A Novel R2R3-MYB Transcription Factor PqMYB4 Inhibited Anthocyanin Biosynthesis in Paeonia qiui
Abstract
:1. Introduction
2. Results
2.1. Characterization of PqMYB4
2.2. Phylogenetic Analysis and Sequence Alignment of PqMYB4
2.3. Subcellular Localization of PqMYB4 Protein
2.4. PqMYB4 Expression Negatively Correlates with Anthocyanin Biosynthetic Gene Expression and Anthocyanin Accumulation in P. qiui
2.5. PqMYB4 Was Not a Transcriptional Activator
2.6. PqMYB4 Suppressed Anthocyanin Accumulation and the Expression of Anthocyanin Pathway Genes
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Total RNA Extraction and cDNA Synthesis
4.3. Full-Length cDNA Clone of PqMYB4
4.4. Bioinformatics Analysis of PqMYB4
4.5. Subcellular Localization
4.6. Dual Luciferase Transient Transfection Assay
4.7. Overexpression Vector Construct and Stable Transformation
4.8. Total Anthocyanin Content Measurement
4.9. Quantitative Real Time PCR Assay
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Could, K.S.; Dudle, D.A.; Neufeld, H.S. Why some stems are red: Cauline anthocyanins shield photosystem II against high light stress. J. Exp. Bot. 2010, 61, 2707–2717. [Google Scholar]
- Zhang, J.; Xu, H.; Wang, N.; Jiang, S.; Fang, H.; Zhang, Z.; Yang, G.; Wang, Y.; Su, M.; Xu, L.; et al. The ethylene response factor MdERF1B regulates anthocyanin and proanthocyanidin biosynthesis in apple. Plant Mol. Biol. 2018, 98, 205–218. [Google Scholar] [CrossRef] [PubMed]
- Deng, X.; Bashandy, H.; Ainasoja, M.; Kontturi, J.; Pietiäinen, M.; Laitinen, R.A.E.; Albert, V.A.; Valkonen, J.P.T.; Elomaa, P.; Teeri, T.H. Functional diversification of duplicated chalcone synthase genes in anthocyanin biosynthesis of Gerbera Hybrida. New Phytol. 2014, 201, 1469–1483. [Google Scholar] [CrossRef] [PubMed]
- Saito, K.; Yamazaki, M. Biochemistry and molecular biology of the late–stage of biosynthesis of anthocyanin: Lessons from Perilla frutescens as a model plant. New Phytol. 2002, 155, 9–23. [Google Scholar] [CrossRef]
- Liu, Y.; Tikunov, Y.; Schouten, R.E.; Marcelis, L.F.M.; Visser, R.G.F.; Bovy, A. Anthocyanin Biosynthesis and Degradation Mechanisms in Solanaceous Vegetables: A Review. Front. Chem. 2018, 6, 52. [Google Scholar] [CrossRef]
- Liu, J.; Osbourn, A.; Ma, P. MYB Transcription Factors as Regulators of Phenylpropanoid Metabolism in Plants. Mol. Plant 2015, 8, 689–708. [Google Scholar] [CrossRef] [Green Version]
- Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef]
- Martin, C.; Paz-Ares, J. MYB transcription factors in plants. Trends Genet. 1997, 13, 67–73. [Google Scholar] [CrossRef]
- Pattanaik, S.; Kong, Q.; Zaitlin, D.; Werkman, J.R.; Xie, C.H.; Patra, B.; Yuan, L. Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. Planta. 2010, 231, 1061–1076. [Google Scholar] [CrossRef]
- Gonzalez, A.; Zhao, M.; Leavitt, J.M.; Lloyd, A.M. Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J. 2008, 53, 814–827. [Google Scholar] [CrossRef]
- Cutanda-Perez, M.; Ageorges, A.; Gomez, C.; Vialet, S.; Terrier, N.; Romieu, C.; Torregrosa, L. Ectopic expression of VlmybA1 in grapevine activates a narrow set of genes involved in anthocyanin synthesis and transport. Plant Mol. Biol. 2009, 69, 633–648. [Google Scholar] [CrossRef] [PubMed]
- Ban, Y.; Honda, C.; Hatsuyama, Y.; Igarashi, M.; Bessho, H.; Moriguchi, T. Isolation and Functional Analysis of a MYB Transcription Factor Gene that is a Key Regulator for the Development of Red Coloration in Apple Skin. Plant Cell Physiol. 2007, 48, 958–970. [Google Scholar] [CrossRef] [PubMed]
- Feng, S.; Wang, Y.; Yang, S.; Xu, Y.; Chen, X. Anthocyanin Biosynthesis in Pears Is Regulated by a R2R3-MYB Transcription Factor PyMYB10. Planta 2010, 232, 245–255. [Google Scholar] [CrossRef] [PubMed]
- Kirik, V.; Simon, M.; Huelskamp, M.; Schiefelbein, J. The ENHANCER OF TRY AND CPC1 gene acts redundantly with TRIPTYCHON and CAPRICE in trichome and root hair cell patterning in Arabidopsis. Dev. Biol. 2004, 268, 506–513. [Google Scholar] [CrossRef] [Green Version]
- Matsui, K.; Umemura, Y.; Ohme-Takagi, M. AtMYBL2, a protein with a single MYB domain, acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis. Plant J. 2008, 55, 954–967. [Google Scholar] [CrossRef]
- Koes, R.; Verweij, W.; Quattrocchio, F. Flavonoids: A colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 2005, 10, 236–242. [Google Scholar] [CrossRef]
- Wang, S.; Chen, J.G. Regulation of Cell Fate Determination by Single-Repeat R3 MYB Transcription Factors in Arabidopsis. Front. Plant Sci. 2014, 5, 133. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Ning, G.; Lv, H.; Liao, L.; Bao, M. Single MYB-type Transcription Factor AtCAPRICE: A New Efficient Tool to Engineer the Production of Anthocyanin in Tobacco. Biochem. Biophys. Res. Commun. 2009, 388, 742–747. [Google Scholar] [CrossRef]
- Tamagnone, L.; Merida, A.; Parr, A.; Mackay, S.; Culianez-Macia, F.A.; Roberts, K.; Martin, C. The AmMYB308 and AmMYB330 Transcription Factors from Antirrhinum Regulate Phenylpropanoid and Lignin Biosynthesis in Transgenic Tobacco. Plant Cell 1998, 10, 135–154. [Google Scholar] [CrossRef] [Green Version]
- Aharoni, A.; De Vos, C.H.; Wein, M.; Sun, Z.; Greco, R.; Kroon, A.; Mol, J.N.; O’Connell, A.P. The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. Plant J. 2001, 28, 319–332. [Google Scholar] [CrossRef]
- Albert, N.W.; Davies, K.M.; Lewis, D.H.; Zhang, H.; Montefiori, M.; Brendolise, C.; Boase, M.R.; Ngo, H.; Jameson, P.E.; Schwinn, K.E. A Conserved Network of Transcriptional Activators and Repressors Regulates Anthocyanin Pigmentation in Eudicots. Plant Cell 2014, 26, 962–980. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cavallini, E.; Matus, J.T.; Finezzo, L.; Zenoni, S.; Loyola, R.; Guzzo, F.; Schlechter, R.; Ageorges, A.; Arce-Johnson, P.; Tornielli, G.B. The Phenylpropanoid Pathway Is Controlled at Different Branches by a Set of R2R3-MYB C2 Repressors in Grapevine. Plant Physiol. 2015, 167, 1448–1470. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Díaz, J.R.; Pérez-Díaz, J.; Madrid-Espinoza, J.; González-Villanueva, E.; Moreno, Y.; Ruiz-Lara, S. New member of the R2R3-MYB transcription factors family in grapevine suppresses the anthocyanin accumulation in the flowers of transgenic tobacco. Plant Mol. Biol. 2016, 90, 63–76. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, Y.; Niu, L.; Ren, L.; Si, B. Paeonia qiui, a Newly Recorded Species of Paeoniaceae from Shaanxi, China. Bot. Boreali-Occident. Sin. 2015, 35, 2337–2338. (In Chinese) [Google Scholar]
- Loguerico, L.L.; Zhang, J.Q.; Wilkins, T.A. Differential regulation of six novel MYB-domain genes defines two distinct expression patterns in allotetraploid cotton (Gossypium hirsutum L.). Mol. Gen. Genet. 1999, 261, 660–671. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Xu, H.; Yang, G.; Wang, N.; Zhang, J.; Wang, Y.; Jiang, S.; Fang, H.; Zhang, Z.; Chen, X. Molecular mechanism of MYB111 and WRKY40 involved in anthocyanin biosynthesis in red-fleshed apple callus. Plant Cell Tiss Organ. Cult. 2019, 139, 467–478. [Google Scholar] [CrossRef]
- Jun, J.H.; Liu, C.; Xiao, X.; Dixon, R.A. The Transcriptional Repressor MYB2 Regulates Both Spatial and Temporal Patterns of Proanthocyandin and Anthocyanin Pigmentation in Medicago truncatula. Plant Cell. 2015, 27, 2860–2879. [Google Scholar]
- Zhou, H.; Lin-Wang, K.; Wang, F.; Espley, R.V.; Ren, F.; Zhao, J.; Ogutu, C.; He, H.; Jiang, Q.; Allan, A.C.; et al. Activator-type R2R3-MYB genes induce a repressor-type R2R3-MYB gene to balance anthocyanin and proanthocyanidin accumulation. New Phytol. 2019, 221, 1919–1934. [Google Scholar] [CrossRef] [Green Version]
- Paolocci, F.; Robbins, M.P.; Passeri, V.; Hauck, B.; Morris, P.; Rubini, A.; Arcioni, S.; Damiani, F. The strawberry transcription factor FaMYB1 inhibits the biosynthesis of proanthocyanidins in Lotus corniculatus leaves. J. Exp. Bot. 2011, 62, 1189–1200. [Google Scholar] [CrossRef] [Green Version]
- Zimmermann, I.M.; Heim, M.A.; Weisshaar, B.; Uhrig, J.F. Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J. 2004, 40, 22–34. [Google Scholar] [CrossRef]
- Chen, L.; Hu, B.; Qin, Y.; Hu, G.; Zhao, J. Advance of the Negative Regulation of Anthocyanin Biosynthesis by MYB Transcription Factors. Plant Physiol. Biochem. 2019, 136, 178–187. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Wang, N.; Liu, J.; Qu, C.; Wang, Y.; Jiang, S.; Lu, N.; Wang, D.; Zhang, Z.; Chen, X. The molecular mechanism underlying anthocyanin metabolism in apple using the MdMYB16 and MdbHLH33 genes. Plant Mol. Biol. 2017, 94, 149–165. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Li, G.; Liu, L.; Zhang, Q.; Han, Z.; Chen, X.; Li, B. A R2R3-MYB Transcription Factor, VvMYBC2L2, Functions as a Transcriptional Repressor of Anthocyanin Biosynthesis in Grapevine (Vitis vinifera L.). Molecules 2018, 24, 92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshida, K.; Ma, D.; Constabel, C.P. The MYB182 Protein Down-Regulates Proanthocyanidin and Anthocyanin Biosynthesis in Poplar by Repressing Both Structural and Regulatory Flavonoid Genes. Plant Physiol. 2015, 167, 693–710. [Google Scholar] [CrossRef] [Green Version]
- Xu, F.; Ning, Y.; Zhang, W.; Liao, Y.; Li, L.; Cheng, H.; Cheng, S. An R2R3-MYB transcription factor as a negative regulator of the flavonoid biosynthesis pathway in Ginkgo biloba. Funct. Integr. Genom. 2014, 14, 177–189. [Google Scholar] [CrossRef]
- Wu, J.; Wang, G.; Muhammad, A.; Zeng, L. Cloning and Functional Analysis of R2R3-MYB Gene NtMYB5 in Narcissus tazetta var. Chinensis. Acta Hortic. Sin. 2018, 45, 1327–1337. [Google Scholar]
- Jin, H.; Cominelli, E.; Bailey, P.; Parr, A.; Mehrtens, F.; Jones, J.; Tonelli, C.; Weisshaar, B.; Martin, C. Transcriptional repression by AtMYB4 controls production of UV-protecting sunscreens in Arabidopsis. EMBO J. 2000, 19, 6150–6161. [Google Scholar] [CrossRef] [Green Version]
- Wong, D.C.; Schlechter, R.; Vannozzi, A.; Höll, J.; Hmmam, L.; Bogs, J.; Tornielli, G.B.; Castellarin, S.D.; Matus, J.T. A systems-oriented analysis of the grapevine R2R3-MYB transcription factor family uncovers new insights into the regulation of stilbene accumulation. DNA Res. 2016, 23, 451–466. [Google Scholar] [CrossRef]
- Kranz, H.D.; Denekamp, M.; Greco, R.; Jin, H.; Leyva, A.; Meissner, R.C.; Petroni, K.; Urzainqui, A.; Bevan, M.; Martin, C.; et al. Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. Plant J. 1998, 16, 263–276. [Google Scholar] [CrossRef]
- Kagale, S.; Links, M.G.; Rozwadowski, K. Genome-wide Analysis of Ethylene-Responsive Element Binding Factor-Associated Amphiphilic Repression Motif-Containing Transcriptional Regulators in Arabidopsis. Plant Physiol. 2010, 152, 1109–1134. [Google Scholar] [CrossRef] [Green Version]
- Xu, H.; Yang, G.; Wang, Y.; Jiang, S.; Wang, N.; Chen, X. Apple MdMYB32 Inhibits the Anthocyanin Biosynthesis by Its Own EAR Inhibitory Sequence. Sci. Agric. Sin. 2018, 51, 4690–4699. [Google Scholar]
- Zong, W.; Tang, N.; Yang, J.; Peng, L.; Ma, S.; Xu, Y.; Li, G.; Xiong, L. Feedback Regulation of ABA Signaling and Biosynthesis by a bZIP Transcription Factor Targets Drought-Resistance-Related Genes. Plant Physiol. 2016, 171, 2810–2825. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoo, S.D.; Cho, Y.H.; Sheen, J. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2017, 2, 1565–1572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, J.; Duan, J.; Huo, D.; Shi, Q.; Niu, L.; Zhang, Y. Transcriptomic Analysis Reveals Transcription Factors Related to Leaf Anthocyanin Biosynthesis in Paeonia qiui. Molecules 2017, 22, 2186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer Name | Primer Sequences | Usage |
---|---|---|
PqMYB4-F | AAAGGTACCTACTGGTGTTAGAGAGATTGG | Gene isolation |
PqMYB4-R | AAAGTCGACGGTATATTTGGCGATGGATGG | |
Pqubiquitin-F | GACCTATACCAAGCCGAAG | qRT-PCR |
Pqubiquitin-R | CGTTCCAGCACCACAATC | |
PqMYB4-F | TTGACCCTAATAACCATCG | qRT-PCR |
PqMYB4-R | TCAAGATTCAAGTCAAGCGAG | |
PqCHS-F | CTGCTATCATCATTGGTTCG | qRT-PCR |
PqCHS-R | GTCGCTTGTAGTTTTTCGGGT | |
PqCHI-F | CTATTCTTTTCACACAGAC | qRT-PCR |
PqCHI-R | TGCTTCCCTATGATCGACTCC | |
PqF3H-F | CGAAATCCCAATCATCTCC | qRT-PCR |
PqF3H-R | TATTTCACGCCAATCTCGCAC | |
PqF3′H-F | TGATGTTGATGGAGAGGGT | qRT-PCR |
PqF3′H-R | GCTAGGATTTTAGGGTGTCGG | |
PqDFR-F | GAGAATATGAGGAAGGTG | qRT-PCR |
PqDFR-R | ACACGAAATACATCCATCCAG | |
PqANS-F | ACCAGCATCACCAACATCT | qRT-PCR |
PqANS-R | GCATATTTCTCCTTCTCTTCC | |
Atactin-F | GGAACTGGAATGGTGAAGGCTG | qRT-PCR |
Atactin-R | CGATTGGATACTTCAGAGTGAGGA | |
AtCHS-F | GCATCTTGGCTATTGGCACTG | qRT-PCR |
AtCHS-R | CGTTTCCGAATTGTCGACTTGT | |
AtCHI-F | CTCCTCCAATCCATTATTCCTCG | qRT-PCR |
AtCHI-R | TTTCCCTTCCACTTGACAGATAGAG | |
AtF3H-F | GTGTTTAGCGACGAAATCCCG | qRT-PCR |
AtF3H-R | ACGAGCGAGACGAGTCATATCC | |
AtF3’H-F | TCGTGGTCGCCGCTTCTAA | qRT-PCR |
AtF3’H-R | CCATCGGTGTCCGTAAGGTG | |
AtDFR-F | CAAACGCCAAGACGCTACTCA | qRT-PCR |
AtDFR-R | CATTCACTGTCGGCTTTATCACTTC | |
AtANS-F | ACGGTCCTCAAGTTCCCACAA | qRT-PCR |
AtANS-R | CAGCTCCTCAATACAATTCTCACG | |
AtUFGT-F | TCGAAGCTACTAAGAATGGTG | qRT-PCR |
AtUFGT-R | GGTAACTCGAAAACGGACTTG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huo, D.; Liu, X.; Zhang, Y.; Duan, J.; Zhang, Y.; Luo, J. A Novel R2R3-MYB Transcription Factor PqMYB4 Inhibited Anthocyanin Biosynthesis in Paeonia qiui. Int. J. Mol. Sci. 2020, 21, 5878. https://doi.org/10.3390/ijms21165878
Huo D, Liu X, Zhang Y, Duan J, Zhang Y, Luo J. A Novel R2R3-MYB Transcription Factor PqMYB4 Inhibited Anthocyanin Biosynthesis in Paeonia qiui. International Journal of Molecular Sciences. 2020; 21(16):5878. https://doi.org/10.3390/ijms21165878
Chicago/Turabian StyleHuo, Dan, Xiaokun Liu, Yue Zhang, Jingjing Duan, Yanlong Zhang, and Jianrang Luo. 2020. "A Novel R2R3-MYB Transcription Factor PqMYB4 Inhibited Anthocyanin Biosynthesis in Paeonia qiui" International Journal of Molecular Sciences 21, no. 16: 5878. https://doi.org/10.3390/ijms21165878