Potassium Chloride, Sodium Lactate and Sodium Citrate Impaired the Antimicrobial Resistance and Virulence of Pseudomonas aeruginosa NT06 Isolated from Fish
1
Department of Biotechnology and Food Microbiology, Poznan University of Life Sciences, Wojska Polskiego 48, 60-637 Poznań, Poland
2
Department of Biochemistry and Biotechnology, Poznan University of Life Sciences, Dojazd 11, 60-632 Poznań, Poland
*
Authors to whom correspondence should be addressed.
Molecules 2023, 28(18), 6654; https://doi.org/10.3390/molecules28186654
Submission received: 11 August 2023
/
Revised: 11 September 2023
/
Accepted: 15 September 2023
/
Published: 16 September 2023
(This article belongs to the Special Issue Recent Advances in Food Microbiology Control)
Abstract
:Sodium chloride (NaCl) is a commonly used additive in minimally processed fish-based products. The addition of NaCl to fish products and packaging in a modified atmosphere is usually efficient with regard to limiting the occurrence of the aquatic environmental pathogen Pseudomonas aeruginosa. Given the negative effects of excess NaCl in the diet, there is a growing demand to reduce NaCl in food products with safer substituents, but the knowledge of their impact on antibiotic resistant P. aeruginosa is limited. This study aimed to evaluate the physiological and transcriptome characteristics of P. aeruginosa NT06 isolated from fish and to determine the effect of selected concentrations of alternative NaCl compounds (KCl/NaL/NaC) on the P. aeruginosa NT06 virulence phenotype and genotype. In the study, among the isolated microorganisms, P. aeruginosa NT06 showed the highest antibiotic resistance (to ampicillin, ceftriaxone, nalidixic acid, and norfloxacin) and the ability to grow at 4 °C. The Comprehensive Antibiotic Resistance Database (CARD) and the Virulence Factor Database (VFDB) revealed the presence of 24 and 134 gene products assigned to AMR and VF in the P. aeruginosa NT06 transcriptome, respectively. KCl, KCl/NaL and KCl/NaL/NaC inhibited pyocyanin biosynthesis, elastase activity, and protease activity from 40 to 77%. The above virulence phenotypic observations were confirmed via RT–qPCR analyses, which showed that all tested AMR and VF genes were the most downregulated due to KCl/NaL/NaC treatment. In conclusion, this study provides insight into the potential AMR and VF among foodborne P. aeruginosa and the possible impairment of those features by KCl, NaL, and NaC, which exert synergistic effects and can be used in minimally processed fish-based products.
1. Introduction
The addition of sodium chloride (NaCl) is an effective and commonly used method for preservation of minimally processed seafood. The ability of NaCl addition to reduce spoilage and the growth of pathogenic bacteria in seafood is mainly attributed to lowered water activity. Moreover, NaCl causes osmotic stress toward microorganisms and decreases oxygen solubility, which are major bacterial growth limitation factors [1]. The preservative effects of NaCl are essential for ensuring the shelf life and safety of minimally processed ready-to-eat (RTE) fish-based products, which usually receive no heat treatment during processing [2]. The food market of these products is constantly growing, due to both an increase in aquaculture production and consumer demand [3]. At the same time, because the excess NaCl intake in the diet (according to The World Health Organization, more than 5 g of NaCl per day) results in hypertension, the development of cardiovascular diseases, gastric cancers and obesity, the current recommendations for reducing the amount of NaCl within the product have recently been of great importance [4]. Therefore, minimally processed fish-based products, for which NaCl is still an important preservative agent, should be preserved with alternative compounds or techniques [5]. Hence, there is an urgent need to conduct research on the impact of alternative NaCl compounds on specific spoilage and pathogenic bacteria related to aquatic environments.
The possible NaCl alternatives that can be implemented in fish-based products are potassium chloride (KCl), sodium lactate (NaL), and sodium citrate (NaC) [6]. Research concerning partial NaCl replacement with those substituents is now gaining much attention in food microbiology. For instance, replacement NaCl with KCl and calcium ascorbate resulted in decreased microbial contamination and improved bacon overall quality [7]. The impact of 25% and 50% NaCl replacement on smoked salmon sensory and microbiological properties has also been demonstrated by Muñoz and coauthors [8]. NaCl substituents, e.g., KCl, CaCl2, and MgCl2, added to meat and seafood exhibited equivalent ionic strengths and did not result in differences in oxidation stability [9]. Nevertheless, as most of the studies were focused on sensory and organoleptic changes upon NaCl substitution, few of them considered the impact on the physiology of microorganisms present in foods [5].
Pseudomonas spp. are one of the main groups of bacteria responsible for fish spoilage, which manifests as changes in taste, smell and appearance [10,11]. Among pseudomonads, the major threat both to food quality and safety is P. aeruginosa [12]. P. aeruginosa is an opportunistic pathogen that causes acute and chronic infections due to its capacity to produce a large repertoire of virulence factors (VF) that are regulated by the quorum sensing system [13]. Recent studies revealed the presence of VF among pseudomonads obtained from clinical isolates [14,15,16,17], while little is known about the physiological characteristics of pathogenic foodborne strains. Notably, P. aeruginosa prevalence among fish and minimally processed fish-based products has constantly increased. P. aeruginosa cells were present in 31.57% of fresh fish collected from aquaculture farms [18]. Similarly, 33.1% and 20% of fresh and smoked fish, respectively, contained P. aeruginosa cells [19]. A recent study also found that in 470 fish samples, P. aeruginosa strains were present in 14.7% of fresh fish, 4% of dried fish, and 2.85% of salted and smoked fish [12]. In addition, pseudomonads isolated from food were capable of producing a wide range of pigments and forming biofilms [20,21]. Pyocyanin produced by almost all P. aeruginosa strains is a blue pigment that belongs to phenazines, and its synthesis enhances cell persistence [22]. Elastase and protease encoded by the lasB and aprA genes, respectively, are extracellular enzymes that induce tissue damage through degradation processes [23]. P. aeruginosa isolated from meat and carcasses contained a number of VF genes, among which exoS, algD, lasA, plcH, and exoU were most frequently detected [24].
P. aeruginosa isolated from seafood is also burdened with a constantly expanding antimicrobial resistance (AMR) phenotype and genotype [25,26,27]. Consequently, an increasing number of outbreaks caused by P. aeruginosa isolated from such products may occur [28,29]. Furthermore, since the vast majority of fish on the food market originate from aquaculture, where in general, there is a need for antimicrobials, AMR among fish-related bacteria can also be a problem [29,30]. Moreover, food-associated P. aeruginosa is able to rapidly develop resistance to a wide range of antimicrobials [31,32]. The prevalence of AMR Pseudomonas spp. was also shown in the diary sector, where resistance to β-lactams was the most prominent [21]. P. aeruginosa isolated from fresh fish samples was resistant to amoxicillin, cefotaxime, tetracycline, and gentamicin [18]. The antibiotic resistance profile of Pseudomonas obtained from a salmon processing environment concerned ampicillin and amoxicillin [29]. AMR phenotypes of Pseudomonas spp. isolated from fresh fish fillets included resistance to penicillin, ampicillin, amoxicillin, and tetracycline [33]. A number of studies have demonstrated that P. aeruginosa enhanced resistance to antimicrobials and virulence is due to the genome-encoded AMR systems, e.g., efflux pumps, antibiotic inactivation enzymes, and two-component regulatory systems, indicating increasing concern about foodborne AMR bacteria [16,34,35,36].
The correlation between food-associated stress factors and bacterial resistance has been comprehensively reviewed in the recent work of Liao and coauthors [37]. However, detailed knowledge of P. aeruginosa prevalence in fish and the impact of alternative preservative antimicrobial compounds is limited. Therefore, precise examination of the physiology of P. aeruginosa foodborne isolates in model experiments and their potential antibiotic resistance are important factors for maintaining high food quality and safety. The aim of the present study was to characterize the antimicrobial and virulence potential of fish-derived P. aeruginosa and to evaluate the impact of selected concentrations of KCl/NaL/NaC on AMR and VF via (i) the determination of the antibiotic resistance among P. aeruginosa strains by the disc diffusion method; (ii) identification of AMR- and VF-related genes in the most resistant P. aeruginosa fish isolate; (iii) evaluation of the impact of selected concentrations of NaCl alternative compounds on the P. aeruginosa virulence phenotype (i.e., pyocyanin content, elastase and protease activities); and (iv) assessment of the expression levels of genes involved in AMR and VF upon treatment with selected concentrations of NaCl alternative compounds in vitro and in situ.
2. Results
2.1. Antimicrobial Resistance among P. aeruginosa Strains
The resistance profile of the six P. aeruginosa strains isolated from commercially available salmon was phenotypically characterized by the ability to grow under refrigerated temperature and by using eight antibiotics that represent a different class of antibiotics, as shown in Table 1. All analyzed strains were able to grow at refrigerated temperatures, but only strain NT06 grew effectively after just 24 h. Of the eight tested antibiotics, ampicillin (AMP), ceftriaxone (CRO), and nalidixic acid (NA) showed no bactericidal effect on the examined P. aeruginosa strains. There were no significant (p < 0.05) differences in sensitivity to tetracycline (TE) among P. aeruginosa strains; the zones of inhibition were approx. 12 mm, indicating an intermediate resistance pattern [38]. All P. aeruginosa strains were sensitive to gentamicin (GEN), meropenem (MEM), and ciprofloxacin (CIP), while norfloxacin (NOR) was not effective against P. aeruginosa NT06.
2.2. P. aeruginosa NT06 Genes Involved in AMR and VF
Based on its ability to grow at low temperatures and its antibiotic resistance profile, only P. aeruginosa NT06 was chosen for transcriptome analysis. The strain was sequenced, and the obtained data were deposited as NCBI RNA-Seq data in the NCBI Short Read Archive (SRA) under the number SRX19555927. Screening of the CARD and VFDB databases resulted in a total of 24 and 134 genes assigned to AMR and VF, respectively (Table 2 and Table 3). Among the AMR genes in the P. aeruginosa NT06 transcriptome, those related to the “efflux pump complex or subunit conferring antibiotic resistance” predominated. For example, homologues of components of the MexAB-OprM efflux pump and multidrug outer membrane proteins, i.e., OpmH, OprN, and OpmE and membrane fusion proteins, i.e., MexP, MexJ, MexX, MexL, and TriA, were present. In the P. aeruginosa NT06 transcriptome, five genes with at least 98.94% homology with genes encoding proteins and two-component regulatory systems modulating antibiotic efflux, rsmA, rrmR, armR, parS, basS, and mexL, were also detected. Moreover, four members of “antibiotic inactivation enzymes” (OXA-850, OXA-486, fosA, and APH(3’)-IIb) and one gene-altering cell wall charge (arnA) were found.
The major VFs identified in the P. aeruginosa NT06 transcriptome were classified as flagella and type IV pili, which accounted for 25 and 24 genes, respectively. Among the flagella group, the genes implicated in flagellar structure and biosynthesis proteins were present, while twitching motility, fimbrial biogenesis, and chemotaxis proteins were the examples of the type IV pili group. Additionally, members of alginate biosynthesis and regulation (algU-mucA-mucB-mucC-mucD and algR-algZ) and rhamnolipid (rhlA, rhlB, rhlC) were identified. Other VFs in the P. aeruginosa NT06 transcriptome included secretion systems, as follows: HSl-1 (secretion island I), TTSS (type III), and xcp (type II) secretion systems, as well as genes encoding siderophores, i.e., phenazines, pyochelin, pyocyanin, and pyoverdine. Finally, quorum sensing-related genes (lasI, rhlI, aprA, lasA, and lasB) were also present.
However, not all genes identified in the de novo assembled transcriptome genes were also identified in the mapped transcriptome; thus, the abundance values were not calculated. The abundance of each identified gene transcript was normalized with a TPM value that indicated the number of transcripts that came from 1 million RNA molecules. The range of TPM values was between 8.41 and 110.98 in the case of CARD-identified genes, and from 0.25 to 419.40 in the group of VF genes.
2.3. The Effects of NaCl Alternatives on the P. aeruginosa NT06 Virulence Phenotype
To investigate the impact of KCl, NaL and NaC on the P. aeruginosa NT06 virulence phenotype grown on mTSB medium, spectrophotometric analyses determining the pyocyanin biosynthesis, and elastase and protease activities were performed. The results are presented in Figure 1, as the percentage of inhibition with regard to the control culture (mTSB medium supplemented with 5 g/L NaCl).
There were no significant differences in virulence phenotype inhibition in the case of KCl treatment at both tested concentrations (5 and 6 g/L); the pyocyanin biosynthesis, elastase and protease activity were inhibited by approximately 40%, 52% and 45%, respectively. The addition of NaL to KCl resulted in a considerably higher reduction in pyocyanin biosynthesis (an average of 56%) and protease activity (an average of 64%), while the combination of KCl/NaL/NaC was the most effective at retarding the P. aeruginosa NT06 virulence phenotype. The above treatment decreased pyocyanin biosynthesis and protease activity by 64% and 77%, respectively. No significant changes in elastase activity were observed for KCl/NaL and KCl/NaL/NaC treatments, which resulted in 72 and 76% elastase inhibition, respectively.
2.4. The Effect of NaCl Alternatives on Genes Involved in AMR and VF
To emphasize the effect of KCl, NaL, and NaC on genes involved in the AMR and VF of P. aeruginosa NT06, changes in their expression were determined via RT–qPCR analysis. The transcriptional levels were normalized to the non-differentially expressed reference 16S rRNA gene. The fold change values of selected genes are presented in Figure 2 and Figure 3, for in vitro and in situ conditions, respectively. The results showed that the expression of all analyzed genes was considerably decreased due to the treatment, and the highest reduction in transcriptional levels was observed for the combination of KCl/NaL/NaC compounds (the fold change ranged from −1.44 to −3.40). The relative change in gene expression obtained in FJ medium was equal to that from cells cultivated in in vitro conditions.
NaCl alternative compounds effectively decreased the expression of genes encoding the MexAB-OprM efflux pump, e.g., the addition of KCl/NaL resulted in 3.37-, 1.42-, and 2.01-fold decreases in the expression of mexA, mexB and oprM, respectively, and there were no statistically significant differences in treatment with KCl/NaL/NaC. The lowered expression of the phzS, aprA, and lasB genes corresponded with the spectrophotometric results regarding pyocyanin, elastase, and protease inhibition due to the NaCl alternative treatment. The expression of lasB was reduced by 2.00-fold and by 3.37-fold after treatment with KCl/NaL and KCl/NaL/NaC, respectively. The mRNA level of aprA was decreased, but not to the same extent; supplementation of mTSB medium with KCl/NaL and KCl/NaL/NaC resulted in aprA reduction by 1.57- and 1.67-fold, respectively, while in FJ medium the same compounds lowered the aprA gene by 1.45- and 1.64-fold, respectively. Other VFs tested (alginate-, flagella-, pili- and secretion-related genes) were also considerably inhibited by KCl/NaL and KCl/NaL/NaC. Treatment with only KCl at both concentrations was less effective at changing gene expression.
3. Discussion
Given the adverse effects of excessive NaCl intake on health, the reduction in NaCl content within food products is now in high demand. In minimally processed fish-based products, which have recently gained more interest in the food market, NaCl should be replaced with alternative compounds that will exert equal preservation effects, due to the high risk of occurrence of foodborne pathogens, such as P. aeruginosa, that are inherently associated with the aquatic environment [1]. The high probability of this pathogen’s persistence in fish, as well as virulent and antimicrobial features, induced the need for research concerning the quality and safety of minimally processed fish-based products. This study aimed to characterize the antimicrobial potential of P. aeruginosa NT06 isolated from fish and to evaluate pyocyanin biosynthesis, elastase and protease activity upon treatment with compounds that can replace NaCl (KCl, NaL, and NaC) in minimally processed fish-based products. To fully reflect the native growth conditions of P. aeruginosa isolated from fish, mTSB medium with fish peptone and FJ medium were applied.
Pseudomonad metabolic activity responsible for virulence and food spoilage may be more intense at lower temperatures than at the temperature considered optimal for cell growth [20,39,40]. Fish-based products have a high probability of containing potential reservoirs of antibiotic resistant Pseudomonas [18]. Therefore, considering the pathogenic nature of P. aeruginosa, along with the increased prevalence of antimicrobial resistance phenotypes [41], the antibiotic resistance profile was determined and served as a selection of examined strains. The present work revealed that the six examined P. aeruginosa strains isolated from commercially available fish had the ability to grow at 4 °C and were resistant to AMP, CRO and NA. The effective antibiotics for all analyzed strains included GEN, MEM, and CIP. Similar antibiotic resistance patterns for β-lactam (AMP), third-generation cephalosporins (e.g., CRO), and fluoroquinolones (e.g., NA) were established for Pseudomonas spp. isolated from fresh dairy products [21]. P. aeruginosa isolated from frozen meat and chicken nuggets also showed resistance to AMP and CRO [42]. In addition, the highest percentage of P. aeruginosa strains (89.65%) isolated from fresh and frozen meat and meat products were also resistant to AMP [43]. Resistance to AMP among pseudomonads is usually mediated by enzymes that degrade antibiotics that belong to the β-lactamase class. P. aeruginosa showed intermediate resistance towards TE. The above phenomenon is probably due to the occurrence of MexAB/MexXY efflux pump systems in P. aeruginosa cells [44]. Antimicrobial resistance of P. psychrophila isolated from fish was determined via efflux pump MexAB-OprM [45]. Furthermore, other RND family efflux pumps, such as MexCD-OprJ and MexEF-OprN, have been involved in the extrusion of β-lactams and quinolones, respectively [41]. Interestingly, the present study showed that one of the P. aeruginosa isolates (i.e., P. aeruginosa NT06) was resistant to NOR, an antibiotic from the fluoroquinolone class. Because resistance to fluoroquinolones is mainly attributed to overexpression of efflux pumps, it was hypothesized that the analyzed strain is characterized by the enhanced functioning of RND family proteins.
Therefore, to establish the transcriptome features of P. aeruginosa NTO6 grown under conditions that mimic the isolation source (mTSB medium), RNA-seq analyses were performed. The two-step approach was used: transcriptome data were mapped to the reference P. aeruginosa genome and were de novo assembled and then screened for the presence of genes classified into the AMR and VF groups according to bioinformatic tools such as the CARD and VFDB databases. Hence, the list of potential AMR and VF genes was extended with those that were not calculated in the reference-guide method, which, according to Raghavan and coauthors [46], might not be able to reconstruct all of the present transcripts. For instance, examples of gene products related to the predicted phenotype conferring the antibiotics inactivation through enzymatic reactions and related to the efflux of antibiotics, as well as HSI-1 secretion system apparatus were only identified in the P. aeruginosa NT06 transcriptome assembled de novo. Major identified AMR products concerned RND efflux pumps (mainly MexAB-OprM encoding genes), which are known for a lack of specific, effective extrusion of antimicrobials outside the cells; nevertheless, they were not always responsible for antibiotic resistance [16]. Antimicrobial efflux is also modulated by a two-component regulatory system, to which five gene products from the P. aeruginosa NT06 transcriptome were classified. Additionally, the two-component system has an essential role in the regulation of VF among P. aeruginosa [47]. RsmA protein is involved in the initial colonization of P. aeruginosa and the development of acute pneumonia [48]. P. aeruginosa NT06 was also characterized by the presence of the antibiotic resistance gene soxR, which is activated by pyocyanin [49]. The enhanced resistance of P. aeruginosa cells is also attributed to decreased membrane permeability to antimicrobials [41]. In addition to porins (opmH, oprN, opmE), our study recognized the AMR determinant arnA, in the P. aeruginosa NT06 transcriptome, which alters cell wall charge and thus has an additional effect on membrane-mediated resistance [50]. According to CARD analysis of the genomes of Pseudomonads isolated from the salmon processing environment, the major AMR elements detected were RND efflux pumps, soxR, and adeF gene products [29]. Our study also indicated a wide range of VFs among the P. aeruginosa NT06 transcriptome, and the most abundant were genes involved in alginate production and regulation. Alginate is one of the major constituents of exopolysaccharides, which contribute to decreased susceptibility to antimicrobials of biofilms [51]. Similar results were obtained by Poursina and coauthors, who showed the presence of algD VF among the P. aeruginosa strains obtained from raw meat [24].
In the food chain, especially in foods produced with minimal processing technology, bacteria encounter different sublethal stressors, which influence their response and resistance mechanisms [52]. Dietary recommendations for salt reduction have emerged from the need to search for compounds that exert similar preservative effects with no simultaneous adverse impact on health [5]. In this study, we hypothesized that NaCl replacement with combinations of different salts, KCl, NaL, and NaC, decreased the P. aeruginosa virulence phenotype, which is also perceived as significant in regard to fish spoilage processes, i.e., pyocyanin biosynthesis and elastase and protease activity. In fish products, the above pseudomonad traits result in changed organoleptic properties, mostly discoloration and degradation of tissue [33]. Spectrophotometric analyses showed the effectiveness of analyzed compounds for lowering the P. aeruginosa VF phenotype. The inhibitory effects of NaC on biofilm development, motility, pyocyanin production and proteolytic activity of P. aeruginosa were also confirmed in the work of Khayat and co-authors [53]. The antivirulence activity of low doses of NaC (5%) was also established for the fish-borne pathogen Serratia marcescens, which inhibited biofilm formation, diminished swarming motility and decreased protease activity [54]. The inhibitory effects of NaL on the foodborne pathogen S. aureus and staphylococcal enterotoxin were evaluated by Lin and coauthors [55]. Changes in the expression of genes involved in glycolysis, DNA repair, and cell division have been also reported after exposure of Listeria monocytogenes to NaL [56].
In the study, the confirmation of phenotype features was achieved via RT–qPCR analyses, which indicated lowered mRNA levels of selected genes encoding AMR and VF. Moreover, comparative transcriptomics showed the effect of 4% NaL on increasing the expression of virulence genes (actA, clpE, hly, ip, inlA, inlE, mpl, plcA and plcB) of Listeria monocytogenes [57]. Therefore, the use of organic acids as effective antimicrobial agents in food should be widely studied; these agents should be combined with other compounds (e.g., NaC) to ensure food quality and safety.
In conclusion, the following study provides insight into the potential AMR and VF among foodborne P. aeruginosa and the possible impairment of those features by KCl, NaL, and NaC, which exert synergistic effects and can be used in minimally processed fish-based products.
4. Materials and Methods
4.1. Microorganisms and Culture Conditions
Six P. aeruginosa strains isolated from commercially available raw salmon were used in this study. The bacterial cultures were grown in modified TSB medium (mTSB) (g/1000 mL of distilled water: 20.0 g of fish peptone; 2.5 g of glucose; 5.0 g of sodium chloride (NaCl); 2.5 g dipotassium phosphate (K2HPO4)) at 4 °C for 72 h. The tested cultures were supplemented with selected concentrations of KCl/NaL/NaC (Table 4). Reference cultures were grown in TSB medium (Oxoid, UK). For in situ analyses, P. aeruginosa was incubated in fish juice medium (FJ) obtained from fresh salmon fillets as described in our previous study [58].
4.2. Determination of Antibiotic Resistance
P. aeruginosa was analyzed for antibiotic resistance using the disc diffusion method as recommended by the Clinical and Laboratory Standards Institute [60]. In brief, aliquots of P. aeruginosa cultures were inoculated in sterile 0.85% NaCl to obtain a turbidity equivalent to 0.5 McFarland standard. Thereafter, the inoculum was plated on the Mueller Hinton agar plates (Thermo Fisher Scientific, Waltham, MA, USA) and standard discs with antibiotics were applied. After incubation at 37 °C for 24 h, the widths of the growth inhibition halos were measured. The following antibiotics (Oxoid, Thermo Fisher Scientific Australia Pty Ltd., Scoresby, Australia) were tested (μg/disc): AMP (10), GEN (10), CIP; 5), nalidixic acid (NA; 30), tetracycline (TE; 30), norfloxacin (NOR; 10), meropenem (MEM; 10), and ceftriaxone (CRO; 30).
4.3. Determination of the P. aeruginosa NT06 Genes Involved in AMR and VF
Initially, total RNA was isolated from P. aeruginosa NT06 cells cultured aerobically in mTSB medium (with 5 g/L NaCl) for 72 h at 4 °C using the RNAqueous Kit (Thermo Fisher Scientific, Waltham, MA, USA). The Ribominus Transcriptome Isolation Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) was used to remove the ribosomal RNA. Transcriptomic libraries were constructed using the Collibri™ Stranded RNA Library Prep Kit for Illumina™ and the Collibri™ H/M/R rRNA Depletion Kit (Thermo Fisher Scientific, Waltham, MA, USA). The obtained libraries were then analyzed on a Qubit fluorometer 4.0 (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). Whole transcriptome sequencing was performed with a MiSeq Reagent Kit on a MiSeq Illumina sequencer. Data were analyzed using CLC Genomics Workbench 20.0.4 (Qiagen, Germantown, MD, USA) software by mapping the reads to the corresponding P. aeruginosa PA01 genome and through estimation of transcript abundance with TPM (transcripts per million) values. The transcriptome was assembled de novo and analyzed for AMR and VF genes using the Comprehensive Antibiotic Resistance Database (CARD) and the Virulence Factor Database (VFDB), respectively [61,62]. RNA-Seq data were deposited in the NCBI Short-Read Archive (SRA) under the number SRX19555927.
4.4. Determination of Changes in the P. aeruginosa NT06 Virulence Phenotype
4.4.1. Assessment of Pyocyanin Content
The method of Huerta et al. [63] was used for pyocyanin content determination. Briefly, after centrifugation of bacterial cultures (3000 g/10 min), 2 mL of chloroform (Chempur, Piekary Śląskie, Poland) was added to the cell-free culture supernatants and the optical density of the chloroform layer was measured at a wavelength of 690 nm (OD690). The percent of inhibition of pyocyanin synthesis was calculated as follows:
where A is the OD690 of the chloroform layer containing pyocyanin from P. aeruginosa culture grown in mTSB medium with selected concentrations of test substances, and B is the OD690 of the chloroform layer containing pyocyanin from the reference P. aeruginosa culture.
Pyocyanin inhibition = 100 − [A/B × 100]
4.4.2. Determination of Elastase Activity
To measure the elastase activity of P. aeruginosa, an assay based on the cleavage of the elastase-specific chromogenic peptide substrate N-succinyl-Ala-Ala-Ala-p-anilide (Sigma–Aldrich, St. Louis, MO, USA) was used [64]. An aliquot of 100 µL of reaction mixture contained the cell-free supernatant, 1 mM of chromogenic substrate, and buffer (50 mM Tris-HCl, 10 mM CaCl2. Then, 1 mM ZnCl2, and 150 mM NaCl, pH 8.0 were incubated at 37 °C for 2 h. Next, an absorbance at a wavelength of 405 nm (A405) of the samples was measured in a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). The results were expressed in U l−1. The percentage of inhibition of elastase activity was calculated as follows:
where C is the A405 of samples containing the supernatant of P. aeruginosa culture grown in mTSB medium with selected concentrations of test substances, and D is the A405 of the reference P. aeruginosa culture.
Elastase inhibition = 100 − [C/D × 100]
4.4.3. Determination of Protease Activity
Proteolytic activity was assayed by measuring the release of α-amino groups with the trinitrobenzenesulfonic acid (TNBS) (Sigma–Aldrich, St. Louis, MO, USA) method [65]. The method is based on the reaction of free amino groups with TNBS reagent at pH 9.2 in the dark. Next, the absorbance at a wavelength of 420 nm (A420) of the samples was measured in a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). The results were expressed in U l−1. The percentage of inhibition of protease activity was calculated as follows:
where E is the A420 of samples containing the supernatant of P. aeruginosa culture grown in mTSB medium with selected concentrations of test substances, and F is the A420 of the reference P. aeruginosa culture.
Protease inhibition = 100 − [E/F × 100]
4.5. Determination of Changes in the Levels of AMR and VF Gene Expression
4.5.1. RNA Extraction and cDNA Synthesis
P. aeruginosa NT06 was grown on mTSB medium and on FJ medium as described in Section 2.1 and then the cultures were treated with the RNAprotect® Bacteria Reagent (Qiagen, Hilden, Germany). Total RNA was extracted and purified using the PureLink™ RNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA) and the PureLink™ DNase Set (Invitrogen, Waltham, MA, USA). RNA extracts were analyzed on a Qubit Fluorometer 4 (Invitrogen, Waltham, MA, USA) using Qubit™ XR RNA and Qubit™ IQ RNA Assay Kits (Thermo Fisher Scientific, Waltham, MA, USA) and then reverse transcribed to cDNA with a High Capacity RNA-to-cDNA Kit (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol.
4.5.2. RT–qPCR Analyses
The resulting cDNA was amplified on a CFX96 system (Bio-Rad, Hercules, CA, USA) using GoTaq® Master Mix (Promega, Walldorf, Germany) and gene-specific primers for AMR and VF-related genes (Table 5). The following cycling conditions were applied: initial denaturation at 95 °C for 2 min; 40 cycles of denaturation at 95 °C for 15 s, annealing at 52 °C and extension at 72 °C for 15 s; followed by a melting curve. The fold changes in relative gene expression levels were estimated using the 2−∆∆ct method [66] with regard to the reference gene encoding the 16S rRNA ribosome subunit.
4.6. Statistical Analysis
R Studio Software v. 4.3.1 [67] was used to conduct the statistical analyses. Significant differences (p < 0.05) were established via one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. The experiments were performed in triplicate.
Author Contributions
Conceptualization, N.T. and K.M.; methodology and investigation: N.T., K.M. and Ł.W.; writing—original draft preparation, N.T., writing—review and editing, K.M.; visualization, N.T.; supervision, K.M.; funding acquisition, N.T. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by a grant from the National Science Center, Poland (no. 2020/37/N/NZ9/00250).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data presented in this study are available on request from the corresponding authors.
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
References
- Institute of Medicine (U.S.); Henney, J.E.; Taylor, C.L.; Boon, C.S. (Eds.) Strategies to Reduce Sodium Intake in the United States; National Academies Press: Washington, DC, USA, 2010; ISBN 978-0-309-14805-4. [Google Scholar]
- Boziaris, I.S.; Stamatiou, A.P.; Nychas, G.-J.E. Microbiological Aspects and Shelf Life of Processed Seafood Products. J. Sci. Food Agric. 2013, 93, 1184–1190. [Google Scholar] [CrossRef] [PubMed]
- Menozzi, D.; Nguyen, T.T.; Sogari, G.; Taskov, D.; Lucas, S.; Castro-Rial, J.L.S.; Mora, C. Consumers’ Preferences and Willingness to Pay for Fish Products with Health and Environmental Labels: Evidence from Five European Countries. Nutrients 2020, 12, 2650. [Google Scholar] [CrossRef] [PubMed]
- da Silva Amorim Gomes, M.; Kato, L.S.; de Carvalho, A.P.A.; de Almeida, A.E.C.C.; Conte-Junior, C.A. Sodium Replacement on Fish Meat Products—A Systematic Review of Microbiological, Physicochemical and Sensory Effects. Trends Food Sci. Technol. 2021, 118, 639–657. [Google Scholar] [CrossRef]
- Rybicka, I.; Gonçalves, A.; Oliveira, H.; Marques, A.; Nunes, M.L. Salt Reduction in Seafood—A Review. Food Control 2022, 135, 108809. [Google Scholar] [CrossRef]
- Ibrahim Sallam, K. Antimicrobial and Antioxidant Effects of Sodium Acetate, Sodium Lactate, and Sodium Citrate in Refrigerated Sliced Salmon. Food Control 2007, 18, 566–575. [Google Scholar] [CrossRef]
- Ruan, J.; Xu, J.; Wu, Z.; Tang, Y.; Xiang, D.; Li, X.; Yu, Y.; Xie, X.; Tang, J.; Zhang, D.; et al. Effect of Partial Replacement of NaCl by KCl and Calcium Ascorbate on the Dynamics of Bacterial Community during Storage of Bacon Based on 16S rRNA Gene Amplicon Sequencing. LWT 2023, 184, 115013. [Google Scholar] [CrossRef]
- Muñoz, I.; Guàrdia, M.D.; Arnau, J.; Dalgaard, P.; Bover, S.; Fernandes, J.O.; Monteiro, C.; Cunha, S.C.; Gonçalves, A.; Nunes, M.L.; et al. Effect of the Sodium Reduction and Smoking System on Quality and Safety of Smoked Salmon (Salmo salar). Food Chem. Toxicol. 2020, 143, 111554. [Google Scholar] [CrossRef]
- Mariutti, L.R.B.; Bragagnolo, N. Influence of Salt on Lipid Oxidation in Meat and Seafood Products: A Review. Food Res. Int. 2017, 94, 90–100. [Google Scholar] [CrossRef]
- Zhang, Y.; Wei, J.; Yuan, Y.; Yue, T. Diversity and Characterization of Spoilage-Associated Psychrotrophs in Food in Cold Chain. Int. J. Food Microbiol. 2019, 290, 86–95. [Google Scholar] [CrossRef]
- Zhuang, S.; Hong, H.; Zhang, L.; Luo, Y. Spoilage-related Microbiota in Fish and Crustaceans during Storage: Research Progress and Future Trends. Compr. Rev. Food Sci. Food Saf. 2021, 20, 252–288. [Google Scholar] [CrossRef]
- Shahrokhi, G.R.; Rahimi, E.; Shakerian, A. The Prevalence Rate, Pattern of Antibiotic Resistance, and Frequency of Virulence Factors of Pseudomonas aeruginosa Strains Isolated from Fish in Iran. J. Food Qual. 2022, 2022, e8990912. [Google Scholar] [CrossRef]
- Rampioni, G.; Pillai, C.R.; Longo, F.; Bondì, R.; Baldelli, V.; Messina, M.; Imperi, F.; Visca, P.; Leoni, L. Effect of Efflux Pump Inhibition on Pseudomonas aeruginosa Transcriptome and Virulence. Sci. Rep. 2017, 7, 11392. [Google Scholar] [CrossRef] [PubMed]
- Eladawy, M.; El-Mowafy, M.; El-Sokkary, M.M.A.; Barwa, R. Antimicrobial Resistance and Virulence Characteristics in ERIC-PCR Typed Biofilm Forming Isolates of P. Aeruginosa. Microb. Pathog. 2021, 158, 105042. [Google Scholar] [CrossRef]
- Tielen, P.; Narten, M.; Rosin, N.; Biegler, I.; Haddad, I.; Hogardt, M.; Neubauer, R.; Schobert, M.; Wiehlmann, L.; Jahn, D. Genotypic and Phenotypic Characterization of Pseudomonas aeruginosa Isolates from Urinary Tract Infections. Int. J. Med. Microbiol. 2011, 301, 282–292. [Google Scholar] [CrossRef] [PubMed]
- Hwang, W.; Yoon, S.S. Virulence Characteristics and an Action Mode of Antibiotic Resistance in Multidrug-Resistant Pseudomonas aeruginosa. Sci. Rep. 2019, 9, 487. [Google Scholar] [CrossRef] [PubMed]
- Khaledi, A.; Schniederjans, M.; Pohl, S.; Rainer, R.; Bodenhofer, U.; Xia, B.; Klawonn, F.; Bruchmann, S.; Preusse, M.; Eckweiler, D.; et al. Transcriptome Profiling of Antimicrobial Resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2016, 60, 4722–4733. [Google Scholar] [CrossRef] [PubMed]
- Algammal, A.M.; Mabrok, M.; Sivaramasamy, E.; Youssef, F.M.; Atwa, M.H.; El-kholy, A.W.; Hetta, H.F.; Hozzein, W.N. Emerging MDR-Pseudomonas aeruginosa in Fish Commonly Harbor oprL and toxA Virulence Genes and blaTEM, blaCTX-M, and tetA Antibiotic-Resistance Genes. Sci. Rep. 2020, 10, 15961. [Google Scholar] [CrossRef]
- Benie, C.K.D.; Dadié, A.; Guessennd, N.; N’gbesso-Kouadio, N.A.; Kouame, N.D.; N’golo, D.C.; Aka, S.; Dako, E.; Dje, K.M.; Dosso, M. Characterization of Virulence Potential of Pseudomonas aeruginosa Isolated from Bovine Meat, Fresh Fish, and Smoked Fish. Eur. J. Microbiol. Immunol. 2017, 7, 55–64. [Google Scholar] [CrossRef]
- Quintieri, L.; Fanelli, F.; Zühlke, D.; Caputo, L.; Logrieco, A.F.; Albrecht, D.; Riedel, K. Biofilm and Pathogenesis-Related Proteins in the Foodborne P. Fluorescens ITEM 17298 With Distinctive Phenotypes During Cold Storage. Front. Microbiol. 2020, 11, 991. [Google Scholar] [CrossRef]
- Quintieri, L.; Fanelli, F.; Caputo, L. Antibiotic Resistant Pseudomonas Spp. Spoilers in Fresh Dairy Products: An Underestimated Risk and the Control Strategies. Foods 2019, 8, 372. [Google Scholar] [CrossRef]
- Gonçalves, T.; Vasconcelos, U. Colour Me Blue: The History and the Biotechnological Potential of Pyocyanin. Molecules 2021, 26, 927. [Google Scholar] [CrossRef]
- Casilag, F.; Lorenz, A.; Krueger, J.; Klawonn, F.; Weiss, S.; Häussler, S. The LasB Elastase of Pseudomonas aeruginosa Acts in Concert with Alkaline Protease AprA To Prevent Flagellin-Mediated Immune Recognition. Infect. Immun. 2015, 84, 162–171. [Google Scholar] [CrossRef]
- Poursina, S.; Ahmadi, M.; Fazeli, F.; Ariaii, P. Assessment of Virulence Factors and Antimicrobial Resistance among the Pseudomonas aeruginosa Strains Isolated from Animal Meat and Carcass Samples. Vet. Med. Sci. 2023, 9, 315–325. [Google Scholar] [CrossRef]
- Sheng, L.; Wang, L. The Microbial Safety of Fish and Fish Products: Recent Advances in Understanding Its Significance, Contamination Sources, and Control Strategies. Compr. Rev. Food Sci. Food Saf. 2021, 20, 738–786. [Google Scholar] [CrossRef]
- Tate, H.; Ayers, S.; Nyirabahizi, E.; Li, C.; Borenstein, S.; Young, S.; Rice-Trujillo, C.; Saint Fleurant, S.; Bodeis-Jones, S.; Li, X.; et al. Prevalence of Antimicrobial Resistance in Select Bacteria From Retail Seafood—United States, 2019. Front. Microbiol. 2022, 13, 928509. [Google Scholar] [CrossRef]
- Delannoy, S.; Hoffer, C.; Youf, R.; Dauvergne, E.; Webb, H.E.; Brauge, T.; Tran, M.-L.; Midelet, G.; Granier, S.A.; Haenni, M.; et al. High Throughput Screening of Antimicrobial Resistance Genes in Gram-Negative Seafood Bacteria. Microorganisms 2022, 10, 1225. [Google Scholar] [CrossRef]
- Kontominas, M.G.; Badeka, A.V.; Kosma, I.S.; Nathanailides, C.I. Innovative Seafood Preservation Technologies: Recent Developments. Animals 2021, 11, 92. [Google Scholar] [CrossRef]
- Thomassen, G.M.B.; Reiche, T.; Tennfjord, C.E.; Mehli, L. Antibiotic Resistance Properties among Pseudomonas Spp. Associated with Salmon Processing Environments. Microorganisms 2022, 10, 1420. [Google Scholar] [CrossRef]
- Boss, R.; Overesch, G.; Baumgartner, A. Antimicrobial Resistance of Escherichia coli, Enterococci, Pseudomonas aeruginosa, and Staphylococcus aureus from Raw Fish and Seafood Imported into Switzerland. J. Food Prot. 2016, 79, 1240–1246. [Google Scholar] [CrossRef]
- Jeukens, J.; Freschi, L.; Kukavica-Ibrulj, I.; Emond-Rheault, J.-G.; Tucker, N.P.; Levesque, R.C. Genomics of Antibiotic-Resistance Prediction in Pseudomonas aeruginosa. Ann. N. Y. Acad. Sci. 2019, 1435, 5–17. [Google Scholar] [CrossRef]
- Hölzel, C.S.; Tetens, J.L.; Schwaiger, K. Unraveling the Role of Vegetables in Spreading Antimicrobial-Resistant Bacteria: A Need for Quantitative Risk Assessment. Foodborne Pathog. Dis. 2018, 15, 671–688. [Google Scholar] [CrossRef]
- Ben Mhenni, N.; Alberghini, G.; Giaccone, V.; Truant, A.; Catellani, P. Prevalence and Antibiotic Resistance Phenotypes of Pseudomonas Spp. in Fresh Fish Fillets. Foods 2023, 12, 950. [Google Scholar] [CrossRef] [PubMed]
- Lorusso, A.B.; Carrara, J.A.; Barroso, C.D.N.; Tuon, F.F.; Faoro, H. Role of Efflux Pumps on Antimicrobial Resistance in Pseudomonas aeruginosa. Int. J. Mol. Sci. 2022, 23, 15779. [Google Scholar] [CrossRef]
- Hou, A.; Yang, D.; Miao, J.; Shi, D.; Yin, J.; Yang, Z.; Shen, Z.; Wang, H.; Qiu, Z.; Liu, W.; et al. Chlorine Injury Enhances Antibiotic Resistance in Pseudomonas aeruginosa through over Expression of Drug Efflux Pumps. Water Res. 2019, 156, 366–371. [Google Scholar] [CrossRef]
- Vaillancourt, M.; Limsuwannarot, S.P.; Bresee, C.; Poopalarajah, R.; Jorth, P. Pseudomonas aeruginosa mexR and mexEF Antibiotic Efflux Pump Variants Exhibit Increased Virulence. Antibiotics 2021, 10, 1164. [Google Scholar] [CrossRef]
- Liao, X.; Ma, Y.; Daliri, E.B.-M.; Koseki, S.; Wei, S.; Liu, D.; Ye, X.; Chen, S.; Ding, T. Interplay of Antibiotic Resistance and Food-Associated Stress Tolerance in Foodborne Pathogens. Trends Food Sci. Technol. 2020, 95, 97–106. [Google Scholar] [CrossRef]
- Igbinosa, I.H.; Beshiru, A.; Igbinosa, E.O. Antibiotic Resistance Profile of Pseudomonas aeruginosa Isolated from Aquaculture and Abattoir Environments in Urban Communities. Asian Pac. J. Trop. Dis. 2017, 7, 47–52. [Google Scholar] [CrossRef]
- Meng, L.; Zhang, Y.; Liu, H.; Zhao, S.; Wang, J.; Zheng, N. Characterization of Pseudomonas Spp. and Associated Proteolytic Properties in Raw Milk Stored at Low Temperatures. Front. Microbiol. 2017, 8, 2158. [Google Scholar] [CrossRef]
- Moreno, R.; Rojo, F. Features of Pseudomonads Growing at Low Temperatures: Another Facet of Their Versatility. Environ. Microbiol. Rep. 2014, 6, 417–426. [Google Scholar] [CrossRef]
- Pang, Z.; Raudonis, R.; Glick, B.R.; Lin, T.-J.; Cheng, Z. Antibiotic Resistance in Pseudomonas aeruginosa: Mechanisms and Alternative Therapeutic Strategies. Biotechnol. Adv. 2019, 37, 177–192. [Google Scholar] [CrossRef]
- Bhuiya, M.; Sarkar, M.K.I.; Sohag, M.H.; Ali, H.; Roy, C.K.; Akther, L.; Sarker, A.F. Enumerating Antibiotic Susceptibility Patterns of Pseudomonas aeruginosa Isolated from Different Sources in Dhaka City. Open Microbiol. J. 2018, 12, 172–180. [Google Scholar] [CrossRef] [PubMed]
- Rezaloo, M.; Motalebi, A.; Mashak, Z.; Anvar, A. Prevalence, Antimicrobial Resistance, and Molecular Description of Pseudomonas aeruginosa Isolated from Meat and Meat Products. J. Food Qual. 2022, 2022, e9899338. [Google Scholar] [CrossRef]
- Morita, Y.; Tomida, J.; Kawamura, Y. Responses of Pseudomonas aeruginosa to Antimicrobials. Front. Microbiol. 2014, 4, 422. [Google Scholar] [CrossRef]
- Tomaś, N.; Myszka, K.; Wolko, Ł.; Nuc, K.; Szwengiel, A.; Grygier, A.; Majcher, M. Effect of Black Pepper Essential Oil on Quorum Sensing and Efflux Pump Systems in the Fish-Borne Spoiler Pseudomonas psychrophila KM02 Identified by RNA-Seq, RT-qPCR and Molecular Docking Analyses. Food Control 2021, 130, 108284. [Google Scholar] [CrossRef]
- Raghavan, V.; Kraft, L.; Mesny, F.; Rigerte, L. A Simple Guide to de Novo Transcriptome Assembly and Annotation. Brief. Bioinform. 2022, 23, bbab563. [Google Scholar] [CrossRef]
- Sultan, M.; Arya, R.; Kim, K.K. Roles of Two-Component Systems in Pseudomonas aeruginosa Virulence. Int. J. Mol. Sci. 2021, 22, 12152. [Google Scholar] [CrossRef]
- Mulcahy, H.; O’Callaghan, J.; O’Grady, E.P.; Maciá, M.D.; Borrell, N.; Gómez, C.; Casey, P.G.; Hill, C.; Adams, C.; Gahan, C.G.M.; et al. Pseudomonas aeruginosa RsmA Plays an Important Role during Murine Infection by Influencing Colonization, Virulence, Persistence, and Pulmonary Inflammation. Infect. Immun. 2008, 76, 632–638. [Google Scholar] [CrossRef]
- Dietrich, L.E.P.; Price-Whelan, A.; Petersen, A.; Whiteley, M.; Newman, D.K. The Phenazine Pyocyanin Is a Terminal Signalling Factor in the Quorum Sensing Network of Pseudomonas aeruginosa. Mol. Microbiol. 2006, 61, 1308–1321. [Google Scholar] [CrossRef]
- Gatzeva-Topalova, P.Z.; May, A.P.; Sousa, M.C. Structure and Mechanism of ArnA: Conformational Change Implies Ordered Dehydrogenase Mechanism in Key Enzyme for Polymyxin Resistance. Structure 2005, 13, 929–942. [Google Scholar] [CrossRef]
- Meliani, A.; Bensoltane, A. Review of Pseudomonas Attachment and Biofilm Formation in Food Industry. Poult. Fish Wildl. Sci. 2015, 3, 1–7. [Google Scholar] [CrossRef]
- Capozzi, V.; Fiocco, D.; Amodio, M.L.; Gallone, A.; Spano, G. Bacterial Stressors in Minimally Processed Food. Int. J. Mol. Sci. 2009, 10, 3076–3105. [Google Scholar] [CrossRef] [PubMed]
- Khayat, M.T.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Shaldam, M.A.; Mohammad, K.A.; Khafagy, E.-S.; El-damasy, D.A.; Hegazy, W.A.H.; Abbas, H.A. Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa. Microorganisms 2022, 10, 1046. [Google Scholar] [CrossRef]
- Khayat, M.T.; Elbaramawi, S.S.; Nazeih, S.I.; Safo, M.K.; Khafagy, E.-S.; Ali, M.A.M.; Abbas, H.A.; Hegazy, W.A.H.; Seleem, N.M. Diminishing the Pathogenesis of the Food-Borne Pathogen Serratia Marcescens by Low Doses of Sodium Citrate. Biology 2023, 12, 504. [Google Scholar] [CrossRef]
- Lin, L.; Hu, J.Y.; Wu, Y.; Chen, M.; Ou, J.; Yan, W.L. Assessment of the Inhibitory Effects of Sodium Nitrite, Nisin, Potassium Sorbate, and Sodium Lactate on Staphylococcus aureus Growth and Staphylococcal Enterotoxin A Production in Cooked Pork Sausage Using a Predictive Growth Model. Food Sci. Hum. Wellness 2018, 7, 83–90. [Google Scholar] [CrossRef]
- Liu, X.; Basu, U.; Miller, P.; McMullen, L.M. Differential Gene Expression and Filamentation of Listeria Monocytogenes 08-5923 Exposed to Sodium Lactate and Sodium Diacetate. Food Microbiol. 2017, 63, 153–158. [Google Scholar] [CrossRef]
- Suo, Y.; Gao, S.; Baranzoni, G.M.; Xie, Y.; Liu, Y. Comparative Transcriptome RNA-Seq Analysis of Listeria Monocytogenes with Sodium Lactate Adaptation. Food Control 2018, 91, 193–201. [Google Scholar] [CrossRef]
- Sobieszczańska, N.; Myszka, K.; Szwengiel, A.; Majcher, M.; Grygier, A.; Wolko, Ł. Tarragon Essential Oil as a Source of Bioactive Compounds with Anti-Quorum Sensing and Anti-Proteolytic Activity against Pseudomonas Spp. Isolated from Fish—In Vitro, in Silico and in Situ Approaches. Int. J. Food Microbiol. 2020, 331, 108732. [Google Scholar] [CrossRef]
- Dalgaard, P. Qualitative and Quantitative Characterization of Spoilage Bacteria from Packed Fish. Int. J. Food Microbiol. 1995, 26, 319–333. [Google Scholar] [CrossRef]
- M07; Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically—Approved Standard—Ninth Edition. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2012; Volume 32, Number 2. ISBN 1-56238-784-7.
- Alcock, B.P.; Raphenya, A.R.; Lau, T.T.Y.; Tsang, K.K.; Bouchard, M.; Edalatmand, A.; Huynh, W.; Nguyen, A.-L.V.; Cheng, A.A.; Liu, S.; et al. CARD 2020: Antibiotic Resistome Surveillance with the Comprehensive Antibiotic Resistance Database. Nucleic Acids Res. 2019, 48, D1, D517–D525. [Google Scholar] [CrossRef]
- Liu, B.; Zheng, D.; Zhou, S.; Chen, L.; Yang, J. VFDB 2022: A General Classification Scheme for Bacterial Virulence Factors. Nucleic Acids Res. 2022, 50, D912–D917. [Google Scholar] [CrossRef]
- Huerta, V.; Mihalik, K.; Crixell, S.; Vattem, D. Herbs, Spices and Medicinal Plants Used In Hispanic Traditional Medicine Can Decrease Quorum Sensing Dependent Virulence in Pseudomonas aeruginosa. Int. J. Appl. Res. Nat. Prod. 2008, 1, 9–15. [Google Scholar]
- Galdino, A.C.M.; Viganor, L.; Ziccardi, M.; Nunes, A.P.F.; Dos Santos, K.R.N.; Branquinha, M.H.; Santos, A.L.S. Heterogeneous Production of Proteases from Brazilian Clinical Isolates of Pseudomonas aeruginosa. Enfermedades Infecc. Microbiol. Clínica 2017, 35, 630–637. [Google Scholar] [CrossRef] [PubMed]
- Marchand, S.; Heylen, K.; Messens, W.; Coudijzer, K.; De Vos, P.; Dewettinck, K.; Herman, L.; De Block, J.; Heyndrickx, M. Seasonal Influence on Heat-Resistant Proteolytic Capacity of Pseudomonas lundensis and Pseudomonas fragi, Predominant Milk Spoilers Isolated from Belgian Raw Milk Samples. Environ. Microbiol. 2009, 11, 467–482. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- R Core Team R: The R Project for Statistical Computing. Available online: https://www.r-project.org/ (accessed on 26 July 2023).
Figure 1.
Impact of alternative NaCl compounds on the P. aeruginosa NT06 virulence phenotype. Values are the average percentage of inhibition of test activity relative to control cultures. Means with the same letter do not differ significantly. “***” indicates significance level of p < 0.001. Medium variants: II—5.0 g/L KCl; III—6.0 g/L KCl; IV—KCl 6.0 g/L + NaL 6.0 g/L; V—KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L.
Figure 1.
Impact of alternative NaCl compounds on the P. aeruginosa NT06 virulence phenotype. Values are the average percentage of inhibition of test activity relative to control cultures. Means with the same letter do not differ significantly. “***” indicates significance level of p < 0.001. Medium variants: II—5.0 g/L KCl; III—6.0 g/L KCl; IV—KCl 6.0 g/L + NaL 6.0 g/L; V—KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L.
Figure 2.
Impact of alternative NaCl compounds on the P. aeruginosa NT06 AMR and VF gene expression levels under in vitro conditions. Values are presented as a fold change in expression in relation to control cultures and normalized to the non-differentially expressed 16S rRNA gene. Error bars indicate standard deviations from three replicates. Medium variants: II—5.0 g/L KCl; III—6.0 g/L KCl; IV—KCl 6.0 g/L + NaL 6.0 g/L; V—KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L.
Figure 2.
Impact of alternative NaCl compounds on the P. aeruginosa NT06 AMR and VF gene expression levels under in vitro conditions. Values are presented as a fold change in expression in relation to control cultures and normalized to the non-differentially expressed 16S rRNA gene. Error bars indicate standard deviations from three replicates. Medium variants: II—5.0 g/L KCl; III—6.0 g/L KCl; IV—KCl 6.0 g/L + NaL 6.0 g/L; V—KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L.
Figure 3.
Impact of alternative NaCl compounds on the P. aeruginosa NT06 AMR and VF gene expression levels under in situ conditions. Values are presented as a fold change in expression in relation to control cultures and normalized to the non-differentially expressed 16S rRNA gene. Error bars indicate standard deviations from three replicates. Medium variants: VII—5.0 g/L KCl; VIII—6.0 g/L KCl; IX—KCl 6.0 g/L + NaL 6.0 g/L; X—KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L.
Figure 3.
Impact of alternative NaCl compounds on the P. aeruginosa NT06 AMR and VF gene expression levels under in situ conditions. Values are presented as a fold change in expression in relation to control cultures and normalized to the non-differentially expressed 16S rRNA gene. Error bars indicate standard deviations from three replicates. Medium variants: VII—5.0 g/L KCl; VIII—6.0 g/L KCl; IX—KCl 6.0 g/L + NaL 6.0 g/L; X—KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L.
Table 1.
Growth characteristics of P. aeruginosa strains.
| Feature | Pseudomonas aeruginosa Strain | ||||||
|---|---|---|---|---|---|---|---|
| NT01 | NT02 | NT03 | NT04 | NT05 | NT06 | ||
| Growth at 4 °C | 48 h | 72 h | 72 h | 72 h | 72 h | 24 h | |
| Antibiotic resistance (zones of inhibition in mm) | TE (30 μg; F = 1.822, p = 0.223) | 12 a | 12 a | 12 a | 10 a | 12 a | 12 a |
| GEN (10 μg, F = 19.16, p = 0.000024) | 21 b | 26 a | 22 b | 18 c | 20 bc | 20 bc | |
| MEM (10 μg; F = 9.908, p = 0.000613) | 20 bc | 23 a | 20 bc | 20 bc | 19 bc | 22 ab | |
| AMP (10 μg) | 0 | 0 | 0 | 0 | 0 | 0 | |
| CRO (30 μg) | 0 | 0 | 0 | 0 | 0 | 0 | |
| NA (30 μg) | 0 | 0 | 0 | 0 | 0 | 0 | |
| CIP (5 μg; F = 80.6, p = 8.25 × 10−9) | 25 bc | 26 b | 20 e | 30 a | 23 de | 24 cd | |
| NOR (10 μg; F = 80.55, p = 8.28 × 10−9) | 26 a | 20 b | 22 b | 25 a | 26 a | 15 c | |
Zones of inhibition are mean values calculated from three replicates. Statistical differences were calculated using one-way ANOVA and a post hoc Tukey’s test. Means with the same letter do not differ significantly.
Table 2.
AMR genes according to the CARD database and the transcriptome abundance in P. aeruginosa NT06.
Table 2.
AMR genes according to the CARD database and the transcriptome abundance in P. aeruginosa NT06.
| Antimicrobial Resistance Gene | Predicted Phenotype | Contig | Position in Contig | % Identity | Gene ARO | TPM Value |
|---|---|---|---|---|---|---|
| OXA-850 | Antibiotic inactivation enzyme | 1_S1_L001_(paired)_contig_1174 | 3524..4312 | 99.61 | 3005138 | - |
| OXA-486 | 1_S1_L001_(paired)_contig_1174 | 3524..4312 | 99.61 | 3003643 | - | |
| fosA | 1_S1_L001_(paired)_contig_1794 | 1354..1761 | 99.75 | 3000149 | - | |
| APH(3’)-IIb | 1_S1_L001_(paired)_contig_84 | 3972..4778 | 98.63 | 3002645 | - | |
| soxR | Antibiotic-resistant gene variant/mutant | 1_S1_L001_(paired)_contig_347 | 45..515 | 99.15 | 3004107 | 8.410823439 |
| mexP | Efflux pump complex or subunit conferring antibiotic resistance | 1_S1_L001_(paired)_contig_1116 | 439..1595 | 99.91 | 3003698 | - |
| opmH | 1_S1_L001_(paired)_contig_1295 | 1..1202 | 100 | 3003682 | - | |
| oprN | 1_S1_L001_(paired)_contig_1828 | 213..1124 | 99.78 | 3000805 | 9.234260698 | |
| opmE | 1_S1_L001_(paired)_contig_1932 | 391..1287 | 99.44 | 3003700 | - | |
| mexJ | 1_S1_L001_(paired)_contig_2174 | 1..689 | 98.40 | 3003692 | - | |
| pmpM | 1_S1_L001_(paired)_contig_2344 | 634..2067 | 99.86 | 3004077 | - | |
| triA | 1_S1_L001_(paired)_contig_2475 | 148..1299 | 99.82 | 3003679 | - | |
| emrE | 1_S1_L001_(paired)_contig_396 | 2109..2389 | 98.93 | 3004038 | - | |
| mexX | 1_S1_L001_(paired)_contig_564 | 1059..1880 | 98.05 | 3003034 | - | |
| yajC | 1_S1_L001_(paired)_contig_580 | 337..675 | 99.70 | 3005040 | - | |
| mexA | 1_S1_L001_(paired)_contig_91 | 206..1357 | 99.82 | 3000377 | 50.25938765 | |
| mexB | 1_S1_L001_(paired)_contig_91 | 1373..4513 | 99.39 | 3000378 | 77.32260128 | |
| oprM | 1_S1_L001_(paired)_contig_91 | 4515..5972 | 99.58 | 3000379 | 106.8020152 | |
| arnA | Gene-altering cell wall charge | 1_S1_L001_(paired)_contig_1042 | 2317..4314 | 98.99 | 3002985 | 15.62721041 |
| rsmA | Protein(s) and two-component regulatory system modulating antibiotic efflux | 1_S1_L001_(paired)_contig_33 | 1050..1235 | 99.46 | 3005069 | 90.10851165 |
| armR | 1_S1_L001_(paired)_contig_34 | 1046..1207 | 100 | 3004056 | 110.9821332 | |
| parS | 1_S1_L001_(paired)_contig_361 | 3186..4443 | 98.96 | 3005067 | 9.234260698 | |
| basS | 1_S1_L001_(paired)_contig_403 | 3425..4858 | 100 | 3003583 | - | |
| mexL | 1_S1_L001_(paired)_contig_693 | 1087..1725 | 99.84 | 3003710 | - |
“-“ indicates not present in the reference-guided transcriptome. The TPM value is a normalized RNA-Seq results and indicates the number of transcripts that came from 1 million RNA molecules.
Table 3.
VF genes according to the VFDB database and the transcriptome abundance in P. aeruginosa NT06.
Table 3.
VF genes according to the VFDB database and the transcriptome abundance in P. aeruginosa NT06.
| Virulence Gene | Virulence Factor (ID) | Contig | Position in Contig | % Identity | TPM Value |
|---|---|---|---|---|---|
| algU | Alginate (VF0091) | 1_S1_L001_(paired)_contig_290 | 1332..1913 | 100 | 419.3972733 |
| mucA | 1_S1_L001_(paired)_contig_290 | 1945..2529 | 99.82 | 308.3769521 | |
| mucB | 1_S1_L001_(paired)_contig_290 | 2538..3488 | 99.89 | 101.2564359 | |
| mucC | 1_S1_L001_(paired)_contig_290 | 3485..3940 | 99.78 | 52.12497157 | |
| algR | 1_S1_L001_(paired)_contig_300 | 4786..5532 | 99.73 | 115.0388622 | |
| algZ | 1_S1_L001_(paired)_contig_300 | 5537..6554 | 99.80 | 35.65093406 | |
| algD | 1_S1_L001_(paired)_contig_3027 | 1..880 | 99.88 | 3.486620172 | |
| algL | 1_S1_L001_(paired)_contig_3318 | 1..676 | 99.70 | 5.520481939 | |
| algQ | 1_S1_L001_(paired)_contig_687 | 214..696 | 99.58 | 72.55490549 | |
| algB | 1_S1_L001_(paired)_contig_871 | 292..1641 | 99.92 | 26.63571197 | |
| algC | Alginate biosynthesis (CVF522) | 1_S1_L001_(paired)_contig_634 | 1481..2872 | 99.85 | 32.61213588 |
| algW | Alginate regulation (CVF523) | 1_S1_L001_(paired)_contig_107 | 2934..4103 | 99.91 | 19.27355951 |
| mucP | 1_S1_L001_(paired)_contig_132 | 9573..10925 | 99.70 | - | |
| mucD | 1_S1_L001_(paired)_contig_290 | 3980..5404 | 99.78 | 88.53225941 | |
| mucE | 1_S1_L001_(paired)_contig_3047 | 1..252 | 99.60 | - | |
| aprA | Alkaline protease (VF0090) | 1_S1_L001_(paired)_contig_1207 | 1..1216 | 99.58 | 10.15768677 |
| motB | Deoxyhexose linking sugar, 209 Da capping structure (AI138) | 1_S1_L001_(paired)_contig_203 | 4505..5548 | 98.94 | 28.89686753 |
| motA | 1_S1_L001_(paired)_contig_203 | 5568..6419 | 98.12 | 15.73726119 | |
| motC | 1_S1_L001_(paired)_contig_216 | 4870..5610 | 99.86 | 21.7958461 | |
| motD | 1_S1_L001_(paired)_contig_216 | 5623..6513 | 100 | 17.44249243 | |
| flgN | 1_S1_L001_(paired)_contig_325 | 4531..5001 | 99.57 | - | |
| flgM | 1_S1_L001_(paired)_contig_325 | 5056..5379 | 100 | 67.71791179 | |
| fliK | 1_S1_L001_(paired)_contig_336 | 149..954 | 100 | - | |
| fliL | 1_S1_L001_(paired)_contig_336 | 1198..1719 | 99.80 | - | |
| fliA | 1_S1_L001_(paired)_contig_632 | 2977..3720 | 99.86 | - | |
| motY | 1_S1_L001_(paired)_contig_67 | 198..1163 | 99.89 | - | |
| fleS | 1_S1_L001_(paired)_contig_88 | 1782..2990 | 99.00 | 17.39157288 | |
| flgF | Flagella (VF0273) | 1_S1_L001_(paired)_contig_1247 | 41..790 | 100 | 8.532456885 |
| flgG | 1_S1_L001_(paired)_contig_1247 | 837..1620 | 99.61 | 9.304751238 | |
| flgH | 1_S1_L001_(paired)_contig_1247 | 1669..2364 | 99.71 | 7.443132546 | |
| flgI | 1_S1_L001_(paired)_contig_1247 | 2376..3485 | 99.45 | 23.88429051 | |
| flgJ | 1_S1_L001_(paired)_contig_1247 | 3496..4698 | 99.58 | 9.119120291 | |
| flhA | 1_S1_L001_(paired)_contig_1444 | 121..1682 | 99.87 | 12.33843308 | |
| fliM | 1_S1_L001_(paired)_contig_336 | 1727..2698 | 99.79 | 22.88614611 | |
| fliN | 1_S1_L001_(paired)_contig_336 | 2726..3199 | 100 | 21.21542173 | |
| fliO | 1_S1_L001_(paired)_contig_336 | 3201..3653 | 98.67 | 18.16275117 | |
| fliP | 1_S1_L001_(paired)_contig_336 | 3650..4417 | 99.47 | 8.332477427 | |
| fliQ | 1_S1_L001_(paired)_contig_336 | 4462..4731 | 100 | 7.900423042 | |
| fliR | 1_S1_L001_(paired)_contig_336 | 4731..5507 | 99.22 | 5.882830175 | |
| flhB | 1_S1_L001_(paired)_contig_336 | 5510..6646 | 99.64 | 7.772372461 | |
| flgE | 1_S1_L001_(paired)_contig_462 | 1..971 | 98.97 | 6.801042976 | |
| flgD | 1_S1_L001_(paired)_contig_462 | 999..1712 | 99.71 | 14.08418754 | |
| fliE | 1_S1_L001_(paired)_contig_618 | 211..540 | 99.69 | 11.08111284 | |
| fliF | 1_S1_L001_(paired)_contig_618 | 563..2359 | 99.55 | 12.039996 | |
| fliG | 1_S1_L001_(paired)_contig_618 | 2365..3381 | 99.80 | 23.37166867 | |
| fliH | 1_S1_L001_(paired)_contig_618 | 3383..4189 | 99.13 | - | |
| fliI | 1_S1_L001_(paired)_contig_618 | 4179..5534 | 99.04 | 14.60729292 | |
| fliJ | 1_S1_L001_(paired)_contig_618 | 5548..5991 | 99.32 | 18.53091505 | |
| flhF | 1_S1_L001_(paired)_contig_632 | 710..1999 | 99.68 | 26.69345593 | |
| fleN | 1_S1_L001_(paired)_contig_632 | 2138..2980 | 99.88 | 21.32752738 | |
| fleQ | 1_S1_L001_(paired)_contig_88 | 197..1669 | 99.11 | 38.27234322 | |
| fleR | 1_S1_L001_(paired)_contig_88 | 2995..3864 | 99.19 | 13.50072292 | |
| tse1 | HSI-1 (SS178) | 1_S1_L001_(paired)_contig_1406 | 164..628 | 99.35 | - |
| tse3 | 1_S1_L001_(paired)_contig_1773 | 1196..2241 | 99.80 | - | |
| tse2 | 1_S1_L001_(paired)_contig_2757 | 1..460 | 98.91 | - | |
| tagQ | 1_S1_L001_(paired)_contig_397 | 766..1680 | 99.67 | - | |
| hsiA1 | HSI-I (VF0334) | 1_S1_L001_(paired)_contig_1341 | 329..1340 | 99.01 | - |
| tagT | 1_S1_L001_(paired)_contig_1644 | 142..861 | 98.47 | - | |
| tagS | 1_S1_L001_(paired)_contig_1644 | 861..2060 | 98.83 | - | |
| tagF/pppB | 1_S1_L001_(paired)_contig_1824 | 155..640 | 98.55 | - | |
| pppA | 1_S1_L001_(paired)_contig_2001 | 1206..1712 | 99.80 | 5.434153415 | |
| hsiH1 | 1_S1_L001_(paired)_contig_354 | 932..1978 | 99.90 | - | |
| clpV1 | 1_S1_L001_(paired)_contig_354 | 1971..3922 | 99.53 | 7.649199338 | |
| hsiE1 | 1_S1_L001_(paired)_contig_652 | 292..1137 | 99.76 | - | |
| hcp1 | 1_S1_L001_(paired)_contig_652 | 1305..1793 | 100 | 58.57807093 | |
| hsiC1/vipB | 1_S1_L001_(paired)_contig_652 | 1869..3365 | 99.79 | - | |
| hsiB1/vipA | 1_S1_L001_(paired)_contig_652 | 3378..3706 | 100 | - | |
| waaF | LPS (VF0085) | 1_S1_L001_(paired)_contig_106 | 1..970 | 99.17 | 16.44018668 |
| waaC | 1_S1_L001_(paired)_contig_106 | 967..2034 | 99.53 | 22.25560584 | |
| waaG | 1_S1_L001_(paired)_contig_106 | 2031..3152 | 99.55 | 11.95021973 | |
| waaP | 1_S1_L001_(paired)_contig_106 | 3149..3955 | 99.38 | 10.57305686 | |
| waaA | 1_S1_L001_(paired)_contig_3715 | 1..1172 | 100 | 8.583960649 | |
| lasA | LasA (VF0088) | 1_S1_L001_(paired)_contig_648 | 1331..2587 | 99.28 | 4.363684053 |
| lasB | LasB (VF0087) | 1_S1_L001_(paired)_contig_29 | 124..1620 | 99.73 | 82.23858626 |
| phzC1 | Phenazines biosynthesis (CVF536) | 1_S1_L001_(paired)_contig_3114 | 24..930 | 99.44 | 0.250189329 |
| pchC | Pyochelin (VF0095) | 1_S1_L001_(paired)_contig_1475 | 1..676 | 99.85 | 6.85240774 |
| pchD | 1_S1_L001_(paired)_contig_1475 | 673..2000 | 99.62 | 7.229010656 | |
| pchA | 1_S1_L001_(paired)_contig_1810 | 134..1564 | 99.51 | 12.56401508 | |
| pchB | 1_S1_L001_(paired)_contig_1810 | 1561..1866 | 99.67 | 1.991703288 | |
| pchG | 1_S1_L001_(paired)_contig_2287 | 1012..2061 | 99.33 | 9.577247524 | |
| fptA | 1_S1_L001_(paired)_contig_2959 | 367..1908 | 99.54 | 5.353565842 | |
| phzS | Pyocyanin (VF0100) | 1_S1_L001_(paired)_contig_4777 | 1..874 | 98.97 | 3.276673151 |
| pvdH | Pyoverdine (IA001) | 1_S1_L001_(paired)_contig_1063 | 148..1557 | 99.57 | 13.83174368 |
| mbtH-like | 1_S1_L001_(paired)_contig_1063 | 1635..1853 | 100 | - | |
| pvcD | 1_S1_L001_(paired)_contig_4738 | 1..435 | 98.16 | 4.232369487 | |
| pvcA | 1_S1_L001_(paired)_contig_4942 | 1..654 | 99.38 | 3.087442787 | |
| lasI | Quorum sensing (VF0093) | 1_S1_L001_(paired)_contig_420 | 22..627 | 100 | 93.02831941 |
| rhlI | 1_S1_L001_(paired)_contig_950 | 202..807 | 98.67 | 13.0742503 | |
| rhlA | Rhamnolipid (VF0089) | 1_S1_L001_(paired)_contig_106 | 4860..5747 | 99.43 | 6.176971683 |
| rhlB | 1_S1_L001_(paired)_contig_106 | 5813..7093 | 98.98 | 6.898663145 | |
| rhlC | Rhamnolipid biosynthesis CVF524) | 1_S1_L001_(paired)_contig_1794 | 380..1357 | 99.69 | 6.543295157 |
| pscB | TTSS (VF0083) | 1_S1_L001_(paired)_contig_1578 | 342..764 | 98.58 | 2.881613268 |
| exsD | 1_S1_L001_(paired)_contig_1578 | 798..1628 | 99.75 | 7.334069869 | |
| pcrG | 1_S1_L001_(paired)_contig_2551 | 216..512 | 99.66 | 2.052057933 | |
| pscG | 1_S1_L001_(paired)_contig_3200 | 376..723 | 100 | 2.626987957 | |
| pscF | 1_S1_L001_(paired)_contig_3200 | 726..983 | 100 | 4.724505474 | |
| pscE | 1_S1_L001_(paired)_contig_3200 | 986..1189 | 99.01 | 1.493777466 | |
| pscK | 1_S1_L001_(paired)_contig_3270 | 1..429 | 99.53 | 4.374123489 | |
| popB | 1_S1_L001_(paired)_contig_491 | 164..1336 | 99.57 | 8.313196332 | |
| popD | 1_S1_L001_(paired)_contig_491 | 1348..2235 | 99.54 | 5.490641496 | |
| exsC | 1_S1_L001_(paired)_contig_743 | 101..538 | 100 | 11.13171153 | |
| exsE | 1_S1_L001_(paired)_contig_743 | 547..792 | 99.59 | - | |
| exsB | 1_S1_L001_(paired)_contig_743 | 801..1214 | 99.75 | 11.77702814 | |
| pcr2 | 1_S1_L001_(paired)_contig_793 | 170..541 | 98.92 | - | |
| pilU | Type IV pili (VF0082) | 1_S1_L001_(paired)_contig_1243 | 1002..2150 | 100 | 15.64761147 |
| pilT | 1_S1_L001_(paired)_contig_1243 | 2328..3362 | 99.90 | 22.96520487 | |
| fimT | 1_S1_L001_(paired)_contig_1412 | 1..435 | 99.31 | 1.792532959 | |
| pilF | 1_S1_L001_(paired)_contig_230 | 6676..7434 | 99.73 | 28.10427169 | |
| pilY2 | 1_S1_L001_(paired)_contig_2608 | 185..532 | 100 | 3.50265061 | |
| pilE | 1_S1_L001_(paired)_contig_2608 | 529..846 | 100 | 12.87594097 | |
| fimV | 1_S1_L001_(paired)_contig_264 | 363..3107 | 98.15 | 32.68125308 | |
| pilM | 1_S1_L001_(paired)_contig_359 | 910..1974 | 99.62 | 48.64244368 | |
| pilN | 1_S1_L001_(paired)_contig_359 | 1974..2570 | 100 | 18.37571476 | |
| pilO | 1_S1_L001_(paired)_contig_359 | 2567..3190 | 99.83 | 20.99906399 | |
| pilP | 1_S1_L001_(paired)_contig_359 | 3187..3711 | 100 | 19.15449505 | |
| fimU | 1_S1_L001_(paired)_contig_4477 | 1..442 | 100 | 4.808372435 | |
| pilG | 1_S1_L001_(paired)_contig_49 | 1880..2287 | 100 | 87.38598175 | |
| pilH | 1_S1_L001_(paired)_contig_49 | 2334..2699 | 100 | 50.78843384 | |
| pilI | 1_S1_L001_(paired)_contig_49 | 2750..3286 | 99.81 | 41.99267156 | |
| pilJ | 1_S1_L001_(paired)_contig_49 | 3371..5419 | 99.95 | 38.66762166 | |
| pilK | 1_S1_L001_(paired)_contig_49 | 5480..6355 | 99.77 | 19.13262919 | |
| xcpA/pilD | 1_S1_L001_(paired)_contig_524 | 1509..2381 | 99.31 | 12.21714903 | |
| pilX | 1_S1_L001_(paired)_contig_539 | 2482..3069 | 99.82 | 6.218991899 | |
| pilW | 1_S1_L001_(paired)_contig_539 | 3066..3565 | 99.4 | 6.648667703 | |
| chpA | 1_S1_L001_(paired)_contig_613 | 28..5322 | 99.79 | 16.14221957 | |
| chpB | 1_S1_L001_(paired)_contig_613 | 5315..6346 | 99.22 | 14.17351642 | |
| chpC | 1_S1_L001_(paired)_contig_613 | 6343..6849 | 98.81 | 10.21779142 | |
| xcpT | xcp secretion system (VF0084) | 1_S1_L001_(paired)_contig_4 | 714..1160 | 99.55 | 14.31620283 |
| xcpU | 1_S1_L001_(paired)_contig_4 | 1167..1685 | 99.80 | 20.55023335 | |
| xcpV | 1_S1_L001_(paired)_contig_4 | 1682..2071 | 99.48 | 10.15768677 | |
| xcpW | 1_S1_L001_(paired)_contig_4 | 2068..2781 | 99.57 | 7.255490549 | |
| xcpX | 1_S1_L001_(paired)_contig_4 | 2778..3779 | 99.60 | 13.68550612 | |
| xcpY | 1_S1_L001_(paired)_contig_4 | 3776..4752 | 99.89 | 20.42145904 | |
| xcpP | 1_S1_L001_(paired)_contig_437 | 9180..9887 | 99.57 | 25.39421692 |
“-“ indicates not present in the reference-guided transcriptome. The TPM value is a normalized RNA-Seq result and indicates the number of transcripts that came from 1 million RNA molecules.
Table 4.
Medium variants used in the study.
| Designation | Medium Composition |
|---|---|
| I (reference mTSB) | mTSB + 5.0 g/L NaCl |
| II | mTSB + 5.0 g/L KCl |
| III | mTSB + 6.0 g/L KCl |
| IV | mTSB + KCl 6.0 g/L + NaL 6.0 g/L |
| V | mTSB + KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L |
| VI (reference FJ) | FJ + 5.0 g/L NaCl |
| VII | FJ + 5.0 g/L KCl |
| VIII | FJ + 6.0 g/L KCl |
| IX | FJ + KCl 6.0 g/L + NaL 6.0 g/L |
| X | FJ + KCl 6.0 g/L + NaL 6.0 g/L + NaC 2.5 g/L |
mTSB—modified TSB medium, where casein-soybean peptone was replaced with fish peptone, FJ—fish juice medium prepared according to Dalagaard [59].
Table 5.
List of genes evaluated in the RT–qPCR experiments.
| Gene Name | Gene Definition, Coding Product and Role | Sequence (5′-3′) Fwd Rev | Tm (°C) | Size (bp) |
|---|---|---|---|---|
| 16S rRNA | The small subunit ribosomal RNA, internal reference gene | GGAGACTGCCGGTGACAAACT TGTAGCCCAGGCCGTAAGG | 56 | 75 |
| mexA | RND multidrug efflux membrane fusion protein MexA precursor | AGCCATGCGTGTACTGGTTC CTCGGTATTCAGGGTCACCG | 60 | 145 |
| mexB | RND multidrug efflux transporter MexB | TGATAGGCCCATTTTCGCGT ATCCCGTTCATCTGCTGCTC | 60 | 198 |
| oprM | Major intrinsic multiple antibiotic resistance efflux outer membrane protein OprM precursor | GGTTCGGGTTCCTGGTTGTT GCAACTGCTCGGTGAAGGTA | 60 | 193 |
| lasB | Metalloproteinase (elastase), pseudolysin precursor | TGAACGACGCGCATTTCTTC CCCGTAGTGCACCTTCATGT | 59 | 104 |
| aprA | Alkaline metalloproteinase precursor | ATTGGTCAATGGCCATCCGT TGAACTTGCCCAGCGAGTAG | 60 | 191 |
| phzS | Probable FAD-dependent monooxygenase, involved in pyocyanin biosynthesis | CTGCAGTACCCGATGGTAGAC TTCTTCGTATTCGCGCAGGG | 60 | 198 |
| algU | Sigma factor AlgU, positive regulation of alginate biosynthesis | CGCGAGTTCGAAGGTTTGAG GCTTCTCGCAACAAAGGCTG | 60 | 131 |
| mucA | Anti-sigma factor MucA, involved in alginate regulation | GTGAAGCCCTGCAGGAAACT GCAGCGATATCCAGCTTCGG | 60 | 181 |
| fliM | Flagellar motor switch protein FliM | CGAGTACGTCAACTCGGAGG TAGGGCATGGTGATGTGCAG | 60 | 129 |
| flgG | Flagellar basal-body rod protein FlgG | CAACCTGGCCAACGTATCCA ACACCGGTACCCAATTGCAG | 60 | 144 |
| fliG | Flagellar motor switch protein FliG | CGAAGGCCAGCTGATGGATT GTACGTCCGAGGAGACTTCC | 60 | 146 |
| pilJ | Twitching motility protein PilJ | ACACCCAGTCGAACCATGAC ACCAGGATGTTCCAGCGTTT | 60 | 169 |
| pilM | Type 4 fimbrial biogenesis protein PilM | TCCTTGAACGGACGCAGAAC CGGACGCACCATCTATACCC | 60 | 162 |
| pilD | Prepilin leader peptidase/N-methyltransferase, role in type IV pili and type II pseudopili formation | CTGATCGCCAACCATTTCGG ACCAGCTTGAACAGCCAGAA | 59 | 107 |
| pscF | Type III export protein PscF, | GCGCAGATATTCAACCCCAAC TGATCTTGTGTTGCAGCTCG | 60 | 169 |
| xcpP | Secretion protein XcpP | CCCTCGGCGATCTTCAGACA GGCGATGATCAGGGCAACAG | 61 | 124 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Tomaś, N.; Myszka, K.; Wolko, Ł. Potassium Chloride, Sodium Lactate and Sodium Citrate Impaired the Antimicrobial Resistance and Virulence of Pseudomonas aeruginosa NT06 Isolated from Fish. Molecules 2023, 28, 6654. https://doi.org/10.3390/molecules28186654
AMA Style
Tomaś N, Myszka K, Wolko Ł. Potassium Chloride, Sodium Lactate and Sodium Citrate Impaired the Antimicrobial Resistance and Virulence of Pseudomonas aeruginosa NT06 Isolated from Fish. Molecules. 2023; 28(18):6654. https://doi.org/10.3390/molecules28186654
Chicago/Turabian StyleTomaś, Natalia, Kamila Myszka, and Łukasz Wolko. 2023. "Potassium Chloride, Sodium Lactate and Sodium Citrate Impaired the Antimicrobial Resistance and Virulence of Pseudomonas aeruginosa NT06 Isolated from Fish" Molecules 28, no. 18: 6654. https://doi.org/10.3390/molecules28186654
