Next Article in Journal
Vibration Analysis of Pulse-Width-Modulated Nozzles in Vineyard Blast Sprayers
Next Article in Special Issue
Foliar Mn and Zn Treatments Improve Apple Tree Nutrition and Help to Maintain Favorable Soil pH
Previous Article in Journal
Effect of Organic Fertilizer on the Growth and Physiological Parameters of a Traditional Medicinal Plant under Salinity Stress Conditions
Previous Article in Special Issue
Growing Degree Day Targets for Fruit Development of Australian Mango Cultivars
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 6
10.3390/horticulturae9060702
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection by Sensitive Real-Time Reverse Transcription Loop-Mediated Isothermal Amplification of Olive Leaf Yellowing Associated Virus and Its Incidence in Italy and Spain

by
Andrea Giovanni Caruso
1,
Sofia Bertacca
1,
Arianna Ragona
1,
Graziella Agrò
1,
Maria Isabel Font-San-Ambrosio
2,
Ana Alfaro-Fernández
2,
Rocío Estévez Sánchez
3,
Stefano Panno
1,* and
Salvatore Davino
1
1
Department of Agricultural, Food and Forest Sciences (SAAF), University of Palermo, Viale delle Scienze, 90128 Palermo, Italy
2
Instituto Agroforestal Mediteráneo, Universitat Politécnica de València (IAM-UPV), Camino de Vera, s/n, 46022 Valencia, Spain
3
Nutesca S.L. C/Ecuador n 2, 23440 Baeza, Spain
*
Author to whom correspondence should be addressed.
Horticulturae 2023, 9(6), 702; https://doi.org/10.3390/horticulturae9060702
Submission received: 26 May 2023 / Revised: 9 June 2023 / Accepted: 12 June 2023 / Published: 15 June 2023
(This article belongs to the Collection Precision Management Systems for Sustainable Orchards and Vineyards)
Browse Figures
Versions Notes

Abstract

:
Olive trees (Olea europea L.) are constantly threatened by many viruses, such as the olive leaf yellowing-associated virus (OLYaV), that belong to the Olivavirus genus, family Closteroviridae. In this work, the OLYaV incidence in different regions of Italy and Spain, which represent the two most important European areas for olive production, was evaluated through the development of a real-time reverse transcription-loop-mediated isothermal amplification (RT-LAMP) for reliable and sensitive OLYaV detection. The specificity and accuracy of the developed real-time RT-LAMP assay were determined; the assay showed that potential cross-reactivity with other viruses belonging to the Closteroviridae family was excluded. The LAMP assay detected OLYaV with a higher sensitivity than conventional end-point RT-PCR, detecting a total of 1.34 × 10−2 genome copies. A total of 80 and 120 plants of different olive cultivars from Spain (Comunitat Valenciana, Andalusia) and Italy (Sicily, Calabria, Apulia, Lazio, and Umbria) regions were tested, respectively. The percentage of infected plants was 46.25% and 30% for Spain and Italy, respectively, while the most susceptible cultivars were “Serrana Espadán” and “Villalonga” from Comunitat Valenciana and Andalusia regions (Spain) and “Ogliarola barese” from Apulia region (Italy). In addition, the survey demonstrated that the real-time RT-LAMP showed good sensitivity for OLYaV-positive sample detection, especially on asymptomatic olive trees. For this reason, the developed assay could be very suitable for phytopathological laboratories as a reliable and efficient method for a rapid and sensitive routine test on olive samples.

1. Introduction

Olea europaea L. (Oleaceae) is the most widespread species of the Olea genus. In the Mediterranean basin, olive cultivation is considered one of the most economically important tree crops, as it has a combination of morphological and developmental characteristics suited to the climate conditions of these geographic areas [1,2]. The olive cultivation covers about 10 million hectares worldwide [3]; the Mediterranean area, in particular Spain, Italy, Greece, and Portugal, produces about 99% of European olive oil. The latest data from the European Commission reported that the European Union (EU) is the leading producer, consumer, and exporter of olive oil [4]. Over the past twenty years, olive cultivation systems have changed mainly with the aim of increasing yield [5,6] and production [7], and improving cultivation practices [8,9]. The human health benefits of olive oil and the increasing demand for olive products [10,11] have led to an increasing interest in olive growing [12]. In fact, many traditional rain-fed olive groves have been converted to irrigation [6], and new orchards have been planted at super-high density (SHD), up to 2500 trees/ha [13]. However, these changes can lead to challenges related to the increasing incidence of olive tree pests and diseases [14]. Olive is susceptible to several diseases caused by fungi, bacteria, phytoplasmas, and viruses. In the last ten years, olive production has suffered a huge decrease due to biotic agents that have considerably undermined the Mediterranean olive tree and oil industry [15]. Furthermore, the vegetative propagation of olive plants using infected, but asymptomatic, material has represented a major means of systemic pathogen dissemination through olive orchards, particularly viruses [16,17,18].
To date, sixteen viruses belonging to eight genera (Nepovirus, Cucumovirus, Tobamovirus, Alphanecrovirus, Oleavirus, Necrovirus, Marafivirus, and Olivavirus) and one unassigned member for each Secoviridae and Geminiviridae families have been identified in olive [16,19,20,21,22]. Most viruses have been detected in Italy, Portugal, Spain, and, more recently, in other countries, such as the United States of America [23]. The infection’s economic impact has not been really determined, although recent studies report that some olive viruses seem to affect the oil yield and quality [23,24,25], even if associated damages with viral infections are reported (e.g., lower yield, reduction of product quality, or market value due to defects in visual attraction) [26]. In particular, it was demonstrated that, depending on the cultivar and virus considered, the parameters that may decrease are as follows: oil yield (≈3.3% decrease), total phenols (≈400 mg/kg decrease), fatty acid composition modification, etc. Despite this, the impact of viruses on cultivated olive trees and production has rarely been studied [23].
In the past, olive leaf yellowing-associated virus (OLYaV) was an unassigned member of the family Closteroviridae [27], but, recently, thanks to the analyses of its full-length genome and its five broadly conserved proteins, it was demonstrated that OLYaV represents a new genus of the Closteroviridae family [28], named Olivavirus [29]. OLYaV has a monopartite positive-sense single-stranded RNA (ssRNA+) of 16,700 nucleotides (nts) that includes 11 open reading frames (ORFs) encoding proteins, some of which have homologies with those of other Closteroviridae members (ORF 1a, ORF 1b, ORF2-thaumatin-like protein, ORF4-HSP70h, ORF5-HSP90h, and ORF6-CP), while others have no homologous counterpart in the GenBank database, such as ORF3-p7, ORF7-p17, ORF8-p10, ORF9-p7, ORF10-p23, and ORF11-p10 [28].
Among olive viruses, OLYaV seems to be one of the most widespread [30]; it has been detected in southern Italy (including Sicily) in a large number of cultivars [31,32,33,34,35] and in high percentages also in Israel [36], the USA [37], Morocco [38], Tunisia [39], and Croatia [40]. Moreover, OLYaV has also been officially reported in Lebanon [41], Syria [42], Egypt [43], Greece [44], Albania [45,46], Palestine [47], Brazil [28], Slovenia [48], and Spain [49]. To date, no symptomatology has been clearly associated with OLYaV infection [49], as this virus has been detected often in symptomless trees [50]. The symptoms consist of foliar discolorations ranging from chlorosis to bright yellowing [50]. In addition, uncommon woody cylinder deformations such as stem pitting and woody gall symptoms were observed in olive trees (cv. Zarzaleña) [28]. It was also demonstrated that total twig length and number, trunk diameter, and leaf area were significantly reduced on olive-infected trees [51]. The OLYaV transmission occurs through the infected plant propagation material [27,52]. The vectors for olivaviruses remain to be identified [53], but it is strongly suspected that the OLYaV vectors are the psyllid Euphyllura olivina (Costa) (Homoptera: Psyllidae) [49] and unidentified mealybugs of the Pseudococcus genus [27].
In detail, the psyllid E. olivina is normally present in abundance during spring, causing up to 60% yield loss, mainly by fumagine formation with the waxy/sugary substance they emit during nymphal development. To date, it is present in Spain, France, the Canary Islands, Greece, South Africa, and the USA (California) [54]. Feeding occurs by penetration and suction of olive shoots, inflorescence, and flowers [55].
As with other plant viruses, OLYaV is reported in many olive cultivars in different areas worldwide [49,56,57], and the implementation of preventive measures and selection of healthy and certified propagation material are appropriate strategies to control olive viruses’ dispersion [16,56]. The identification of OLYaV-free plants based on visual symptoms is not reliable because many infected olive trees remain asymptomatic [16]. For this reason, due to the high presence of latent infections, field selection must therefore be followed by molecular analyses [16,17,58]. In general, plant virus detection is based on immune-enzymatic assays (e.g., ELISA) [59] and molecular methods [60,61]. Currently, the available methods for OLYaV detection are based on conventional reverse transcription-PCR [27,31,49] and SYBR® Green real-time quantitative PCR (RT-qPCR) assay [62]; furthermore, high-throughput sequencing (HTS) has proven to be a robust tool for OLYaV detection [28,49]. These methods are valuable to identify latent infections and early disease stages; however, they require expensive equipment, sophisticated laboratory setup, and highly skilled personnel [63] and are impractical for large-scale use.
An alternative is represented by the loop-mediated isothermal amplification technique (LAMP), which allows the amplification of specific genome traits with high specificity, efficiency, and rapidity under isothermal conditions [64]. LAMP is a technique with different applications, such as multiplex LAMP (mLAMP), digital LAMP (dLAMP), lab-on-a-disc (LoaD), and LAMP and transposon-insertion site detection [65]. LAMP enzymes are less affected by PCR inhibitors; for this reason, LAMP methods are easier and quicker than PCR as, in some cases, difficult DNA/RNA extraction is not required [66,67].
In the present study, the OLYaV incidence was evaluated in different cultivars collected from Spain and Italy, which represent the major olive producers in Europe, through a new real-time reverse transcription LAMP (RT-LAMP) diagnostic protocol. The reasons for the LAMP methodology’s development are based on the attempt to overcome different drawbacks of end-point RT-PCR (high-cost equipment, long times, inhibitor sensitivity, etc.). Conversely, LAMP provides high specificity, enzyme robustness, and inhibitor problem reduction [67]. Moreover, LAMP could represent a valid method for epidemiological studies thanks to its rapidity, reliability, and specificity. To our knowledge, the assay developed in this work is the first real-time RT-LAMP method for OLYaV detection.

2. Materials and Methods

2.1. Real-Time RT-LAMP Assay Development for Fast OLYaV Detection

2.1.1. Source of Viral Material

One characterized lyophilized OLYaV isolate from olive leaves, named V64 (GenBank Acc. No. MW056495) [49], stored in the “Bruno Rosciglione” plant virology laboratory of the University of Palermo (SAAF Department) (Palermo, Italy), was used as source material to develop the real-time RT-LAMP assay.
About 100 mg of olive leaf V64 isolate was previously rehydrated with 1 mL of extraction buffer (1.3 g sodium sulphite anhydrous, 20 g polyvinylpyrrolidone MW 24–40,000, 2 g chicken egg chicken albumin Grade II, and 20 g Tween-20 in one L of distilled water, pH 7.4) and subsequently used for total RNA extraction using the NucleoSpin® RNA Plant Kit (Macherey-Nagel GmbH & Co., Dueren, Germany) following the manufacturer’s instructions, with minor modifications. Briefly, 350 µL of lysis buffer supplied in the kit was added to 350 µL of the extract; the manufacturer’s protocol was followed after this preparation step. The eluted RNA was re-suspended in 60 µL of RNase-free water. The concentration of total RNA was measured in duplicate with a Qubit 3.0 fluorometer (Thermo Fisher Scientific, Waltham, MA, USA), subsequently diluted to ≈50 ng/µL, and stored at −80 °C until molecular analyses.

2.1.2. Primer Design and OLYaV Detection Using Canonical RT-PCR

New primer pairs for OLYaV detection by end-point RT-PCR were specifically designed in this work. In detail, the complete genome sequences available in GenBank (Acc. No. MT809205, MW056495, and OK569886) were aligned using the Clustal X2 program [68] to identify the nucleotide regions that show a high homology percentage at the nucleotide level within the reference isolates. A total of six primer pairs, targeting the nucleotide sequence elapsing region between 5′-UTR and ORF-1a, were designed using the OLYaV MW056495 as a reference sequence. The designed primers were evaluated with the Nucleotide-BLAST algorithm (https://www.ncbi.nlm.nih.gov, accessed on 15 January 2023) to evaluate possible hybridization with other organisms, while the hairpins and secondary structures were verified using the OligoAnalyzer Tool (https://eu.idtdna.com/calc/analyzer, accessed on 15 January 2023). Moreover, the primers were also checked using Vector NTI Advance 11.5 software (Invitrogen, Carlsbad, CA, USA) with the complete genome sequences of other viruses belonging to the Closteroviridae family, including viruses belonging to the Olivavirus genus (Table 1), to evaluate their affinity percentages.
The obtained primer sets were tested by a canonical RT-PCR assay using the OLYaV RNA positive control (PC) (≈50 ng/µL concentration), including a healthy olive plant RNA as a negative control (NC). Each sample was analyzed in triplicate in three independent, two-step end-point RT-PCR assays. In detail, the reverse transcription (RT) was carried out in a 20 µL final volume with 1 µL of total RNA, 0.4 mM dNTPs, 4 µL of 5X First Strand Buffer [50 mM Tris-HCl pH 8.3, 40 mM KCl, 6 mM MgCl2] (Thermo Fisher Scientific, Waltham, MA, USA), 1 µM of reverse primer, 20 U of M-MLV reverse transcriptase (Thermo Fisher Scientific, Waltham, MA, USA), and RNase-free water to reach the final volume. After an initial denaturation at 65 °C for 10 min, RT was performed at 42 °C for 45 min and 95 °C for 10 min. PCR was performed in a final reaction volume of 25 μL, containing 2 μL of the obtained cDNA, 20 mM Tris–HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2, 0.4 mM dNTPs, 1 µM of each primer, 2 U of Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA), and RNase-free water to reach the final volume (Table S1), according to the following cycling conditions: 95 °C for 3 min; 40 cycles of 30 s at 95 °C, 30 s at the specific annealing temperature of each primer pair, 45 s at 72 °C, and a final elongation of 10 min at 72 °C (Table S1). RT-PCR was carried out in a PCR System 2720 thermocycler (Applied Biosystems, Foster City, CA, USA). RT-PCR products were verified by electrophoresis in a 1.5% agarose gel stained with SybrSafeTM (Thermo Fisher Scientific, Waltham, MA, USA) and visualized by UV light. The primer pair that revealed the highest specificity and the absence of any non-specific products was chosen and used for subsequent tests. The obtained PCR product was cloned into the pGEM-T vector (Promega, Madison, WI, USA) and cloned into Escherichia coli One Shot™ Mach1™ competent cells (Invitrogen, Carlsbad, CA, USA). After ampicillin resistance selection of the transformants, the fragment presence was verified by colony-PCR with the specific primer pair previously used. The plasmid DNA was purified using the NucleoSpin Plasmid DNA Purification Kit (Macherey-Nagel GmbH & Co., Dueren, Germany), quantified twice using a Qubit 3.0 fluorometer (Thermo Fisher Scientific, Waltham, MA, USA), and sequenced in both directions using an ABI PRISM 3100 DNA sequence analyzer (Applied Biosystems, Foster City, CA, USA). Finally, the sequence obtained was verified by the BLAST algorithm at the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi, accessed on 30 January 2023).

2.1.3. OLYaV Real-Time RT-LAMP Primer Design

A 429 bp nucleotide sequence elapsing from the 5′-UTR to the ORF1a genes of the OLYaV V64 isolate (GenBank Acc. No. MW056495) used as a reference sequence was chosen to design a specific LAMP primer set. In detail, a set of six primers was designed using the PrimerExplorer version 5 software (https://primerexplorer.jp/e/, accessed on 5 February 2023), including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Primer set specificity was evaluated in silico using the nucleotide BLAST algorithm (https://www.ncbi.nlm.nih.gov, accessed on 5 February 2023) available at the NCBI website to evaluate possible cross-reactions with other organisms. In addition, each primer was tested against the full genomic sequences of other viruses listed in Table 1 to verify their affinity using the Vector NTI Advance 11.5 software (Invitrogen, Carlsbad, CA, USA).

2.1.4. OLYaV Real-Time RT-LAMP Assay Optimization

The OLYaV V64 isolate RNA was used as a template for the real-time RT-LAMP assay optimization, including healthy olive plant RNA (NC) as a negative control. The real-time RT-LAMP assay was performed in a volume of 25 μL, containing 0.2 μM each of OLYaV-F3 and OLYaV-B3, 1.6 μM each of OLYaV-FIP and OLYaV-BIP, and 0.4 μM each of OLYaV-LoopF and OLYaV-LoopB, 15 μL of LAMP Isothermal Master Mix (Optigene® Limited, West Sussex, UK), 1 μL of RNA (≈50 ng/µL), and nuclease-free water to reach the final volume (Table S1). Each sample was analyzed in triplicate in three independent real-time LAMP assays, performed at 65 °C for 60 min (fluorescence acquisition every 60 s), using a Rotor-Gene Q2plex HRM Platform Thermal Cycler (Qiagen, Hilden, Germany). Additional steps for the melting curve were carried out to acquire the fluorescence using the following protocol: 95 °C for 1 min, 40 °C for 1 min, 70 °C for 1 min, and an increase in temperature at 0.5 °C/s up to 95 °C (Table S1). The fluorescence data were obtained in the 6-carboxyfluorescein (FAM) channel (450–495 nm excitation and 510–527 nm detection). The relative fluorescence units (RFU) threshold value was used, and the threshold time (Tt) was calculated as the time at which fluorescence was equal to the threshold value.

2.1.5. Sensitivity and Comparison of OLYaV Real-Time RT-LAMP Assay to Conventional RT-PCR

The plasmids obtained were used to determine the OLYaV real-time RT-LAMP sensitivity and to compare the results with an end-point RT-PCR assay. Ten-fold serial dilutions of the purified recombinant plasmid DNA diluted into healthy olive RNA extract were used as templates for both real-time RT-LAMP and end-point RT-PCR assays. The number of copies was determined as follows:
N o .   o f   c o p i e s = D N A   a m o u n t n g × 6.022 × 10 23 D N A   t e m p l a t e   l e n g h t [ b p ] × 1 × 10 9 × 650
Additional steps for the melting curve were carried out, as described above (see Section 2.1.4). Each sample was analyzed in triplicate in three independent assays. The results obtained were compared, and the optimal reaction time of the real-time RT-LAMP was determined.

2.1.6. Specificity of OLYaV Real-Time RT-LAMP Assay

To verify the real-time RT-LAMP assay specificity and evaluate non-specific reactions with other viruses belonging to the Closteroviridae family, a real-time RT-LAMP assay was conducted using the OLYaV V64 isolate as a positive control and the RNAs of other viruses stored in the “Bruno Rosciglione” virology laboratory. In particular, the following viruses were tested: Citrus tristeza virus (CTV), grapevine leafroll-associated virus 1 (GLRaV-1), grapevine leafroll-associated virus 2 (GLRaV-2), grapevine leafroll-associated virus 3 (GLRaV-3), tomato chlorosis virus (ToCV), tomato infectious chlorosis virus (TICV), and cucurbit yellow stunting disorder virus (CYSDV). In each run, total RNA from a healthy olive plant (NC) was included, and each sample was analyzed in triplicate in three independent LAMP assays. The experiment was performed with the conditions described above (see Section 2.1.4), reducing the reaction time to 45 min, including the melting curve steps.

2.2. Evaluation of OLYaV Incidence in Italy and Spain by Real Time RT-LAMP Assay on Symptomatic and Asymptomatic Olive Trees

To understand the effective OLYaV incidence in Italy and Spain, several samplings were carried out in the main Italian and Spanish olive-growing regions, and each sample was analyzed by the real-time RT-LAMP assay developed in this work.
The analyses were performed on 61 symptomatic and 139 asymptomatic field samples, for a total of 200 samples of different cultivars collected during spring 2022. In detail, 80 samples were collected in Spain, of which 40 were in the Valencia region (20 in the Valencia province and 20 in the Castellón province) and 40 were in the Andalusia region (20 in the Granada province and 20 in the Jaén province) (Figure 1). Regarding Italy, a total of 120 samples were collected, of which 40 were collected in Sicily (20 in the Agrigento province and 20 in the Trapani province), 20 in the Calabria region (Crotone province), 20 in the Apulia region (Trapani province), 20 in the Lazio region (Frosinone province), and 20 in the Umbria region (Terni province) (Figure 1). Table 2 reports the different olive cultivars collected.
The Planthology mobile application was used to geo-reference all samples collected [69]; subsequently, the samples were stored at 4 °C and analyzed. Sampling was carried out, collecting eight branches per plant from symptomatic and asymptomatic olive trees. The hierarchical sampling scheme, with minor modifications to olive plants, was applied to collect the samples [70]. Total RNA was extracted, and the concentration was determined as described above. Subsequently, real-time RT-LAMP for easy detection of OLYaV was carried out. Each test included a positive control (PC) and RNA from a healthy olive plant as a negative control (NC). Each sample was analyzed in triplicate in three independent real-time RT-LAMP assays.

3. Results

3.1. Real-Time RT-LAMP Assay Development for Fast OLYaV Detection

3.1.1. Primer Design and OLYaV Detection Using Canonical RT-PCR

In Table 3, the six end-point RT-PCR primer pairs designed are reported. The in silico analysis results showed that no relevant matches with other organisms were identified.
All the obtained primer pairs were verified by end-point RT-PCR. Between the six primer pairs, OLYaV-30F/OLYaV-527R and OLYaV-46F/OLYaV-371R did not give the expected amplicon (), while the remaining primer pairs gave the expected amplicon (Table 3), but with non-specific bands, except for OLYaV-21F/OLYaV-471R, which showed the higher specificity without non-specific bands. Therefore, this primer pair was chosen as the best candidate for OLYaV detection by end-point RT-PCR. A 450 bp amplicon size was obtained, as expected PCR product, and the sequence showed a percentage identity of >99.9% with the previously uploaded OLYaV sequences in GenBank, indicating that the assay was specific for OLYaV detection. The analysis using the Vector NTI 11.5 program against other viruses (see Section 2.1.2) has not demonstrated relevant matches.

3.1.2. OLYaV Real-Time RT-LAMP Primer Design

A set of six primers for OLYaV detection by a real-time RT-LAMP assay was designed between the 5′-UTR and ORF-1a coding regions, within the OLYaV-21F/OLYaV-471R amplified region. Table 4 and Figure 2 report the primer sequences and binding sites, respectively. Both the in silico analysis of LAMP primers and the hybridization analysis against other viruses showed no cross-reactions with other organisms and excluded relevant matches with other viruses, respectively.

3.1.3. OLYaV Real-Time RT-LAMP Assay Optimization

As reported in Table 5 and Figure 3A, the amplification curve of the OLYaV V64 isolate showed an exponential trend at 14 min, reaching the reaction plateau in about 24 min, while the melting curve displayed a peak temperature of approximately 90 °C (Figure 3B). No signal was obtained with the negative control (NC).

3.1.4. Sensitivity and Comparison of OLYaV Real-Time RT-LAMP Assay to Conventional End-Point RT-PCR

To ascertain the sensitivity and efficacy of the real-time RT-LAMP assay, a comparative experiment was conducted using as a template ten-fold serial dilutions of a purified recombinant plasmid, starting from a concentration of ≈50 ng/µL (1.34 × 1010 copies). The results obtained in the three replicates for each test returned completely overlapping results.
The end-point RT-PCR was able to detect up to ≈50 × 10−11 ng/µL (Figure 4), while DNA concentrations up to ≈50 × 10−12 ng/µL were detected with the real-time LAMP assay developed in this work (Figure 5A). In detail, the LAMP assay was more sensitive and able to detect a total of 1.34 × 10−2 genome copies, whereas with the canonical RT-PCR, it was only possible to detect up to 1.34 × 10−1 genome copies. Moreover, even considering the lowest detectable concentration in real-time RT-LAMP (≈50 × 10−12 ng/µL), the results clearly showed that the time required to obtain reliable results was less than 45 min. The melting curves displayed the same peak temperature at 90 °C (Figure 5B), and the results of the RT-LAMP reaction time plateau were calculated as the mean values obtained from the three replicates (Table 6).

3.1.5. Specificity of OLYaV Real-Time LAMP Assay

To evaluate the LAMP assay specificity and to assess non-specific cross-reactions, a real-time RT-LAMP assay, using the outgroup reported in Section 2.1.6, was performed. A reaction time value of 15 min (Figure 6A) and a single peak at ≈90 °C of the melting curve (Figure 6B) were obtained with the OLYaV V64 isolate RNA, while no amplification was obtained with the other viruses used as outgroups.

3.2. Evaluation of OLYaV Incidence in Italy and Spain by Real Time RT-LAMP Assay on Symptomatic and Asymptomatic Olive Trees

To evaluate the OLYaV incidence in Italy and Spain and to confirm the validity of the real-time RT-LAMP assay developed, the analyses were performed on 61 symptomatic (Figure 7 and Figure 8A) and 139 asymptomatic (Figure 8B) field samples, for a total of 200 samples, collected from different olive production sites in Italy and Spain.
Seventy-three out of two hundred collected samples resulted positive for OLYaV by real-time RT-LAMP (Tables S2 and S3), with an incidence percentage of samples that resulted positive of 36.5%. Moreover, the obtained results showed an improvement in OLYaV-positive sample detection in asymptomatic samples. In Italy, out of 120 samples collected from the 6 different provinces investigated, 36 samples resulted positive for LAMP, with an infection percentage of 30%. In this case, the developed RT-LAMP assay was also able to detect the OLYaV presence in 7 olive asymptomatic plants (Figure 8B). Considering the cultivars analyzed, a different OLYaV incidence was observed. The higher OLYaV incidence was observed in the “Ogliarola barese” cv collected from the Apulia region, with a total of 11 out of 20 samples analyzed, followed by “Giarraffa” (Sicily) and “Carolea” cvs (Calabria), with a total of 8 and 7 samples resulted positive, respectively. A lower incidence was observed in “Nocellara del Belice” (Sicily), “Frantoio” (Umbria), and “Leccino” (Lazio) cvs, with a total of 5, 3, and 2 positive samples, respectively. Regarding the OLYaV incidence in Spain, 37 out of 80 samples resulted positive, with an infection percentage of 46.2%; in this case, 5 positive samples collected from asymptomatic plants resulted positive for OLYaV infection. The highest incidence was observed in Valencia (13 out of 20 samples) and Jaén provinces (11 out of 20 samples). Specifically, the following results were obtained for Spanish cultivars: 12 out of 20 samples of the “Serrana Espadán” and “Villalonga” cultivars, respectively, resulted positive for OLYaV, while a lower incidence was revealed in the “Picual” and “Arbequina” cultivars (8 and 5 positive samples out of 20, respectively).
Finally, to confirm the RT-LAMP assay results, the melting curve analysis, carried out on asymptomatic samples too, showed the same peak temperature (≈90 °C) in all samples, concordant with the OLYaV-positive control, including those that were asymptomatic and positive by real-time RT-LAMP.

4. Discussion

Olive trees are prone to several pathogens that can compromise product yield and quality, such as fungi, bacteria, and viruses [15]. Concerning viral diseases, infected plants generally exhibit morphological/physiological alterations, which usually result in lower production performance [71]. Viral symptoms on olive trees mainly consist of leaf yellowing, irregular fruit, streaking, and vein clearing [16,72]. However, some viruses can lead to symptoms only in some olive cultivars while remaining latent in others [16], as in the case of OLYaV; for this reason, viral diagnosis in the field and propagation material selection are impossible to perform without laboratory analyses [73]. Since there is no known source of genetic resistance to olive viruses, a key component of viral disease management is the use of virus-free plant materials; for this reason, the legislation currently in force for the exchange of olive trees or propagation material (Regulation (EU) 2016/2031) [74] requires the absence of several olive tree viruses, including OLYaV. The certification program’s adoption demands the use of extremely sensitive diagnostic techniques for viral detection, which are the basis for obtaining virus-free olive plants, as reported in the certification scheme for olive trees and rootstocks (PM 4/17-3) by EPPO. The low viral titer in olive tissues and the presence of different inhibitors during the acid nucleic extraction, such as acidic polysaccharides, a variety of salts, secondary metabolites, and phytochelatins [75], are the major constraints of the diagnosis methods and do not always allow for successful, accurate, and reproducible detection [57]. Thus, sensitive, precise, and cost-effective detection assays for olive viruses are critical and of major importance to guarantee the sustainable production of the orchards. In this study, a real-time LAMP protocol was developed in order to overcome some of the limitations of the RT-PCR-based assays, e.g., reduced sensitivity to inhibitors [17,67], such as phenols and polysaccharides [76]. For OLYaV detection by real-time LAMP, a set of six specific primers, capable of recognizing a total of eight different regions targeting the ORF1a coding region, was designed. The technique developed has demonstrated a 10-fold higher sensitivity compared to the canonical RT-PCR; in addition, even considering the lowest detectable concentration of 50 × 10−12 ng/µL, the time required to carry out the experiment was less than 45 min, compared with the time required for the conventional RT-PCR assay, which requires several hours to obtain the results due to the extended duration of the RT-PCR reaction protocol and results visualization by electrophoresis. The LAMP assay provides considerable sensitivity for OLYaV detection; similar results were previously reported by other researchers for various plant viruses [77,78,79,80]. Moreover, OLYaV was detected in olive orchards independently of the cultivar, crop management, or geographical location (Italy or Spain), probably due to a gene flow that occurred in the past between these two countries, which led to a wide spread of this pathogen over time and a distributed presence in cultivars across the countries. In this sense, OLYaV may represent an issue that should not be underestimated, both in terms of phytosanitary certification of propagation material and for new plantings, particularly new intensive and super-intensive olive orchards. For this reason, it is essential to monitor the commercial cultivars to date most widespread in Italy and Spain, including molecular diagnostic methodologies as reliable and sensitive as possible. The robustness and sensitivity of the methodology, suitable to be adopted under conditions of low symptom presence or low viral titer, could be a useful tool to be introduced in this context. Moreover, the incidence analysis showed that the developed assay was capable of detecting OLYaV in 12 asymptomatic olive plants from Spain and Italy, in 5 and 7 asymptomatic plants, respectively. OLYaV incidence was higher in the Spanish territory than in the Italian territory, out of a total of 80 and 120 samples analyzed, respectively. Probably, the higher OLYaV incidence in Spain could be due to the presence of the insect vector (E. olivina). Moreover, OLYaV appears to be more prevalent in the southern regions of Spain that are more involved in olive cultivation compared with the Italian regions.

5. Conclusions

To the best of our knowledge, this work represents the first OLYaV incidence study in the two most important European areas for olive production and reports for the first time the development of a LAMP methodology for the specific OLYaV detection that can be accomplished in 45 min. The real-time RT-LAMP methodology enabled substantial precision, sensitivity, and reproducibility for the OLYaV detection in infected olive trees. The real-time RT-LAMP developed is an alternative to the methods currently used for routine OLYaV detection and plant material certification programs, thus representing a potential contribution to improving virus diagnosis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae9060702/s1, Table S1: Reaction mixtures, volumes, and protocols used for reverse transcription (RT), PCR, and RT-LAMP assays Table S2: Real-time RT-LAMP assay results for OLYaV detection of symptomatic and asymptomatic field samples collected from different Spanish provinces. Asymptomatic samples resulted positive are underlined in gray; Table S3: Real-time RT-LAMP assay results for OLYaV detection of symptomatic and asymptomatic field samples collected from different Italian provinces. Asymptomatic samples resulted positive are underlined in gray.

Author Contributions

Conceptualization, A.G.C., S.P. and S.D.; methodology, A.G.C., S.B., A.R., G.A., S.P. and S.D.; validation, A.G.C., S.B., A.R., G.A., M.I.F.-S.-A., A.A.-F., R.E.S., S.P. and S.D.; formal analysis, A.G.C., S.B., A.R. and G.A.; investigation, A.G.C., S.B., A.R., S.P. and S.D.; resources, S.P. and S.D.; data curation, A.G.C., S.B., S.P. and S.D.; writing—original draft preparation, A.G.C., S.B., A.R., G.A., M.I.F.-S.-A., S.P. and S.D.; writing—review and editing, A.G.C., S.B., A.R., G.A., M.I.F.-S.-A., A.A.-F., R.E.S., S.P. and S.D.; supervision, A.G.C., S.P. and S.D.; funding acquisition, S.P. and S.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by “MUR (Ministero dell’Università e della Ricerca), PNRR-M4C2, ECS_00000022”, and “2014–2020 FESR-PROGETTO SCORELINE-Uso efficiente dei sottoprodotti nelle imprese oli-vinicole-CUP B79J23000020005”.

Data Availability Statement

Not applicable.

Acknowledgments

The authors thank the “SiciliAn MicronanOTecH Research and Innovation CEnter SAMOTHRACE (MUR, PNRR-M4C2, ECS_00000022), spoke 3–University of Palermo S2-COMMs-Micro and Nanotechnologies for Smart and Sustainable Communities” and the “Programma Operativo Nazionale “Imprese e competitività” 2014–2020 FESR-PROGETTO SCORELINE-Uso efficiente dei sottoprodotti nelle imprese oli-vinicole-CUP B79J23000020005”.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rapoport, H.F.; Fabbri, A.; Sebastiani, L. Olive biology. In The Olive Tree Genome; Springer: Cham, Switzerland, 2016; pp. 13–25. [Google Scholar] [CrossRef]
  2. Fraga, H.; Moriondo, M.; Leolini, L.; Santos, J.A. Mediterranean olive orchards under climate change: A review of future impacts and adaptation strategies. Agronomy 2020, 11, 56. [Google Scholar] [CrossRef]
  3. FAO (Food and Agriculture Organization). Available online: http://www.fao.org/faostat/en (accessed on 1 February 2023).
  4. European Commission. Available online: https://commission.europa.eu (accessed on 1 February 2023).
  5. Lodolini, E.M.; Polverigiani, S.; Ali, S.; Mutawea, M.; Qutub, M.; Pierini, F.; Neri, D. Effect of complementary irrigation on yield components and alternate bearing of a traditional olive orchard in semi-arid conditions. Spanish J. Agric. Res. 2016, 14, 1203. [Google Scholar] [CrossRef] [Green Version]
  6. Marra, F.P.; Marino, G.; Marchese, A.; Caruso, T. Effects of different irrigation regimes on a super-high-density olive grove cv. “Arbequina”: Vegetative growth, productivity and polyphenol content of the oil. Irrig. Sci. 2016, 34, 313–325. [Google Scholar] [CrossRef]
  7. Beyá-Marshall, V.; Herrera, J.; Fichet, T.; Trentacoste, E.R.; Kremer, C. The effect of water status on productive and flowering variables in young ‘Arbequina’olive trees under limited irrigation water availability in a semiarid region of Chile. Hortic. Environ. Biotechnol. 2018, 59, 815–826. [Google Scholar] [CrossRef]
  8. Rallo, L.; Barranco, D.; Castro-García, S.; Connor, D.J.; Gómez del Campo, M.; Rallo, P. High-density olive plantations. Hortic. Rev. 2013, 41, 303–384. [Google Scholar] [CrossRef]
  9. Connor, D.J.; Gómez-del-Campo, M.; Rousseaux, M.C.; Searles, P.S. Structure, management and productivity of hedgerow olive orchards: A review. Sci. Hortic. 2014, 169, 71–93. [Google Scholar] [CrossRef]
  10. Visioli, F.; Poli, A.; Gall, C. Antioxidant and other biological activities of phenols from olives and olive oil. Med. Res. Rev. 2001, 22, 65–75. [Google Scholar] [CrossRef]
  11. Kiritsakis, A. Olive Oil, Table Olive, Olive Paste; Printing Akritidi Sindos: Thessaloniki, Greece, 2007. [Google Scholar]
  12. Kiritsakis, A.; Shahidi, F. Olives and Olive Oil as Functional Foods: Bioactivity, Chemistry and Processing; John Wiley & Sons: Oxford, UK, 2017. [Google Scholar]
  13. Tous, J.; Romero, A.; Hermoso, J.F. New trends in olive orchard design for continuous mechanical harvesting. Adv. Hortic. Sci. 2010, 24, 43–52. Available online: http://digital.casalini.it/10.1400/132342 (accessed on 1 February 2023).
  14. Montes-Osuna, N.; Mercado-Blanco, J. Verticillium wilt of olive and its control: What did we learn during the last decade? Plants 2020, 9, 735. [Google Scholar] [CrossRef]
  15. Saponari, M.; Boscia, D.; Nigro, F.; Martelli, G.P. Identification of DNA sequences related to Xylella fastidiosa in oleander, almond and olive trees exhibiting leaf scorch symptoms in Apulia (Southern Italy). J. Plant Pathol. 2013, 95, 668. [Google Scholar] [CrossRef]
  16. Martelli, G.P. Infectious diseases and certification of olive: An overview. EPPO Bull. 1999, 29, 127–133. [Google Scholar] [CrossRef]
  17. Bertacca, S.; Caruso, A.G.; Trippa, D.; Marchese, A.; Giovino, A.; Matic, S.; Noris, E.; Font San Ambrosio, M.I.; Alfaro, A.; Panno, S.; et al. Development of a Real-Time Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Olea Europaea Geminivirus. Plants 2022, 11, 660. [Google Scholar] [CrossRef]
  18. Alabi, O.J.; Diaz-Lara, A.; Erickson, T.M.; Al Rwahnih, M. Olea europaea geminivirus is present in a germplasm repository and in California and Texas olive (Olea europaea L.) groves. Arch. Virol. 2021, 166, 3399–3404. [Google Scholar] [CrossRef]
  19. Felix, M.R.F.; Clara, M.I.E. Two Necrovirus isolates with properties of Olive latent virus 1 and of Tobacco necrosis virus from olive in Portugal. In IV International Symposium on Olive Growing; Vitagliano, C., Martelli, G.P., Eds.; ISHS Acta Horticulturae: Valenzano, Italy, 2000; pp. 725–728. [Google Scholar] [CrossRef]
  20. Al Abdullah, A.; Minafra, A.; Elbeaino, T.; Saponari, M.; De Stradis, A.; Savino, V.; Martelli, G.P. Complete nucleotide sequence of Olive latent virus 3, representing a new genome structure in the genus Marafivirus. Virus Res. 2010, 152, 10–17. [Google Scholar] [CrossRef]
  21. Loconsole, G.; Saponari, M.; Faggioli, F.; Albanese, G.; Bouyahia, H.; Elbeaino, T.; Materazzi, A.; Nuzzaci, M.; Prota, V.; Romanazzi, G.; et al. Inter-laboratory validation of PCR-based protocol for detection of olive viruses. EPPO Bull. 2010, 40, 423–428. [Google Scholar] [CrossRef]
  22. Chiumenti, M.; Greco, C.; De Stradis, A.; Loconsole, G.; Cavalieri, V.; Altamura, G.; Zicca, S.; Saldarelli, P.; Saponari, M. Olea Europaea Geminivirus: A Novel Bipartite Geminivirid Infecting Olive Trees. Viruses 2021, 13, 481. [Google Scholar] [CrossRef]
  23. Fontana, A.; Piscopo, A.; De Bruno, A.; Tiberini, A.; Muzzalupo, I.; Albanese, G. Impact of olive leaf yellowing associated virus on olive (Olea europaea L.) oil. Eur. J. Lipid Sci. Technol. 2019, 121, 1800472. [Google Scholar] [CrossRef]
  24. Godena, S.; Bendini, A.; Giambanelli, E.; Cerretani, L.; Ðermić, D.; Ðermić, E. Cherry leafroll virus: Impact on olive fruit and virgin olive oil quality. Eur. J. Lipid Sci. Technol. 2012, 114, 535–541. [Google Scholar] [CrossRef]
  25. Erilmez, S.; Erkan, S. The Investigation about the effects of Strawberry latent ring spot virus on certain fruit quality characteristics of olive tree. J. Turk. Phytopathol. 2014, 43, 7–13. [Google Scholar]
  26. Hull, R. Comparative Plant Virology; Elsevier Academic Press: London, UK, 2009. [Google Scholar]
  27. Sabanadzovic, S.; Abou-Ghanem, N.; La Notte, P.; Savino, V.; Scarito, G.; Martelli, G.P. Partial molecular characterization and RT-PCR detection of a putative closterovirus associated with olive leaf yellowing. J. Plant Pathol. 1999, 81, 37–45. Available online: https://www.jstor.org/stable/41997939 (accessed on 1 February 2023).
  28. Ruiz-García, A.B.; Candresse, T.; Canales, C.; Morán, F.; Machado De Oliveira, C.; Bertolini, E.; Olmos, A. Molecular Characterization of the Complete Coding Sequence of Olive Leaf Yellowing-Associated Virus. Plants 2020, 9, 1272. [Google Scholar] [CrossRef]
  29. International Committee on Taxonomy of Viruses (ICTV). Available online: https://talk.ictvonline.org (accessed on 1 February 2023).
  30. Çağlayan, K.; Faggioli, F.; Barba, M. Viruses, phytoplasmas, and diseases of unknown etiology of olive trees. In Virus and Virus-Like Diseases of Pome and Stone Fruits; APS Publications: St. Paul, MN, USA, 2011; pp. 289–297. [Google Scholar] [CrossRef]
  31. Faggioli, F.; Ferretti, L.; Albanese, G.; Sciarroni, R.; Pasquini, G.; Lumia, V.; Barba, M. Distribution of olive tree viruses in Italy as revealed by one-step RT-PCR. J. Plant Pathol. 2005, 87, 45–51. [Google Scholar]
  32. Faggioli, F.; Roschetti, A.; Luigi, M.; Leo, G.; Albanese, G. Sanitary Selection of Olive (Olea europaea L.) Cultivars for Worldwide Distribution. Asian J. Plant Pathol. 2017, 11, 28–34. [Google Scholar] [CrossRef] [Green Version]
  33. Savino, V.; Sabanadzovic, S.; Scarito, G.; Laviola, C.; Martelli, G.P. Two olive yellows of possible viral origin in Sicily. Inf. Fitopatol. 1996, 46, 55–59. [Google Scholar]
  34. Saponari, M.; Alkowni, R.; Grieco, F.; Driouech, N.; Hassan, M.; Di Terlizzi, B.; Digiaro, M.; Pantaleo, V.; Savino, V.; Martelli, G.P. Detection of Olive-infecting virus in the Mediterranean basin. Acta Hortic. 2002, 586, 787–790. [Google Scholar] [CrossRef]
  35. Albanese, G.; Faggioli, F.; Ferretti, L.; Sciarroni, R.; La Rosa, R.; Barba, M. Sanitary status evaluation of olive cultivars in Calabria and Sicily. J. Plant Pathol. 2003, 85, 304. [Google Scholar]
  36. Martelli, G.P. Infectious diseases of olive. In Olive Diseases and Disorders; Schena, L., Agosteo, G.E., Cacciola, S.O., Eds.; Transworld Research Network: Kerala, India, 2011; pp. 71–88. [Google Scholar]
  37. Rowhani, A.; Al Rwahnih, M.; Golino, D.; Daubert, S.; Guo, Y. Characterization of latent viral infection of olive trees in the national clonal germplasm repository in California. J. Plant Pathol. 2011, 93, 227–231. [Google Scholar] [CrossRef]
  38. Afechtal, M.; Mounir, M. Preliminary evaluation of the status of olive-infecting viruses in Morocco. Moroc. J. Agric. Sci. 2020, 1, 1. [Google Scholar]
  39. El Air, M.; Mahfoudi, N.; Digiaro, M.; Najjar, A.; Elbeaino, T. Detection of olive-infecting viruses in Tunisia. J. Phytopathol. 2011, 159, 283–286. [Google Scholar] [CrossRef]
  40. Bjeliš, M.; Loconsole, G.; Saponari, M. Presence of viruses in Croatian olive groves. Pomol. Croat. 2007, 13, 165–172. [Google Scholar] [CrossRef]
  41. Fadel, C.; Digiaro, M.; Choueiri, E.; Elbeaino, T.; Saponari, M.; Savino, V.; Martelli, G.P. On the presence and distribution of olive viruses in Lebanon. EPPO Bull. 2005, 35, 33–36. [Google Scholar] [CrossRef]
  42. Al Abdullah, A.; Elbeaino, T.; Saponari, M.; Hallak, H.; Digiaro, M. Preliminary evaluation of the status of olive-infecting viruses in Syria. EPPO Bull. 2005, 35, 249–252. [Google Scholar] [CrossRef]
  43. Youssef, S.A.; Moawed, S.M.; El-Sayed, M.; Shalaby, A.A. Detection of olive tree viruses in Egypt by one-step RT-PCR. Julius-Kühn-Archiv. 2010, 427, 51. [Google Scholar]
  44. Mathioudakis, M.M.; Saponari, M.; Hasiów-Jaroszewska, B.; Elbeaino, T.; Koubouris, G. Detection of viruses in olive cultivars in Greece, using a rapid and efective RNA extraction method, for certification of virus-tested propagation material. Phytopathol. Mediterr. 2020, 59, 203–211. [Google Scholar] [CrossRef]
  45. Çakalli, A. Sanitary Assessment of Albanian Olive and Stone Fruit Varieties. Master’s Thesis, Università degli Studi di Bari Aldo Moro—CIHEAM (Istituto Agronomico Mediterraneo di Bari), Bari, Italy, 1999; p. 45. [Google Scholar]
  46. Luigi, M.; Manglli, A.; Thomaj, F.; Buonaurio, R.; Barba, M.; Faggioli, F. Phytosanitary evaluation of olive germplasm in Albania. Phytopathol. Mediterr. 2009, 48, 280–284. Available online: http://www.jstor.org/stable/26463352 (accessed on 1 February 2023).
  47. Samara, R.; Alkowni, R.; Qubbaj, T.; Abu-Qaoud, H.; Jarrar, S. Plant diseases associated with olive bark midge in West-Bank Palestine. Res. Crops 2018, 19, 712–719. [Google Scholar] [CrossRef]
  48. Marn, M.V.; Pleško, I.M. Detection of olive viruses in Slovenia. In Power of Viruses: Programme and Abstracts; Bielen, A., Ježić, M., Jurak, I., Škorić, D., Tomaic, V., Eds.; Hrvatsko Mikrobiološko Društvo: Zagabria, Croatia, 2018; p. 101. [Google Scholar]
  49. Ruiz-García, A.B.; Canales, C.; Morán, F.; Ruiz-Torres, M.; Herrera-Mármol, M.; Olmos, A. Characterization of Spanish Olive Virome by High Throughput Sequencing Opens New Insights and Uncertainties. Viruses 2021, 13, 2233. [Google Scholar] [CrossRef]
  50. Martelli, G.P. A Brief Outline of Infectious Diseases of Olive. Palest. Tech. Univ. Res. J. 2013, 1, 10. [Google Scholar] [CrossRef]
  51. Cutuli, M.; Lo Bianco, R.; Marra, F.P.; Caruso, T. Growth and physiological responses of young olive trees affected by Olive leaf yellowing associated virus. In International Symposium on Physiological Principles and Their Application to Fruit Production; Robinson, T., Ed.; ISHS Acta Horticulturae: Geneva, Switzerland; New York, NY, USA, 2014; pp. 165–168. [Google Scholar] [CrossRef]
  52. Martelli, G.P.; Prota, U. Malattie e patogeni dell’olivo trasmessi col materiale di propagazione. In I Georgofili, Quaderni, 2nd ed.; Polistampa: Firenze, Italy, 1997; pp. 73–96. [Google Scholar]
  53. Mollov, D.; Filloux, D.; Grinstead, S.; Bolus, S.; Claude, L.; Fernandez, E.; Julian, C.; Cadresse, T.; Lockhart, B.; Roumagnac, P.; et al. Sugarcane mild mosaic virus: The rediscovery of an identified but unrecognized virus. Plant Pathol. 2022, 72, 312–321. [Google Scholar] [CrossRef]
  54. GBIF—Global Biodiversity Information Facility. Available online: https://www.gbif.org/ (accessed on 1 June 2023).
  55. Guessab, A.; Lazreg, F.; Elouissi, M.; Elouissi, A.; Daikh, Z. Larvicidal activities of essential oils against Euphyllura olivina Costa (Homoptera: Psyllidae). An. Univ. Din Oradea Fasc. Biol. 2022, 2, 140–148. [Google Scholar]
  56. Martelli, G.P.; Savino, V.; Catalano, L.; Di Terlizzi, B.; Sabanadzovic, S.; Greco, N. Viruses and certification of olive in Apulia (Southern Italy). In XVI International Symposium on Fruit Tree Virus Diseases; Barba, M., Hadidi, A., Eds.; ISHS Acta Horticulturae: Rome, Italy, 1994; pp. 569–573. [Google Scholar] [CrossRef]
  57. Zellama, M.S.; Varanda, C.M.; Materatski, P.; Nabi, N.; Hafsa, A.B.; Saamali, B.M.; Félix, M.R. An integrated approach for understanding the high infection rates of olive viruses in Tunisia. Eur. J. Plant Pathol. 2019, 153, 1043–1054. [Google Scholar] [CrossRef]
  58. Erilmez, S. The comparison of sensitivity of various methods in the detection of olive tree viruses. J. Turk. Phytopathol. 2016, 45, 1–13. [Google Scholar]
  59. Clark, M.F.; Adams, A. Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 1977, 34, 475. [Google Scholar] [CrossRef] [PubMed]
  60. Ferriol, I.; Rangel, E.A.; Panno, S.; Davino, S.; Han, C.G.; Olmos, A.; Rubio, L. Rapid detection and discrimination of fabaviruses by flow-through hybridisation with genus-and species-specific riboprobes. Ann. Appl. Biol. 2015, 167, 26–35. [Google Scholar] [CrossRef]
  61. Panno, S.; Caruso, A.G.; Bertacca, S.; Mati’c, S.; Davino, S.; Parrella, G. Detection of parietaria mottle virus by RT-qPCR: An emerging virus native of Mediterranean area that undermine tomato and pepper production in Southern Italy. Front. Plant Sci. 2021, 12, 698573. [Google Scholar] [CrossRef]
  62. Campos, M.D.; Zellama, M.S.; Varanda, C.; Materatski, P.; Peixe, A.; Chaouachi, M.; Félix, M.D.R. Establishment of a sensitive qPCR methodology for detection of the olive-infecting viruses in Portuguese and Tunisian orchards. Front. Plant Sci. 2019, 10, 694. [Google Scholar] [CrossRef] [Green Version]
  63. Matić, S.; Candian, V.; D’Errico, C.; Pierro, R.; Panno, S.; Davino, S.; Noris, E.; Tedeschi, R. In-Field LAMP Detection of Flavescence Dorée Phytoplasma in Crude Extracts of the Scaphoideus titanus Vector. Agronomy 2022, 12, 1645. [Google Scholar] [CrossRef]
  64. Notomi, T.; Mori, Y.; Tomita, N.; Kanda, H. Loop-mediated isothermal amplification (LAMP): Principle, features, and future prospects. J. Microbiol. 2015, 53, 1–5. [Google Scholar] [CrossRef]
  65. Ayukawa, Y.; Hanyuda, S.; Fujita, N.; Komatsu, K.; Arie, T. Novel loop-mediated isothermal amplification (LAMP) assay with a universal QProbe can detect SNPs determining races in plant pathogenic fungi. Sci. Rep. 2017, 7, 4253. [Google Scholar] [CrossRef] [Green Version]
  66. Khan, M.; Wang, R.; Li, B.; Liu, P.; Weng, Q.; Chen, Q. Comparative evaluation of the LAMP assay and PCR-based assays for the rapid detection of Alternaria solani. Front. Microbiol. 2018, 9, 2089. [Google Scholar] [CrossRef] [Green Version]
  67. Panno, S.; Matić, S.; Tiberini, A.; Caruso, A.G.; Bella, P.; Torta, L.; Stassi, R.; Davino, S. Loop mediated isothermal amplification: Principles and applications in plant virology. Plants 2020, 9, 461. [Google Scholar] [CrossRef] [Green Version]
  68. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Green Version]
  69. Davino, S.; Panno, S.; Arrigo, M.; La Rocca, M.; Caruso, A.G.; Bosco, G.L. Planthology: An application system for plant diseases management. Chem. Eng. Trans. 2017, 58, 619–624. [Google Scholar] [CrossRef]
  70. Gottwald, T.R.; Hughes, G. A new survey method for Citrus tristeza virus disease assessment. In Proceedings of the XIV International Organization of Citrus Virologists (1957–2010), Campinas, Brazil, 19–18 September 1998; Volume 14, pp. 77–87. [Google Scholar] [CrossRef]
  71. Zhao, J.; Zhang, X.; Hong, Y.; Liu, Y. Chloroplast in plant-virus interaction. Front. Microbiol. 2016, 7, 1565. [Google Scholar] [CrossRef] [Green Version]
  72. Albanese, G.; Saponari, M.; Faggioli, F. Phytosanitary certification. In Olive Germoplasm—The Olive Cultivation, Table Olive and Olive Oil Industry in Italy; Muzzalupo, I., Ed.; IntechOpen: London, UK, 2012; pp. 107–132. [Google Scholar] [CrossRef] [Green Version]
  73. Martelli, G.P.; Salerno, M.; Savino, V.; Prota, U. An appraisal of diseases and pathogens of olive. In IV International Symposium on Olive Growing; Vitagliano, C., Martelli, G.P., Eds.; ISHS Acta Horticulturae: Valenzano, Italy, 2000; pp. 701–708. [Google Scholar] [CrossRef]
  74. Montilon, V.; Potere, O.; Susca, L.; Bottalico, G. Phytosanitary Rules for the Movement of Olive (Olea europaea L.) Propagation Material into the European Union (EU). Plants 2023, 12, 699. [Google Scholar] [CrossRef]
  75. Kiddle, G.; Hardinge, P.; Buttigieg, N.; Gandelman, O.; Pereira, C.; McElgunn, C.J.; Rizzoli, M.; Jackson, R.; Appleton, N.; Moore, C.; et al. GMO detection using a bioluminescent real time reporter (BART) of loop mediated isothermal amplification (LAMP) suitable for field use. BMC Biotechnol. 2012, 12, 15. [Google Scholar] [CrossRef] [Green Version]
  76. Schrader, C.; Schielke, A.; Ellerbroek, L.; Johne, R. PCR inhibitors–occurrence, properties and removal. J. Appl. Microbiol 2012, 113, 1014–1026. [Google Scholar] [CrossRef]
  77. Zhao, L.; Li, G.; Gao, Y.; Zhu, Y.; Liu, J.; Zhu, X. Reverse transcription loop-mediated isothermal amplification assay for detecting tomato chlorosis virus. J. Virol. Methods 2015, 213, 93–97. [Google Scholar] [CrossRef]
  78. Zhang, Y.; Xie, Z.; Fletcher, J.D.; Wang, Y.; Wang, R.; Guo, Z.; He, Y. Rapid and sensitive detection of Lettuce yellows and cucumber mosaic virus infecting lettuce (Lactuca sativa L.) by reverse transcription loop-mediated isothermal amplification. Plant Pathol. J. 2020, 36, 76–86. [Google Scholar] [CrossRef]
  79. Tiberini, A.; Tomlinson, J.; Micali, G.; Fontana, A.; Albanese, G.; Tomassoli, L. Development of a reverse transcription-loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Onion yellow dwarf virus. J. Virol. Methods 2019, 271, 113680. [Google Scholar] [CrossRef]
  80. Caruso, A.G.; Ragona, A.; Bertacca, S.; Montoya, M.A.M.; Panno, S.; Davino, S. Development of an In-Field Real-Time LAMP Assay for Rapid Detection of Tomato Leaf Curl New Delhi Virus. Plants 2023, 12, 1487. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 09 00702 g001 550
Figure 1. Sampling regions in Spain (left) and Italy (right).
Figure 1. Sampling regions in Spain (left) and Italy (right).
Horticulturae 09 00702 g001
Horticulturae 09 00702 g002 550
Figure 2. Genome position of the LAMP primer set designed in this work. F3 and B3 are shown in pale blue, FIP (F1c-F2) in red, BIP (B1c-B2) in gray, and the two loop primers LF and LB in green. Genomic position of the first and last nucleotide in the selected sequence is represented by the number at the beginning and end of the sequence (GenBank Acc. No. MW056495).
Figure 2. Genome position of the LAMP primer set designed in this work. F3 and B3 are shown in pale blue, FIP (F1c-F2) in red, BIP (B1c-B2) in gray, and the two loop primers LF and LB in green. Genomic position of the first and last nucleotide in the selected sequence is represented by the number at the beginning and end of the sequence (GenBank Acc. No. MW056495).
Horticulturae 09 00702 g002
Horticulturae 09 00702 g003 550
Figure 3. Real-time RT-LAMP assay results for OLYaV detection. Amplification (A) and melting (B) curves of OLYaV V64 isolate. NC: negative control.
Figure 3. Real-time RT-LAMP assay results for OLYaV detection. Amplification (A) and melting (B) curves of OLYaV V64 isolate. NC: negative control.
Horticulturae 09 00702 g003
Horticulturae 09 00702 g004 550
Figure 4. RT-PCR products electrophoresis on 1.5% agarose gel for OLYaV detection using 10-fold serial dilutions. M: Bioline HyperLadder 100 bp marker. From 100 to 10−15: 10-fold serial dilutions of a purified recombinant plasmid. NC: negative control.
Figure 4. RT-PCR products electrophoresis on 1.5% agarose gel for OLYaV detection using 10-fold serial dilutions. M: Bioline HyperLadder 100 bp marker. From 100 to 10−15: 10-fold serial dilutions of a purified recombinant plasmid. NC: negative control.
Horticulturae 09 00702 g004
Horticulturae 09 00702 g005 550
Figure 5. Sensitivity of real-time RT-LAMP assays for OLYaV detection using 10-fold serial dilutions. (A) Fluorescence of the 10-fold serial dilutions analyzed. Fluorescence increasing in positive sample curves (from ≈50 × 10−1 to ≈50 × 10−12 ng/µL) after 2 to 33 min. (B) Melting curves.
Figure 5. Sensitivity of real-time RT-LAMP assays for OLYaV detection using 10-fold serial dilutions. (A) Fluorescence of the 10-fold serial dilutions analyzed. Fluorescence increasing in positive sample curves (from ≈50 × 10−1 to ≈50 × 10−12 ng/µL) after 2 to 33 min. (B) Melting curves.
Horticulturae 09 00702 g005
Horticulturae 09 00702 g006 550
Figure 6. Specificity of the real-time RT-LAMP assays for OLYaV. Amplification (A) and melting (B) curves of OLYaV V64 isolate, and viruses used as out-group. NC: negative control.
Figure 6. Specificity of the real-time RT-LAMP assays for OLYaV. Amplification (A) and melting (B) curves of OLYaV V64 isolate, and viruses used as out-group. NC: negative control.
Horticulturae 09 00702 g006
Horticulturae 09 00702 g007 550
Figure 7. Typical yellowing branches on olive tree infected by olive leaf yellowing-associated virus.
Figure 7. Typical yellowing branches on olive tree infected by olive leaf yellowing-associated virus.
Horticulturae 09 00702 g007
Horticulturae 09 00702 g008 550
Figure 8. (A) Typical foliar symptoms caused by olive leaf yellowing-associated virus on collected samples. (B) Asymptomatic olive leaves sample.
Figure 8. (A) Typical foliar symptoms caused by olive leaf yellowing-associated virus on collected samples. (B) Asymptomatic olive leaves sample.
Horticulturae 09 00702 g008
Table
Table 1. Viruses belonging to Closteroviridae family, and their sequences used for in silico analysis.
Table 1. Viruses belonging to Closteroviridae family, and their sequences used for in silico analysis.
SpeciesGenusFamilyGenBank
Accession No.
Citrus tristeza virus (CTV)ClosterovirusClosteroviridaeEU937521
AF001623
Y18420
Grapevine leafroll-associated virus 1 (GLRaV-1)NC016509
Grapevine leafroll-associated virus 2 (GLRaV-2)AmpelovirusDQ286725
Grapevine leafroll-associated virus 3 (GLRaV-3)AF037268
Tomato chlorosis virus (ToCV)CrinivirusRNA1: AY903447
RNA2: AY903448
Tomato infectious chlorosis virus (TICV)RNA1: FJ815440
RNA2: FJ815441
Cucurbit yellow stunting disorder virus (CYSDV)RNA1: NC004809
RNA2: NC004810
Actinidia virus 1 (AcV1)OlivavirusKX857665
Persimmon virus B (PeVB)AB923924
Table
Table 2. Olive cultivars collected from different Italian and Spanish regions.
Table 2. Olive cultivars collected from different Italian and Spanish regions.
CountryRegionProvinceNo. of Samples CollectedCultivar
ItalySicilyAgrigento20Giarraffa
Trapani20Nocellara del Belice
CalabriaCrotone20Carolea
ApuliaTaranto20Ogliarola barese
LazioFrosinone20Leccino
UmbriaTerni20Frantoio
SpainComunitat ValencianaValencia20Serrana Espadán, Picual
Castellón20Serrana Espadán, Villalonga
AndalusiaJaén20Picual, Villalonga
Granada20Arbequina
Table
Table 3. OLYaV RT-PCR primer pairs designed in this work.
Table 3. OLYaV RT-PCR primer pairs designed in this work.
Primer NameBinding Sites (Genbank Acc. No. MW056495)Genomic PositionNucleotide Sequence (5′-3′)Annealing Temperature—Ta (°C)Amplicon Size (bp)
OLYaV-21F21–445′ UTR-ORF1aATCAATTGAAGAAAACCACTCCC59450
OLYaV-471R450–471AGTACCTCCCACGACGTATTG
OLYaV-30F30–545′ UTR-ORF1aGAAAACCACTCCCTTCAATTCAAT61497
OLYaV-527R505–527GAAGAACTATTGATTGGCTTGGG
OLYaV-36F36–595′ UTR-ORF1aCCACTCCCTTCAATTCAATAACAT60428
OLYaV-444R444–464CCCACGACGTATTGACCACTC
OLYaV-46F46–675′ UTR-ORF1aCAATTCAATAACATAACATACC60345
OLYaV-371R371–391ATGTGACTTTTGACTGAGGTA
OLYaV-495F495–517ORF1aGAAGAACACTCCCAAGCCAATC60646
OLYaV-1141R1120–1141CACACTCTCTCTTGTAAGTCCC
OLYaV-742F742–763ORF1aGCGGCTTGGGTCATTAAGGGT60427
OLYaV-1166R1147–1166GGGCAAAAATAGTGAGAGCGAC
Table
Table 4. Primers designed for OLYaV detection by real-time RT-LAMP.
Table 4. Primers designed for OLYaV detection by real-time RT-LAMP.
Primer NameNucleotide Sequence (5′-3′)Amplicon Size (bp)
OLYaV-F3CTGGTCTCTACGTACAGGGA195
OLYaV-B3GGTACTGCCTCAGTTCCCA
OLYaV-FIPCCGGTAACGACCTTCAGCCTTCCCCGCTGTGCAGAACAAC-
OLYaV-BIPAAGAAAACGGGCTGTAGCCCATGCCGTCAATGTTACGAGC
OLYaV-LoopFTCTGTGCAGATCTAGATTTGGGA-
OLYaV-LoopBGAGGAAAGCAGCGACCACC
Table
Table 5. Real-time RT-LAMP assay performance for OLYaV detection.
Table 5. Real-time RT-LAMP assay performance for OLYaV detection.
SampleReal-Time RT-LAMP Reaction Time (Min)
Assay #1Assay #2Assay #3
OLYaV V64 isolate13.714.114.4
Negative control (NC)---
Table
Table 6. Comparison of real-time RT-LAMP and end-point RT-PCR assays sensitivity using 10-fold serial dilutions of a purified recombinant plasmid (SD: standard deviation).
Table 6. Comparison of real-time RT-LAMP and end-point RT-PCR assays sensitivity using 10-fold serial dilutions of a purified recombinant plasmid (SD: standard deviation).
Starting DNA Concentration (50 ng/μL) (1.34 × 1010 Copies)
Assay10010−110−210−310−410−510−610−710−810−910−1010−1110−1210−1310−1410−15
End-point RT-PCR++++++++++++−−−−
LAMP reaction time plateau (min)
(mean values ± SD) 		13
±
0.1		13.9
±
0.2		15.2
±
0.2		16.8
±
0.2		17.4
±
0.1		20.1
±
0.4		22
±
0.2		24.4
±
0.4		25.1
±
0.3		26.3
±
0.4		31.2
±
0.4		35.1
±
0.3		43.4
±
0.4		−−−
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Caruso, A.G.; Bertacca, S.; Ragona, A.; Agrò, G.; Font-San-Ambrosio, M.I.; Alfaro-Fernández, A.; Sánchez, R.E.; Panno, S.; Davino, S. Detection by Sensitive Real-Time Reverse Transcription Loop-Mediated Isothermal Amplification of Olive Leaf Yellowing Associated Virus and Its Incidence in Italy and Spain. Horticulturae 2023, 9, 702. https://doi.org/10.3390/horticulturae9060702

AMA Style

Caruso AG, Bertacca S, Ragona A, Agrò G, Font-San-Ambrosio MI, Alfaro-Fernández A, Sánchez RE, Panno S, Davino S. Detection by Sensitive Real-Time Reverse Transcription Loop-Mediated Isothermal Amplification of Olive Leaf Yellowing Associated Virus and Its Incidence in Italy and Spain. Horticulturae. 2023; 9(6):702. https://doi.org/10.3390/horticulturae9060702

Chicago/Turabian Style

Caruso, Andrea Giovanni, Sofia Bertacca, Arianna Ragona, Graziella Agrò, Maria Isabel Font-San-Ambrosio, Ana Alfaro-Fernández, Rocío Estévez Sánchez, Stefano Panno, and Salvatore Davino. 2023. "Detection by Sensitive Real-Time Reverse Transcription Loop-Mediated Isothermal Amplification of Olive Leaf Yellowing Associated Virus and Its Incidence in Italy and Spain" Horticulturae 9, no. 6: 702. https://doi.org/10.3390/horticulturae9060702

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop