; hence, both the Ala4551Gly mutation of FAT1 and the Val231Leu mutation of HOMER3 might contribute to the major depression of these two sisters.
The GPM6B is an X-linked gene encoding the glycoprotein M6B, a member of the proteolipid protein family. GPM6B is expressed in neurons, oligodendrocytes, and astrocytes [102,103], but the physiological function of GPM6B is unclear. A genome-wide association study discovered that an SNP rs6528024 of GPM6B was significantly associated with delay discounting [104], a trait underlying impulse control. Higher delay discounting is associated with attention-deficit/hyperactivity disorder, schizophrenia, major depression, smoking, personality, cognition, and body weight. All these data suggest the possible involvement of GPM6B in neurocognitive traits.
A genetic study of suicide and the X-chromosome reported an association of several markers at the X-chromosome with male suicide completers. The study also found six differentially expressed genes in the postmortem brains of suicide completers, including GPM6B. GPM6B was significantly down-regulated in the depression suicide completers compared to normal subjects [105]. Another study also discovered the reduced expression of GPM6B in the hippocampus of depression suicides, providing further support for the involvement of GPM6B in the pathogenesis of major depression [106]. UniProt states that GPM6B is a 265-amino acid protein with four transmembrane domains. The Ile185Met mutation is located between transmembranes 3 and 4. BioGRID showed 24 proteins/genes interacting with GPM6B in humans. Among them, SLC6A4 encodes the serotonin transporter that transports the serotonin from the synaptic cleft to the presynaptic neuron. Genetic variants of SLC6A have been the focus of association studies of major depressive disorder and anti-depressant response [107,108]. Hence, the Ile185Met mutation of GPM6B might be associated with major depressive disorder through interactions with SLC6A4.
This study did not find pathogenic or likely pathogenic mutations associated with psychiatric disorders in these two families. However, this study detected several rare variants in genes implicated in neuropsychiatric disorders. This observation suggests an oligogenic model of psychiatric disorders. Rare variants associated with psychiatric conditions may occur from de novo mutation or be transmitted within families [12,109,110,111]. We calculated the chance of the simultaneous presence of multiple rare variants in the general population by multiplying the allele frequency of each rare variant obtained from the databases of Taiwan Biobank and Allele Frequency Aggregator (ALFA). For family 1, the estimated concurrent frequency of four rare variants (p.Arg1627Trp of LAMA2, p.Pro1338Ser of CSMD1, p.Arg691Gly of TLR4, and Arg182X of AGTR2) was zero using either the Taiwan Biobank database (0.00033 × 0 × 0 × 0.005020 = 0) or the ALFA database (0 × 0 × 0.000172 × 0.000035 = 0). For family 2, the estimated concurrent frequency of three rare variants (p.Ala4551Gly of FAT1, p.Val231Leu of HOMER3, and p.Ile185Met of GPM6B) in the general population was very rare using data from the Taiwan Biobank (0.017469 × 0.001980 × 0.000670 = 2.32 × 10−7), or zero when using ALFA (0.00029 × 0.0738 × 0 = 0). These data suggest that the opportunity for the concurrence of multiple rare variants associated with psychiatric disorders in the general population is extremely rare. Still, intermarriage may increase their coexistence.
Our observations are consistent with a recent study that reported five rare heterozygous variants associated with schizophrenia in a multiplex family. These variants were transmitted from their unaffected parents. Hence, the authors proposed that these variants had cumulative and threshold effects on the development of schizophrenia [112], suggesting that gene–gene interaction is an essential mechanism of oligogenic model psychiatric disorders [113]. Our recent paper also discovered seven rare damaging variants in a patient diagnosed with intellectual disability, autism spectrum disorder, and psychosis. All these rare variants were inherited from his unaffected parents [29].
The reporting of multiple rare inherited variants in two families affected with schizophrenia and major depressive disorders supports the idea that rare inherited variants from various genes might be a genetic mechanism that may explain a part of the missing heritability of mental disorders. These multiple genes might have a moderate risk compared to common SNPs with small and rare mutations with large effect sizes. When moderate-risk genes work together, they may reach a threshold and lead to clinical presentations. Detecting these rare oligogenic variants would provide new insights into the pathogenesis of psychiatric disorders and improve the clinical care of patients in the future.
Our study has several limitations. First, the prediction of functional impacts of variants identified in this study was inconsistent in different software. Second, we did not conduct functional assays to measure the effects of variants identified in this study at biochemical or molecular levels. Hence, we do not know their actual impacts. Third, the variants identified in the sisters of family 2 were assumed to be inherited from their parents, but we could not confirm this through family study. Fourth, the study is limited by the small sample size. Hence, our report can only be considered to show preliminary and descriptive observations. The ways in which the oligogenic model contributes to the missing heritability of psychiatric disorders needs further large-scale study.

4. Materials and Methods

4.1. Subjects

All subjects were residents of Taiwan. We consecutively recruited families with single or multiple cases affected with major psychiatric disorders into our precision psychiatry study series. The Review Board of the Chang Gung Memorial Hospital—Linkou approved this study, with the approval number 201801385A3. Each participant signed their informed consent after a full explanation of this study. We interviewed each participant and reviewed their medical records to collect their clinical information. The psychiatric diagnosis followed the diagnostic criteria of the DSM-5 (Diagnostic and Statistical Manual of Mental Disorder—5th edition) [114]. We prepared the genomic DNA from a blood sample for each participant.

4.2. Whole-Genome Sequencing (WGS) Analysis

We performed short-read paired-end whole-genome sequencing using the Illumina NovaSeq6000 platform (Illumina, San Diego, CA, USA) to search for small indels and SNVs. The experiment followed the standard protocols provided by the manufacturer. After a quality check, we aligned the sequencing data to the human reference genome build hg19/GRch37. Afterwards, we used the SAMtools (https://www.htslib.org/, accessed on 1 June 2022) and Genome Analysis Tool Kit (https://gatk.broadinstitute.org/hc/en-us, accessed on 1 June 2022) to refine the local alignment and generate a variant calling file (VCF) for each subject. To search for rare pathogenic SNVs associated with their psychiatric conditions in these two families, we set up several criteria to filter out the variants. We defined an allele frequency less than 0.01 as rare. Hence, we first filtered out variants with an allele frequency ≥ 0.01 from several databases. Also, we excluded variants with a read depth of less than 10×. Next, we selected variants with functional impacts of being damaging, possible damaging, probably damaging, deleterious, or disease-causing as predicted by several online software for further analysis. After obtaining a list of rare variants with compromised functional impacts, we manually curated them by reviewing the literature to determine their association with psychiatric disorders. Finally, we interpreted their clinical relevance following the “Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology” [30]. Further, we assessed the inheritance pattern of candidate variants by family analysis under different modes of inheritance, including de novo mutation, autosomal dominant, autosomal recessive, and X-linked inheritance. We used the SeqsLab software (https://www.atgenomix.com/seqslab-platform, accessed on 1 June 2022, Atgenomics, Taipei, Taiwan) to perform these analyses.

4.3. Bioinformatics Analysis

We checked the allele frequency of variants in the dbSNP (https://www.ncbi.nlm.nih.gov/snp/, accessed on 28 February 2023) and the Taiwan Biobank (https://taiwanview.twbiobank.org.tw/index, accessed on 28 February 2023). We defined variants with an allele frequency less than 0.01 as rare. We also used online software to predict the functional impacts of rare variants identified in this study, including Polyphen-2 (http://genetics.bwh.harvard.edu/pph2/index.shtml, accessed on 28 February 2023) [115], SIFT (https://sift.bii.a-star.edu.sg/, accessed on 28 February 2023) [116], and Mutation Taster (http://www.mutationtaster.org, accessed on 28 February 2023) [117]. TAfter filtering the variants with allele < 0.01, we selected variants with putatively deleterious effects and assessed their possible association with psychiatric disorders by reviewing the literature published in PubMed. To determine the damage of mutations on protein structure identified in this study, we looked at the protein structure in the UniProt Knowledgebase (https://www.uniprot.org/, accessed on 6 June 2023) [118]. Also, we examined the interacting proteins with the mutant genes using BioGrid (https://thebiogrid.org, accessed on 6 June 2023), a database of protein, genetic, and chemical interactions [119].

4.4. Sanger Sequencing

To verify the authenticity of mutations identified from whole-genome sequencing analysis, we designed primer pairs to obtain amplicons that covered the variants of interest using polymerase chain reaction (PCR)-based Sanger sequencing. In brief, 30 cycles of PCR were performed in a 20 μL mixture containing 100 ng DNA, 1 μM of each primer, 1X buffer, 0.25 mM of dNTP, and 0.5 U of Power Taq polymerase (Genomics, New Taipei City, Taiwan). An aliquot of the amplicon was purified and subjected to Sanger sequencing using the BigDye Terminator kit v3.1 (Applied Biosystems, Foster, CA, USA). We have summarized the primer sequences, optimal annealing temperature, and the size of each amplicon in Table 3.

5. Conclusions

Schizophrenia and major depressive disorders are two different diseases from clinical point of view, but several lines of study indicate shared heritability between these two disorders. Our study detected multiple inherited rare variants in two families with schizophrenia and major depressive disorder, respectively. We suggest that this might also be a common genetic mechanism shared by these two psychiatric conditions.

Author Contributions

Conceptualization, C.-H.C. and Y.-S.H.; investigation, I.-H.C., Y.-S.H., T.-H.F. and C.-H.C.; writing—original draft preparation, I.-H.C. and C.-H.C.; writing—review and editing, C.-H.C. and Y.-S.H.; funding acquisition, C.-H.C. and Y.-S.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Chang Gung Memorial Hospital—Linkou, Taoyuan, Taiwan, Grant Numbers CORPG3J0311, CORPG3J0312, and CORPG3J0313, and the Ministry of Science and Technology, Taiwan, Grant Number MOST 107-2314-B-182-057-MY2.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board of Chang Gung Memorial Hospital—Linkou (Protocol Code 201801385A3, 28 October 2018).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The raw data are available upon request of the corresponding author.

Acknowledgments

We thank Atgenomics (Taipei, Taiwan) for their assistance in the analysis of whole-genome sequencing data.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the study’s design, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

References

  1. Sullivan, P.F.; Kendler, K.S.; Neale, M.C. Schizophrenia as a complex trait: Evidence from a meta-analysis of twin studies. Arch. Gen. Psychiatry 2003, 60, 1187–1192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Sullivan, P.F.; Neale, M.C.; Kendler, K.S. Genetic epidemiology of major depression: Review and meta-analysis. Am. J. Psychiatry 2000, 157, 1552–1562. [Google Scholar] [CrossRef] [PubMed]
  3. O’Connell, K.S.; Coombes, B.J. Genetic contributions to bipolar disorder: Current status and future directions. Psychol. Med. 2021, 51, 2156–2167. [Google Scholar] [CrossRef] [PubMed]
  4. Ikeda, M.; Takahashi, A.; Kamatani, Y.; Okahisa, Y.; Kunugi, H.; Mori, N.; Sasaki, T.; Ohmori, T.; Okamoto, Y.; Kawasaki, H.; et al. A genome-wide association study identifies two novel susceptibility loci and trans population polygenicity associated with bipolar disorder. Mol. Psychiatry 2018, 23, 639–647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Cattarinussi, G.; Delvecchio, G.; Sambataro, F.; Brambilla, P. The effect of polygenic risk scores for major depressive disorder, bipolar disorder and schizophrenia on morphological brain measures: A systematic review of the evidence. J. Affect. Disord. 2022, 310, 213–222. [Google Scholar] [CrossRef]
  6. Flint, J. The genetic basis of major depressive disorder. Mol. Psychiatry 2023, in press. [Google Scholar] [CrossRef]
  7. Thalamuthu, A.; Mills, N.T.; Berger, K.; Minnerup, H.; Grotegerd, D.; Dannlowski, U.; Meinert, S.; Opel, N.; Repple, J.; Gruber, M.; et al. Genome-wide interaction study with major depression identifies novel variants associated with cognitive function. Mol. Psychiatry 2022, 27, 1111–1119. [Google Scholar] [CrossRef]
  8. Legge, S.E.; Santoro, M.L.; Periyasamy, S.; Okewole, A.; Arsalan, A.; Kowalec, K. Genetic architecture of schizophrenia: A review of major advancements. Psychol. Med. 2021, 51, 2168–2177. [Google Scholar] [CrossRef]
  9. Hall, J.; Bray, N.J. Schizophrenia Genomics: Convergence on Synaptic Development, Adult Synaptic Plasticity, or Both? Biol. Psychiatry 2022, 91, 709–717. [Google Scholar] [CrossRef]
  10. MacIntyre, D.J.; Blackwood, D.H.R.; Porteous, D.J.; Pickard, B.S.; Muir, W.J. Chromosomal abnormalities and mental illness. Mol. Psychiatry 2003, 8, 275–287. [Google Scholar] [CrossRef] [Green Version]
  11. Blackwood, D.H.R.; Thiagarajah, T.; Malloy, P.; Pickard, B.S.; Muir, W.J. Chromosome abnormalities, mental retardation and the search for genes in bipolar disorder and schizophrenia. Neurotox. Res. 2008, 14, 113–120. [Google Scholar] [CrossRef] [PubMed]
  12. Jouan, L.; Gauthier, J.; Dion, P.A.; Rouleau, G.A. Rare variants in complex traits: Novel identification strategies and the role of de novo mutations. Hum. Hered. 2012, 74, 215–225. [Google Scholar] [CrossRef] [PubMed]
  13. Malhotra, D.; Sebat, J. CNVs: Harbingers of a rare variant revolution in psychiatric genetics. Cell 2012, 148, 1223–1241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Trifu, S.C.; Kohn, B.; Vlasie, A.; Patrichi, B.-E. Genetics of schizophrenia (Review). Exp. Ther. Med. 2020, 20, 3462–3468. [Google Scholar] [CrossRef]
  15. Rees, E.; Kirov, G. Copy number variation and neuropsychiatric illness. Curr. Opin. Genet. Dev. 2021, 68, 57–63. [Google Scholar] [CrossRef]
  16. Kato, T. Whole genome/exome sequencing in mood and psychotic disorders. Psychiatry Clin. Neurosci. 2015, 69, 65–76. [Google Scholar] [CrossRef]
  17. Glahn, D.C.; Nimgaonkar, V.L.; Raventós, H.; Contreras, J.; McIntosh, A.M.; Thomson, P.A.; Jablensky, A.; McCarthy, N.S.; Charlesworth, J.C.; Blackburn, N.B.; et al. Rediscovering the value of families for psychiatric genetics research. Mol. Psychiatry 2019, 24, 523–535. [Google Scholar] [CrossRef]
  18. Satterstrom, F.K.; Kosmicki, J.A.; Wang, J.; Breen, M.S.; De Rubeis, S.; An, J.-Y.; Peng, M.; Collins, R.; Grove, J.; Klei, L.; et al. Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism. Cell 2020, 180, 568–584.e23. [Google Scholar] [CrossRef]
  19. Kato, H.; Kimura, H.; Kushima, I.; Takahashi, N.; Aleksic, B.; Ozaki, N. The genetic architecture of schizophrenia: Review of large-scale genetic studies. J. Hum. Genet. 2023, 68, 175–182. [Google Scholar] [CrossRef]
  20. Havdahl, A.; Niarchou, M.; Starnawska, A.; Uddin, M.; van der Merwe, C.; Warrier, V. Genetic contributions to autism spectrum disorder. Psychol. Med. 2021, 51, 2260–2273. [Google Scholar] [CrossRef]
  21. Zhang, Y.; Li, Y.; Guo, R.; Xu, W.; Liu, X.; Zhao, C.; Guo, Q.; Xu, W.; Ni, X.; Hao, C.; et al. Genetic diagnostic yields of 354 Chinese ASD children with rare mutations by a pipeline of genomic tests. Front. Genet. 2023, 14, 1108440. [Google Scholar] [CrossRef]
  22. Nakamura, T.; Takata, A. The molecular pathology of schizophrenia: An overview of existing knowledge and new directions for future research. Mol. Psychiatry 2023, in press. [Google Scholar] [CrossRef]
  23. Morris, E.; Inglis, A.; Austin, J. Psychiatric genetic counseling for people with copy number variants associated with psychiatric conditions. Clin. Genet. 2022, 102, 369–378. [Google Scholar] [CrossRef]
  24. Van Dijk, E.L.; Jaszczyszyn, Y.; Naquin, D.; Thermes, C. The Third Revolution in Sequencing Technology. Trends Genet. 2018, 34, 666–681. [Google Scholar] [CrossRef]
  25. Chen, C.-H.; Huang, A.; Huang, Y.-S.; Fang, T.-H. Identification of a Rare Novel KMT2C Mutation That Presents with Schizophrenia in a Multiplex Family. J. Pers. Med. 2021, 11, 1254. [Google Scholar] [CrossRef]
  26. Chen, C.-H.; Cheng, M.-C.; Hu, T.-M.; Ping, L.-Y.; Kushima, I.; Aleksic, B. Identification of rare mutations of the vasoactive intestinal peptide receptor 2 gene in schizophrenia. Psychiatr. Genet. 2022, 32, 125–130. [Google Scholar] [CrossRef]
  27. Chen, C.-H.; Huang, Y.-S.; Fang, T.-H. Identification of a novel nonsense homozygous mutation of LINS1 gene in two sisters with intellectual disability, schizophrenia, and anxiety. Biomed. J. 2021, 44, 748–751. [Google Scholar] [CrossRef]
  28. Chen, C.-H.; Huang, Y.-S.; Liao, D.-L.; Huang, C.-Y.; Lin, C.-H.; Fang, T.-H. Identification of Rare Mutations of Two Presynaptic Cytomatrix Genes BSN and PCLO in Schizophrenia and Bipolar Disorder. J. Pers. Med. 2021, 11, 1057. [Google Scholar] [CrossRef]
  29. Huang, Y.-S.; Fang, T.-H.; Kung, B.; Chen, C.-H. Two Genetic Mechanisms in Two Siblings with Intellectual Disability, Autism Spectrum Disorder, and Psychosis. J. Pers. Med. 2022, 12, 1013. [Google Scholar] [CrossRef]
  30. Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [Green Version]
  31. Chen, C.-H.; Cheng, M.-C.; Hu, T.-M.; Ping, L.-Y. Chromosomal Microarray Analysis as First-Tier Genetic Test for Schizophrenia. Front. Genet. 2021, 12, 620496. [Google Scholar] [CrossRef] [PubMed]
  32. Cheng, M.-C.; Chien, W.-H.; Huang, Y.-S.; Fang, T.-H.; Chen, C.-H. Translational Study of Copy Number Variations in Schizophrenia. Int. J. Mol. Sci. 2021, 23, 457. [Google Scholar] [CrossRef] [PubMed]
  33. Sarkozy, A.; Foley, A.R.; Zambon, A.A.; Bönnemann, C.G.; Muntoni, F. LAMA2-Related Dystrophies: Clinical Phenotypes, Disease Biomarkers, and Clinical Trial Readiness. Front. Mol. Neurosci. 2020, 13, 123. [Google Scholar] [CrossRef] [PubMed]
  34. Hong, S.-Y.; Yang, J.-J.; Li, S.-Y.; Lee, I.-C. A Wide Spectrum of Genetic Disorders Causing Severe Childhood Epilepsy in Taiwan: A Case Series of Ultrarare Genetic Cause and Novel Mutation Analysis in a Pilot Study. J. Pers. Med. 2020, 10, 281. [Google Scholar] [CrossRef]
  35. Accogli, A.; Severino, M.; Riva, A.; Madia, F.; Balagura, G.; Iacomino, M.; Carlini, B.; Baldassari, S.; Giacomini, T.; Croci, C.; et al. Targeted re-sequencing in malformations of cortical development: Genotype-phenotype correlations. Seizure 2020, 80, 145–152. [Google Scholar] [CrossRef]
  36. Nouri, Z.; Sarmadi, A.; Narrei, S.; Sehhati, M.; Tabatabaiefar, M.A. Whole exome sequencing identified a novel LAMA2 frameshift variant causing merosin-deficient congenital muscular dystrophy in a patient with cardiomyopathy, and autism-like behavior. Neuromuscul. Disord. 2022, 32, 776–784. [Google Scholar] [CrossRef]
  37. Xu, B.; Ionita-Laza, I.; Roos, J.L.; Boone, B.; Woodrick, S.; Sun, Y.; Levy, S.; Gogos, J.A.; Karayiorgou, M. De novo gene mutations highlight patterns of genetic and neural complexity in schizophrenia. Nat. Genet. 2012, 44, 1365–1369. [Google Scholar] [CrossRef] [Green Version]
  38. Feng, Y.-Q.; Zhou, Z.-Y.; He, X.; Wang, H.; Guo, X.-L.; Hao, C.-J.; Guo, Y.; Zhen, X.-C.; Li, W. Dysbindin deficiency in sandy mice causes reduction of snapin and displays behaviors related to schizophrenia. Schizophr. Res. 2008, 106, 218–228. [Google Scholar] [CrossRef]
  39. Hu, H.; Wang, X.; Li, C.; Li, Y.; Hao, J.; Zhou, Y.; Yang, X.; Chen, P.; Shen, X.; Zhang, S. Loss of Dysbindin Implicates Synaptic Vesicle Replenishment Dysregulation as a Potential Pathogenic Mechanism in Schizophrenia. Neuroscience 2021, 452, 138–152. [Google Scholar] [CrossRef]
  40. Dickman, D.K.; Tong, A.; Davis, G.W. Snapin is critical for presynaptic homeostatic plasticity. J. Neurosci. 2012, 32, 8716–8724. [Google Scholar] [CrossRef] [Green Version]
  41. Ermis Akyuz, E.; Bell, S.M. The Diverse Role of CUB and Sushi Multiple Domains 1 (CSMD1) in Human Diseases. Genes 2022, 13, 2332. [Google Scholar] [CrossRef] [PubMed]
  42. Håvik, B.; Le Hellard, S.; Rietschel, M.; Lybæk, H.; Djurovic, S.; Mattheisen, M.; Mühleisen, T.W.; Degenhardt, F.; Priebe, L.; Maier, W.; et al. The complement control-related genes CSMD1 and CSMD2 associate to schizophrenia. Biol. Psychiatry 2011, 70, 35–42. [Google Scholar] [CrossRef] [PubMed]
  43. The Schizophrenia Psychiatric Genome-Wide Association Study (GWAS) Consortium. Genome-wide association study identifies five new schizophrenia loci. Nat. Genet. 2011, 43, 969–976. [Google Scholar] [CrossRef] [PubMed]
  44. Fatima, A.; Farooq, M.; Abdullah, U.; Tariq, M.; Mustafa, T.; Iqbal, M.; Tommerup, N.; Mahmood Baig, S. Genome-Wide Supported Risk Variants in MIR137, CACNA1C, CSMD1, DRD2, and GRM3 Contribute to Schizophrenia Susceptibility in Pakistani Population. Psychiatry Investig. 2017, 14, 687–692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Liu, W.; Liu, F.; Xu, X.; Bai, Y. Replicated association between the European GWAS locus rs10503253 at CSMD1 and schizophrenia in Asian population. Neurosci. Lett. 2017, 647, 122–128. [Google Scholar] [CrossRef] [PubMed]
  46. Liu, Y.; Cheng, Z.; Wang, J.; Jin, C.; Yuan, J.; Wang, G.; Zhang, F.; Zhao, X. No association between the rs10503253 polymorphism in the CSMD1 gene and schizophrenia in a Han Chinese population. BMC Psychiatry 2016, 16, 206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Lotan, A.; Fenckova, M.; Bralten, J.; Alttoa, A.; Dixson, L.; Williams, R.W.; van der Voet, M. Neuroinformatic analyses of common and distinct genetic components associated with major neuropsychiatric disorders. Front. Neurosci. 2014, 8, 331. [Google Scholar] [CrossRef]
  48. Chen, X.; Long, F.; Cai, B.; Chen, X.; Qin, L.; Chen, G. A Novel Relationship for Schizophrenia, Bipolar, and Major Depressive Disorder. Part 8: A Hint from Chromosome 8 High Density Association Screen. Mol. Neurobiol. 2017, 54, 5868–5882. [Google Scholar] [CrossRef] [Green Version]
  49. Ortega-Alonso, A.; Ekelund, J.; Sarin, A.-P.; Miettunen, J.; Veijola, J.; Järvelin, M.-R.; Hennah, W. Genome-Wide Association Study of Psychosis Proneness in the Finnish Population. Schizophr. Bull. 2017, 43, 1304–1314. [Google Scholar] [CrossRef]
  50. Woo, H.J.; Yu, C.; Kumar, K.; Reifman, J. Large-scale interaction effects reveal missing heritability in schizophrenia, bipolar disorder and posttraumatic stress disorder. Transl. Psychiatry 2017, 7, e1089. [Google Scholar] [CrossRef] [Green Version]
  51. Liu, Y.; Fu, X.; Tang, Z.; Li, C.; Xu, Y.; Zhang, F.; Zhou, D.; Zhu, C. Altered expression of the CSMD1 gene in the peripheral blood of schizophrenia patients. BMC Psychiatry 2019, 19, 113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Abd El Gayed, E.M.; Rizk, M.S.; Ramadan, A.N.; Bayomy, N.R. mRNA Expression of the CUB and Sushi Multiple Domains 1 (CSMD1) and Its Serum Protein Level as Predictors for Psychosis in the Familial High-Risk Children and Young Adults. ACS Omega 2021, 6, 24128–24138. [Google Scholar] [CrossRef] [PubMed]
  53. Hatzimanolis, A.; Foteli, S.; Stefanatou, P.; Ntigrintaki, A.-A.; Ralli, I.; Kollias, K.; Nikolaou, C.; Gazouli, M.; Stefanis, N.C. Deregulation of complement components C4A and CSMD1 peripheral expression in first-episode psychosis and links to cognitive ability. Eur. Arch. Psychiatry Clin. Neurosci. 2022, 272, 1219–1228. [Google Scholar] [CrossRef] [PubMed]
  54. Gu, X.; Dou, M.; Su, W.; Jiang, Z.; Duan, Q.; Cao, B.; Chen, Y. Identifying novel proteins underlying schizophrenia via integrating pQTLs of the plasma, CSF, and brain with GWAS summary data. BMC Med. 2022, 20, 474. [Google Scholar] [CrossRef]
  55. Venkatasubramanian, G.; Debnath, M. The TRIPS (Toll-like receptors in immuno-inflammatory pathogenesis) Hypothesis: A novel postulate to understand schizophrenia. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2013, 44, 301–311. [Google Scholar] [CrossRef]
  56. Garcia Bueno, B.; Caso, J.R.; Madrigal, J.L.; Leza, J.C. Innate immune receptor Toll-like receptor 4 signalling in neuropsychiatric diseases. Neurosci. Biobehav. Rev. 2016, 64, 134–147. [Google Scholar] [CrossRef]
  57. Carnac, T. Schizophrenia Hypothesis: Autonomic Nervous System Dysregulation of Fetal and Adult Immune Tolerance. Front. Syst. Neurosci. 2022, 16, 844383. [Google Scholar] [CrossRef]
  58. McKernan, D.P.; Dennison, U.; Gaszner, G.; Cryan, J.F.; Dinan, T.G. Enhanced peripheral toll-like receptor responses in psychosis: Further evidence of a pro-inflammatory phenotype. Transl. Psychiatry 2011, 1, e36. [Google Scholar] [CrossRef] [Green Version]
  59. García-Bueno, B.; Gassó, P.; MacDowell, K.S.; Callado, L.F.; Mas, S.; Bernardo, M.; Lafuente, A.; Meana, J.J.; Leza, J.C. Evidence of activation of the Toll-like receptor-4 proinflammatory pathway in patients with schizophrenia. J. Psychiatry Neurosci. 2016, 41, E46–E55. [Google Scholar] [CrossRef] [Green Version]
  60. Balaji, R.; Subbanna, M.; Shivakumar, V.; Abdul, F.; Venkatasubramanian, G.; Debnath, M. Pattern of expression of Toll like receptor (TLR)-3 and -4 genes in drug-naïve and antipsychotic treated patients diagnosed with schizophrenia. Psychiatry Res. 2020, 285, 112727. [Google Scholar] [CrossRef]
  61. Gurung, J.; Bera, N.K.; Lama, M.; Singh, B. Association of TLR-4 896A/G, TLR-4 1196C/T, and TLR-9 C/T polymorphism with schizophrenia in Indian Bengalee patient. Indian J. Psychiatry 2022, 64, 579–587. [Google Scholar] [CrossRef]
  62. Mostafa, M.; Elwasify, M.; Fathy, A.A.; Abdelsalam, M. Toll-Like Receptor 4 Gene Polymorphisms and Susceptibility to Schizophrenia: A Case-Control Study. Immunol. Investig. 2022, 51, 2009–2024. [Google Scholar] [CrossRef]
  63. Park, H.S.; Jung, H.Y.; Park, E.Y.; Kim, J.; Lee, W.J.; Bae, Y.S. Cutting edge: Direct interaction of TLR4 with NAD(P)H oxidase 4 isozyme is essential for lipopolysaccharide-induced production of reactive oxygen species and activation of NF-κB. J. Immunol. 2004, 173, 3589–3593. [Google Scholar] [CrossRef] [Green Version]
  64. Ershova, E.S.; Shmarina, G.V.; Martynov, A.V.; Zakharova, N.V.; Veiko, R.V.; Umriukhin, P.E.; Kostyuk, G.P.; Kutsev, S.I.; Veiko, N.N.; Kostyuk, S.V. NADPH-oxidase 4 gene over-expression in peripheral blood lymphocytes of the schizophrenia patients. PLoS ONE 2022, 17, e0269130. [Google Scholar] [CrossRef]
  65. Fyhrquist, F.; Saijonmaa, O. Renin-angiotensin system revisited. J. Intern. Med. 2008, 264, 224–236. [Google Scholar] [CrossRef]
  66. Turner, A.J.; Nalivaeva, N.N. Angiotensin-converting enzyme 2 (ACE2): Two decades of revelations and re-evaluation. Peptides 2022, 151, 170766. [Google Scholar] [CrossRef]
  67. Junho, C.V.C.; Trentin-Sonoda, M.; Panico, K.; Dos Santos, R.S.N.; Abrahão, M.V.; Vernier, I.C.S.; Fürstenau, C.R.; Carneiro-Ramos, M.S. Cardiorenal syndrome: Long road between kidney and heart. Heart Fail. Rev. 2022, 27, 2137–2153. [Google Scholar] [CrossRef]
  68. Pedreanez, A.; Mosquera, J.; Munoz, N.; Robalino, J.; Tene, D. Diabetes, heart damage, and angiotensin II. What is the relationship link between them? A minireview. Endocr. Regul. 2022, 56, 55–65. [Google Scholar] [CrossRef]
  69. Kagan, M.; Pleniceanu, O.; Vivante, A. The genetic basis of congenital anomalies of the kidney and urinary tract. Pediatr. Nephrol. 2022, 37, 2231–2243. [Google Scholar] [CrossRef]
  70. Gribouval, O.; Morinière, V.; Pawtowski, A.; Arrondel, C.; Sallinen, S.-L.; Saloranta, C.; Clericuzio, C.; Viot, G.; Tantau, J.; Blesson, S.; et al. Spectrum of mutations in the renin-angiotensin system genes in autosomal recessive renal tubular dysgenesis. Hum. Mutat. 2012, 33, 316–326. [Google Scholar] [CrossRef]
  71. Gubler, M.-C. Renal tubular dysgenesis. Pediatr. Nephrol. 2014, 29, 51–59. [Google Scholar] [CrossRef] [PubMed]
  72. Szczepanska-Sadowska, E.; Wsol, A.; Cudnoch-Jedrzejewska, A.; Czarzasta, K.; Żera, T. Multiple Aspects of Inappropriate Action of Renin-Angiotensin, Vasopressin, and Oxytocin Systems in Neuropsychiatric and Neurodegenerative Diseases. J. Clin. Med. 2022, 11, 908. [Google Scholar] [CrossRef] [PubMed]
  73. Tran, S.; Kuruppu, S.; Rajapakse, N.W. Chronic Renin-Angiotensin System Activation Induced Neuroinflammation: Common Mechanisms Underlying Hypertension and Dementia? J. Alzheimer’s Dis. 2022, 85, 943–955. [Google Scholar] [CrossRef]
  74. Wu, H.; Sun, Q.; Yuan, S.; Wang, J.; Li, F.; Gao, H.; Chen, X.; Yang, R.; Xu, J. AT1 Receptors: Their Actions from Hypertension to Cognitive Impairment. Cardiovasc. Toxicol. 2022, 22, 311–325. [Google Scholar] [CrossRef] [PubMed]
  75. Vervoort, V.S.; Beachem, M.A.; Edwards, P.S.; Ladd, S.; Miller, K.E.; de Mollerat, X.; Clarkson, K.; DuPont, B.; Schwartz, C.E.; Stevenson, R.E.; et al. AGTR2 mutations in X-linked mental retardation. Science 2002, 296, 2401–2403. [Google Scholar] [CrossRef] [PubMed]
  76. Ylisaukko-oja, T.; Rehnström, K.; Vanhala, R.; Tengström, C.; Lähdetie, J.; Järvelä, I. Identification of two AGTR2 mutations in male patients with non-syndromic mental retardation. Hum. Genet. 2004, 114, 211–213. [Google Scholar] [CrossRef]
  77. Takeshita, E.; Nakagawa, E.; Nakatani, K.; Sasaki, M.; Goto, Y.-I. Novel AGTR2 missense mutation in a Japanese boy with severe mental retardation, pervasive developmental disorder, and epilepsy. Brain Dev. 2012, 34, 776–779. [Google Scholar] [CrossRef]
  78. Bienvenu, T.; Poirier, K.; Van Esch, H.; Hamel, B.; Moraine, C.; Fryns, J.P.; Ropers, H.H.; Beldjord, C.; Yntema, H.G.; Chelly, J. Rare polymorphic variants of the AGTR2 gene in boys with non-specific mental retardation. J. Med. Genet. 2003, 40, 357–359. [Google Scholar] [CrossRef] [Green Version]
  79. Erdmann, J.; Dähmlow, S.; Guse, M.; Hetzer, R.; Regitz-Zagrosek, V. The assertion that a G21V mutation in AGTR2 causes mental retardation is not supported by other studies. Hum. Genet. 2004, 114, 396–397. [Google Scholar] [CrossRef]
  80. Huang, D.; Sun, W.; Strom, C.M. Sequence variations in AGTR2 are unlikely to be associated with X-linked mental retardation. Am. J. Med. Genet. Part A 2005, 139, 243–244. [Google Scholar] [CrossRef]
  81. Piton, A.; Redin, C.; Mandel, J.-L. XLID-causing mutations and associated genes challenged in light of data from large-scale human exome sequencing. Am. J. Hum. Genet. 2013, 93, 368–383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  82. Hong, S.; Yi, J.H.; Lee, S.; Park, C.-H.; Ryu, J.H.; Shin, K.S.; Kang, S.J. Defective neurogenesis and schizophrenia-like behavior in PARP-1-deficient mice. Cell Death Dis. 2019, 10, 943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Nelson, M.M.; Hoff, J.D.; Zeese, M.L.; Corfas, G. Poly (ADP-Ribose) Polymerase 1 Regulates Cajal-Retzius Cell Development and Neural Precursor Cell Adhesion. Front. Cell Dev. Biol. 2021, 9, 693595. [Google Scholar] [CrossRef] [PubMed]
  84. Usui, N.; Berto, S.; Konishi, A.; Kondo, M.; Konopka, G.; Matsuzaki, H.; Shimada, S. Zbtb16 regulates social cognitive behaviors and neocortical development. Transl. Psychiatry 2021, 11, 242. [Google Scholar] [CrossRef]
  85. Zhang, X.; Liu, J.; Liang, X.; Chen, J.; Hong, J.; Li, L.; He, Q.; Cai, X. History and progression of Fat cadherins in health and disease. OncoTargets Ther. 2016, 9, 7337–7343. [Google Scholar] [CrossRef] [Green Version]
  86. Peng, Z.; Gong, Y.; Liang, X. Role of FAT1 in health and disease (Review). Oncol. Lett. 2021, 21, 398. [Google Scholar] [CrossRef]
  87. Blair, I.P.; Chetcuti, A.F.; Badenhop, R.F.; Scimone, A.; Moses, M.J.; Adams, L.J.; Craddock, N.; Green, E.; Kirov, G.; Owen, M.J.; et al. Positional cloning, association analysis and expression studies provide convergent evidence that the cadherin gene FAT contains a bipolar disorder susceptibility allele. Mol. Psychiatry 2006, 11, 372–383. [Google Scholar] [CrossRef] [Green Version]
  88. Abou Jamra, R.; Becker, T.; Georgi, A.; Feulner, T.; Schumacher, J.; Stromaier, J.; Schirmbeck, F.; Schulze, T.G.; Propping, P.; Rietschel, M.; et al. Genetic variation of the FAT gene at 4q35 is associated with bipolar affective disorder. Mol. Psychiatry 2008, 13, 277–284. [Google Scholar] [CrossRef]
  89. Light, K.J.; Miller, A.L.; Doughty, C.J.; Joyce, P.R.; Olds, R.J.; Kennedy, M.A. FAT and bipolar affective disorder. Mol. Psychiatry 2007, 12, 899–900. [Google Scholar] [CrossRef]
  90. Frei, J.A.; Brandenburg, C.; Nestor, J.E.; Hodzic, D.M.; Plachez, C.; McNeill, H.; Dykxhoorn, D.M.; Nestor, M.W.; Blatt, G.J.; Lin, Y.-C. Postnatal expression profiles of atypical cadherin FAT1 suggest its role in autism. Biol. Open 2021, 10, bio056457. [Google Scholar] [CrossRef]
  91. Costa, C.I.S.; da Silva Montenegro, E.M.; Zarrei, M.; de Sá Moreira, E.; Silva, I.M.W.; de Oliveira Scliar, M.; Wang, J.Y.T.; Zachi, E.C.; Branco, E.V.; da Costa, S.S.; et al. Copy number variations in a Brazilian cohort with autism spectrum disorders highlight the contribution of cell adhesion genes. Clin. Genet. 2022, 101, 134–141. [Google Scholar] [CrossRef] [PubMed]
  92. Hernando-Davalillo, C.; Martín, A.A.S.; Borregan Prats, M.; Ortigoza-Escobar, J.D. De novo 4q35.2 duplication containing FAT1 is associated with autism spectrum disorder. Clin. Genet. 2022, 102, 434–437. [Google Scholar] [CrossRef] [PubMed]
  93. Shiraishi-Yamaguchi, Y.; Furuichi, T. The Homer family proteins. Genome Biol. 2007, 8, 206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  94. Luo, P.; Li, X.; Fei, Z.; Poon, W. Scaffold protein Homer 1: Implications for neurological diseases. Neurochem. Int. 2012, 61, 731–738. [Google Scholar] [CrossRef]
  95. Quadir, S.G.; dos Santos, J.R.B.; Campbell, R.R.; Wroten, M.G.; Singh, N.; Holloway, J.J.; Bal, S.K.; Camarini, R.; Szumlinski, K.K. Homer2 regulates alcohol and stress cross-sensitization. Addict. Biol. 2016, 21, 613–633. [Google Scholar] [CrossRef] [Green Version]
  96. Castelli, V.; Brancato, A.; Cavallaro, A.; Lavanco, G.; Cannizzaro, C. Homer2 and Alcohol: A Mutual Interaction. Front. Psychiatry 2017, 8, 268. [Google Scholar] [CrossRef] [Green Version]
  97. Azaiez, H.; Decker, A.R.; Booth, K.T.; Simpson, A.C.; Shearer, A.E.; Huygen, P.L.M.; Bu, F.; Hildebrand, M.S.; Ranum, P.T.; Shibata, S.B.; et al. HOMER2, a stereociliary scaffolding protein, is essential for normal hearing in humans and mice. PLoS Genet. 2015, 11, e1005137. [Google Scholar] [CrossRef] [Green Version]
  98. Lu, X.; Wang, Q.; Gu, H.; Zhang, X.; Qi, Y.; Liu, Y. Whole exome sequencing identified a second pathogenic variant in HOMER2 for autosomal dominant non-syndromic deafness. Clin. Genet. 2018, 94, 419–428. [Google Scholar] [CrossRef]
  99. Wu, Q.; Gong, B.; Jiang, A.; Qin, X. Case report and literature analysis: Autoimmune cerebellar ataxia associated with homer-3 antibodies. Front. Neurol. 2022, 13, 951659. [Google Scholar] [CrossRef]
  100. Hansen, N.; Radenbach, K.; Rentzsch, K.; Fox, J.; Wiltfang, J.; Bartels, C. Cerebrospinal Fluid Homer-3 Autoantibodies in a Patient with Amnestic Mild Cognitive Impairment. Brain Sci. 2023, 13, 125. [Google Scholar] [CrossRef]
  101. Han, K.-M.; Han, M.-R.; Kim, A.; Kang, W.; Kang, Y.; Kang, J.; Tae, W.-S.; Cho, Y.; Ham, B.-J. A study combining whole-exome sequencing and structural neuroimaging analysis for major depressive disorder. J. Affect. Disord. 2020, 262, 31–39. [Google Scholar] [CrossRef]
  102. Yan, Y.; Narayanan, V.; Lagenaur, C. Expression of members of the proteolipid protein gene family in the developing murine central nervous system. J. Comp. Neurol. 1996, 370, 465–478. [Google Scholar] [CrossRef]
  103. Werner, H.; Dimou, L.; Klugmann, M.; Pfeiffer, S.; Nave, K.-A. Multiple splice isoforms of proteolipid M6B in neurons and oligodendrocytes. Mol. Cell. Neurosci. 2001, 18, 593–605. [Google Scholar] [CrossRef]
  104. Sanchez-Roige, S.; Fontanillas, P.; Elson, S.L.; Pandit, A.; Schmidt, E.M.; Foerster, J.R.; Abecasis, G.R.; Gray, J.C.; de Wit, H.; Davis, L.K.; et al. Genome-wide association study of delay discounting in 23,217 adult research participants of European ancestry. Nat. Neurosci. 2018, 21, 16–18. [Google Scholar] [CrossRef]
  105. Fiori, L.M.; Zouk, H.; Himmelman, C.; Turecki, G. X chromosome and suicide. Mol. Psychiatry 2011, 16, 216–226. [Google Scholar] [CrossRef] [Green Version]
  106. Fuchsova, B.; Alvarez Juliá, A.; Rizavi, H.S.; Frasch, A.C.; Pandey, G.N. Altered expression of neuroplasticity-related genes in the brain of depressed suicides. Neuroscience 2015, 299, 1–17. [Google Scholar] [CrossRef] [Green Version]
  107. Fratelli, C.; Siqueira, J.; Silva, C.; Ferreira, E.; Silva, I. 5HTTLPR Genetic Variant and Major Depressive Disorder: A Review. Genes 2020, 11, 1260. [Google Scholar] [CrossRef]
  108. Stein, K.; Maruf, A.A.; Müller, D.J.; Bishop, J.R.; Bousman, C.A. Serotonin Transporter Genetic Variation and Antidepressant Response and Tolerability: A Systematic Review and Meta-Analysis. J. Pers. Med. 2021, 11, 1334. [Google Scholar] [CrossRef]
  109. Gershon, E.S. Bipolar illness and schizophrenia as oligogenic diseases: Implications for the future. Biol. Psychiatry 2000, 47, 240–244. [Google Scholar] [CrossRef]
  110. Du, Y.; Li, Z.; Liu, Z.; Zhang, N.; Wang, R.; Li, F.; Zhang, T.; Jiang, Y.; Zhi, X.; Wang, Z.; et al. Nonrandom occurrence of multiple de novo coding variants in a proband indicates the existence of an oligogenic model in autism. Genet. Med. 2020, 22, 170–180. [Google Scholar] [CrossRef]
  111. Wang, T.; Zhao, P.A.; Eichler, E.E. Rare variants and the oligogenic architecture of autism. Trends Genet. 2022, 38, 895–903. [Google Scholar] [CrossRef] [PubMed]
  112. John, J.; Bhattacharyya, U.; Yadav, N.; Kukshal, P.; Bhatia, T.; Nimgaonkar, V.L.; Deshpande, S.N.; Thelma, B.K. Multiple rare inherited variants in a four generation schizophrenia family offer leads for complex mode of disease inheritance. Schizophr. Res. 2020, 216, 288–294. [Google Scholar] [CrossRef] [PubMed]
  113. Wang, X.; Elston, R.C.; Zhu, X. The meaning of interaction. Hum. Hered. 2010, 70, 269–277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  114. American Psychiatric Association; DSM-5 Task Force. Diagnostic and Statistical Manual of Mental Disorders: DSM-5; American Psychiatric Association: Washington, DC, USA, 2013; Volume 5. [Google Scholar]
  115. Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A method and server for predicting damaging missense mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef] [Green Version]
  116. Ng, P.C.; Henikoff, S. Predicting deleterious amino acid substitutions. Genome Res. 2001, 11, 863–874. [Google Scholar] [CrossRef] [Green Version]
  117. Schwarz, J.M.; Cooper, D.N.; Schuelke, M.; Seelow, D. MutationTaster2: Mutation prediction for the deep-sequencing age. Nat. Methods 2014, 11, 361–362. [Google Scholar] [CrossRef]
  118. The UniProt Consortium. UniProt: The Universal Protein Knowledgebase in 2023. Nucleic Acids Res. 2023, 51, D523–D531. [Google Scholar] [CrossRef]
  119. Stark, C.; Breitkreutz, B.-J.; Reguly, T.; Boucher, L.; Breitkreutz, A.; Tyers, M. BioGRID: A general repository for interaction datasets. Nucleic Acids Res. 2006, 34, D535–D539. [Google Scholar] [CrossRef] [Green Version]
Ijms 24 11777 g001 550
Figure 1. Genealogy of family 1. Black color indicates the diagnosis of schizophrenia. White color indicates the absence of mental disorder.
Figure 1. Genealogy of family 1. Black color indicates the diagnosis of schizophrenia. White color indicates the absence of mental disorder.
Ijms 24 11777 g001
Ijms 24 11777 g002 550
Figure 2. Sanger sequencing results of four inherited variants identified in family 1. Red arrows indicate the positions of nucleotide changes.
Figure 2. Sanger sequencing results of four inherited variants identified in family 1. Red arrows indicate the positions of nucleotide changes.
Ijms 24 11777 g002
Ijms 24 11777 g003 550
Figure 3. Genealogy of the family with two sisters affected by major depressive disorder and anxiety (black circle). Their mother’s mental condition was unknown (gray circle). White color indicates the absence of mental disorder.
Figure 3. Genealogy of the family with two sisters affected by major depressive disorder and anxiety (black circle). Their mother’s mental condition was unknown (gray circle). White color indicates the absence of mental disorder.
Ijms 24 11777 g003
Ijms 24 11777 g004 550
Figure 4. Sanger sequencing results of three inherited variants identified in family 2. Red arrows indicate the positions of nucleotide changes.
Figure 4. Sanger sequencing results of three inherited variants identified in family 2. Red arrows indicate the positions of nucleotide changes.
Ijms 24 11777 g004
Table
Table 1. Multiple inherited rare variants identified in family 1.
Table 1. Multiple inherited rare variants identified in family 1.
Gene Name
and SNP		Mutation LocationInheritanceTaiwan Biobank (MAF)ALFASIFTPolyPhen-2Mutation Taster
LAMA2
rs773658276		NC_000006.11:g.129691055C > T
NM_000426.3:c.4879C > T
NM_000426.3:p.Arg1627Trp		Mother0.0003300Damaging (0.004)Probably damaging
(0.996)		Disease-causing
CSMD1
rs1443220234		NC_000008.10:g.3141807G > A
NM_033225.5:c.4012C > T
NM_033225.5:p.Pro1338Ser		Mother00Damaging (0.034)Possibly damaging
(0.513)		Disease-causing
TLR4
rs201670644		NC_000009.11:g.120476597C > G
NM_003266.3:c.2071C > G
NM_003266.3:p.Arg691Gly		Father00.000172Damaging
(0.000)		Probably damaging
(1.000)		Disease-causing
AGTR2
rs186326479		NC_000023.10:g.115304077C > T
NM_000686.4:c.544C > T
NM_000686.4:p.Arg182X		Mother0.0050200.000035N/AN/ADisease-causing
MAF: minor allele frequency; ALFA: allele frequency aggregator; SIFT: sorting intolerant from tolerant; PolyPhen-2: polymorphism phenotyping v2. N/A: not applicable.
Table
Table 2. Multiple inherited rare variants identified in family 2.
Table 2. Multiple inherited rare variants identified in family 2.
Gene Name
and SNP		Mutation LocationTaiwan
Biobank (MAF)		ALFASIFT
(Score)		PolyPhen-2Mutation Taster
FAT1
rs148468016		NC_000004.11:g.187509861G > C
NM_005245.3:c.13652C > G
NM_005245.3:p.Ala4551Gly		0.0174690.00029Damaging
(0.009)		Probably
damaging
(1.000)		Disease-causing
HOMER3
rs200520741		NC_000019.9:g.19042434C > G
NM_001145722.1:c.691G > C
NM_001145722.1:p.Val231Leu		0.0019800.000378Damaging (0.027)Probably
damaging
(0.998)		Disease-causing
GPM6B
rs774122710		NC_000023.10:g.13797959G > C
NM_005278.3:c.555C > G
NM_005278.3:p.Ile185Met		0.0006700Damaging
(0.007)		Probably
damaging
(0.992)		Disease-causing
MAF: minor allele frequency; ALFA: allele frequency aggregator; SIFT: sorting intolerant from tolerant; PolyPhen-2: polymorphism phenotyping v2.
Table
Table 3. Sequences of primers, optimal annealing temperature (Ta), and amplicon size for PCR-based sequencing of variants identified in this study.
Table 3. Sequences of primers, optimal annealing temperature (Ta), and amplicon size for PCR-based sequencing of variants identified in this study.
Gene Name
and SNP		Forward Primer Sequences (5′-3′)Reverse Primer Sequences (5′-3′)Size (bp)
AGTR2
rs186326479		CTGGCTCTTTGGACCTGTGATGTGCATTAAGGCAATCCCAGCTGACCA316
CSMD1
rs1443220234		CGCTGTGCCACCTACTGGAGAACTGGGTTGTGTGAAAGCGAAATGAGC317
LAMA2
rs773658276		CCCCCATAGAGCTGTTGTGAAATACCCTGGTCAGCAGCTCGTTCAT375
TLR4
rs201670644		TCAAGCCAGGATGAGGACTGGGTACCTGAGCAGGGTCTTCTCCACCTT300
GPM6B
rs774122710		CCTCCCTGAAGTTTCCACCCAGAACTGGCTGGGTGTGTTTGGTTTCTC320
FAT1
rs148468016		GGGGAGTTGAGAGTCAGACTTCCGAGAGAACCCCATGCCCCTTACCCG244
HOMER3
rs200520741		GCGAGGCCCAGGAACCACACTTGTGGGTTTGAGACAATGCCAGCCTC347
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chung, I.-H.; Huang, Y.-S.; Fang, T.-H.; Chen, C.-H. Whole Genome Sequencing Revealed Inherited Rare Oligogenic Variants Contributing to Schizophrenia and Major Depressive Disorder in Two Families. Int. J. Mol. Sci. 2023, 24, 11777. https://doi.org/10.3390/ijms241411777

AMA Style

Chung I-H, Huang Y-S, Fang T-H, Chen C-H. Whole Genome Sequencing Revealed Inherited Rare Oligogenic Variants Contributing to Schizophrenia and Major Depressive Disorder in Two Families. International Journal of Molecular Sciences. 2023; 24(14):11777. https://doi.org/10.3390/ijms241411777

Chicago/Turabian Style

Chung, I-Hang, Yu-Shu Huang, Ting-Hsuan Fang, and Chia-Hsiang Chen. 2023. "Whole Genome Sequencing Revealed Inherited Rare Oligogenic Variants Contributing to Schizophrenia and Major Depressive Disorder in Two Families" International Journal of Molecular Sciences 24, no. 14: 11777. https://doi.org/10.3390/ijms241411777

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop