A Novel Cu2+ Quantitative Detection Nucleic Acid Biosensors Based on DNAzyme and “Blocker” Beacon
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Preparation of DNAzyme
2.3. Hybridization and Ligation
2.4. PCR Amplification
2.5. Colorimetric Determination of Cu2+
2.6. Analysis of Copper Ion Content in Yunnan Water Samples
3. Results and Discussion
3.1. Principle of the Biosensor System
3.2. Verification of the Biosensor System
3.3. Optimization of the Biosensor
3.4. Sensitivity of the Biosensor
3.5. Selectivity of the Biosensor
3.6. Application of the Biosensor
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Hussain, I.; Afzal, S.; Ashraf, M.A.; Rasheed, R.; Saleem, M.H.; Alatawi, A.; Ameen, F.; Fahad, S. Effect of Metals or Trace Elements on Wheat Growth and Its Remediation in Contaminated Soil. J. Plant Growth Regul. 2022, 26, 1–25. [Google Scholar] [CrossRef]
- Berni, R.; Luyckx, M.; Xu, X.; Legay, S.; Sergeant, K.; Hausman, J.F.; Lutts, S.; Cai, G.; Guerriero, G. Reactive oxygen species and heavy metal stress in plants: Impact on the cell wall and secondary metabolism. Environ. Exp. Bot. 2019, 161, 98–106. [Google Scholar] [CrossRef]
- Khan, A.; Khan, S.; Khan, M.A.; Qamar, Z.; Waqas, M. The uptake and bioaccumulation of heavy metals by food plants, their effects on plants nutrients, and associated health risk: A review. Environ. Sci. Pollut. Res. 2015, 22, 13772–13799. [Google Scholar] [CrossRef] [PubMed]
- Kelly, B.C.; Gobas, F.; McLachlan, M.S. Intestinal absorption and biomagnification of organic contaminants in fish, wildlife, and humans. Environ. Toxicol. Chem. 2004, 23, 2324–2336. [Google Scholar] [CrossRef]
- Mohmand, J.; Eqani, S.; Fasola, M.; Alamdar, A.; Mustafa, I.; Ali, N.; Liu, L.P.; Peng, S.Y.; Shen, H.Q. Human exposure to toxic metals via contaminated dust: Bio-accumulation trends and their potential risk estimation. Chemosphere 2015, 132, 142–151. [Google Scholar] [CrossRef]
- Tekaya, N.; Saiapina, O.; Ben Ouada, H.; Lagarde, F.; Ben Ouada, H.; Jaffrezic-Renault, N. Ultra-sensitive conductometric detection of pesticides based on inhibition of esterase activity in Arthrospira platensis. Environ. Pollut. 2013, 178, 182–188. [Google Scholar] [CrossRef]
- Jarup, L. Hazards of heavy metal contamination. Br. Med. Bull. 2003, 68, 167–182. [Google Scholar] [CrossRef] [Green Version]
- Singh, A.; Sharma, R.K.; Agrawal, M.; Marshall, F.M. Health risk assessment of heavy metals via dietary intake of foodstuffs from the wastewater irrigated site of a dry tropical area of India. Food Chem. Toxicol. 2010, 48, 611–619. [Google Scholar] [CrossRef]
- Karube, I.; Nomura, Y.; Arikawa, Y. Biosensors for environmental control. TrAC Trends Anal. Chem. 1995, 14, 295–299. [Google Scholar] [CrossRef] [Green Version]
- Bremner, I. Manifestations of copper excess. Am. J. Clin. Nutr. 1998, 67, 1069S–1073S. [Google Scholar] [CrossRef] [Green Version]
- Chan, M.S.; Huang, S.D. Direct determination of cadmium and copper in seawater using a transversely heated graphite furnace atomic absorption spectrometer with Zeeman-effect background corrector. Talanta 2000, 51, 373–380. [Google Scholar] [CrossRef]
- Santosa, S.J.; Tanaka, S.; Yamanaka, K. Inductively coupled plasma mass spectrometry for the sequential determination of trace metals in sea water after electrothermal vaporization of their dithiocarbamate complexes in methyl isobutyl ketone. Fresenius J. Anal. Chem. 1997, 357, 1127. [Google Scholar] [CrossRef]
- Zhu, G.C.; Zhang, C.Y. Functional nucleic acid-based sensors for heavy metal ion assays. Analyst 2014, 139, 6326–6342. [Google Scholar] [CrossRef] [PubMed]
- Zhan, S.S.; Wu, Y.G.; Luo, Y.F.; Liu, L.; He, L.; Xing, H.B.; Zhou, P. Label-free fluorescent sensor for lead ion detection based on lead(II)-stabilized G-quadruplex formation. Anal. Biochem. 2014, 462, 19–25. [Google Scholar] [CrossRef]
- Li, W.Y.; Yang, Y.; Chen, J.; Zhang, Q.F.; Wang, Y.; Wang, F.Y.; Yu, C. Detection of lead(II) ions with a DNAzyme and isothermal strand displacement signal amplification. Biosens. Bioelectron. 2014, 53, 245–249. [Google Scholar] [CrossRef]
- Liu, J.; Lu, Y. Rational design of “Turn-On” allosteric DNAzyme catalytic beacons for aqueous mercury ions with ultrahigh sensitivity and selectivity. Angew. Chem. Int. Ed. 2007, 46, 7587–7590. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Dong, S.J.; Wang, E. Label-Free Colorimetric Detection of Aqueous Mercury Ion (Hg2+) Using Hg2+-Modulated G-Quadruplex-Based DNAzymes. Anal. Chem. 2009, 81, 2144–2149. [Google Scholar] [CrossRef] [PubMed]
- Lang, M.J.; Li, Q.; Huang, H.M.; Yu, F.; Chen, Q.H. Highly sensitive exonuclease III-assisted fluorometric determination of silver(I) based on graphene oxide and self-hybridization of cytosine-rich ss-DNA. Microchim. Acta 2016, 183, 1659–1665. [Google Scholar] [CrossRef]
- Li, T.; Shi, L.L.; Wang, E.K.; Dong, S.J. Silver-Ion-Mediated DNAzyme Switch for the Ultrasensitive and Selective Colorimetric Detection of Aqueous Ag+ and Cysteine. Chem. Eur. J. 2009, 15, 3347–3350. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.D.; Gao, Z.Q.; Wei, Q.H.; Chen, G.N.; Tang, D.P. Hemin/G-quadruplex-based DNAzyme concatamers for in situ amplified impedimetric sensing of copper(II) ion coupling with DNAzyme-catalyzed precipitation strategy. Biosens. Bioelectron. 2015, 74, 1–7. [Google Scholar] [CrossRef]
- Liu, J.; Lu, Y. A DNAzyme catalytic beacon sensor for paramagnetic Cu2+ ions in aqueous solution with high sensitivity and selectivity. J. Am. Chem. Soc. 2007, 129, 9838–9839. [Google Scholar] [CrossRef] [PubMed]
- Huang, P.J.J.; Liu, J.W. An Ultrasensitive Light-up Cu2+ Biosensor Using a New DNAzyme Cleaving a Phosphorothioate-Modified Substrate. Anal. Chem. 2016, 88, 3341–3347. [Google Scholar] [CrossRef] [PubMed]
- Moshe, M.; Elbaz, J.; Willner, I. Sensing of UO22+ and Design of Logic Gates by the Application of Supramolecular Constructs of Ion-Dependent DNAzymes. Nano Lett. 2009, 9, 1196–1200. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.W.; Brown, A.K.; Meng, X.L.; Cropek, D.M.; Istok, J.D.; Watson, D.B.; Lu, Y. A catalytic beacon sensor for uranium with parts-per-trillion sensitivity and millionfold selectivity. Proc. Natl. Acad. Sci. USA 2007, 104, 2056–2061. [Google Scholar] [CrossRef] [Green Version]
- Silverman, S.K. In vitro selection, characterization, and application of deoxyribozymes that cleave RNA. Nucleic Acids Res. 2005, 33, 6151–6163. [Google Scholar] [CrossRef] [Green Version]
- Gao, L.; Li, L.L.; Wang, X.L.; Wu, P.W.; Cao, Y.; Liang, B.; Li, X.; Lin, Y.W.; Lu, Y.; Guo, X.F. Graphene-DNAzyme junctions: A platform for direct metal ion detection with ultrahigh sensitivity. Chem. Sci. 2015, 6, 2469–2473. [Google Scholar] [CrossRef] [Green Version]
- Li, L.; Li, B.X.; Qi, Y.Y.; Jin, Y. Label-free aptamer-based colorimetric detection of mercury ions in aqueous media using unmodified gold nanoparticles as colorimetric probe. Anal. Bioanal. Chem. 2009, 393, 2051–2057. [Google Scholar] [CrossRef]
- Liu, J.; Lu, Y. Colorimetric Cu2+ detection with a ligation DNAzyme and nanopairticles. Chem. Commun. 2007, 46, 4872–4874. [Google Scholar] [CrossRef]
- Fang, Z.Y.; Huang, J.; Lie, P.C.; Xiao, Z.; Ouyang, C.Y.; Wu, Q.; Wu, Y.X.; Liu, G.D.; Zeng, L.W. Lateral flow nucleic acid biosensor for Cu2+ detection in aqueous solution with high sensitivity and selectivity. Chem. Commun. 2010, 46, 9043–9045. [Google Scholar] [CrossRef]
- Xu, X.Y.; Daniel, W.L.; Wei, W.; Mirkin, C.A. Colorimetric Cu2+ Detection Using DNA-Modified Gold-Nanoparticle Aggregates as Probes and Click Chemistry. Small 2010, 6, 623–626. [Google Scholar] [CrossRef] [Green Version]
- Wang, F.; Orbach, R.; Willner, I. Detection of Metal Ions (Cu2+, Hg2+) and Cocaine by Using Ligation DNAzyme Machinery. Chem. Eur. J. 2012, 18, 16030–16036. [Google Scholar] [CrossRef] [PubMed]
- Li, L.D.; Luo, L.; Mu, X.J.; Sun, T.Y.; Guo, L. A reagentless signal-on architecture for electronic, real-time copper sensors based on self-cleavage of DNAzymes. Anal. Methods 2010, 2, 627–630. [Google Scholar] [CrossRef]
- Chen, Z.B.; Li, L.D.; Mu, X.J.; Zhao, H.T.; Guo, L. Electrochemical aptasensor for detection of copper based on a reagentless signal-on architecture and amplification by gold nanoparticles. Talanta 2011, 85, 730–735. [Google Scholar] [CrossRef] [PubMed]
- Ocana, C.; Malashikhina, N.; del Valle, M.; Pavlov, V. Label-free selective impedimetric detection of Cu2+ ions using catalytic DNA. Analyst 2013, 138, 1995–1999. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.L.; Zhang, Y.Y.; Wei, M.J.; Yi, Y.H.; Li, H.T.; Yao, S.Z. A label-free fluorescent molecular switch for Cu2+ based on metal ion-triggered DNA-cleaving DNAzyme and DNA intercalator. New J. Chem. 2013, 37, 1252–1257. [Google Scholar] [CrossRef]
- Yin, B.C.; Zuo, P.; Huo, H.; Zhong, X.H.; Ye, B.C. DNAzyme self-assembled gold nanoparticles for determination of metal ions using fluorescence anisotropy assay. Anal. Biochem. 2010, 401, 47–52. [Google Scholar] [CrossRef]
- Liu, M.; Zhao, H.M.; Chen, S.; Yu, H.T.; Zhang, Y.B.; Quan, X. Label-free fluorescent detection of Cu(II) ions based on DNA cleavage-dependent graphene-quenched DNAzymes. Chem. Commun. 2011, 47, 7749–7751. [Google Scholar] [CrossRef]
- Zhan, S.S.; Wu, Y.G.; Wang, L.M.; Zhan, X.J.; Zhou, P. A mini-review on functional nucleic acids-based heavy metal ion detection. Biosens. Bioelectron. 2016, 86, 353–368. [Google Scholar] [CrossRef]
- Li, H.; Huang, X.X.; Kong, D.M.; Shen, H.X.; Liu, Y. Bioelectronics, Ultrasensitive, high temperature and ionic strength variation-tolerant Cu2+ fluorescent sensor based on reconstructed Cu2+ -dependent DNAzyme/substratecomplex. Biosens. Bioelectron. 2013, 42, 225–228. [Google Scholar] [CrossRef]
- Zuo, P.; Yin, B.C.; Ye, B.C. DNAzyme-based microarray for highly sensitive determination of metal ions. Biosens. Bioelectron. 2009, 25, 935–939. [Google Scholar] [CrossRef]
- Xiang, Y.; Lu, Y. DNA as Sensors and Imaging Agents for Metal Ions. Inorg. Chem. 2014, 53, 1925–1942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, G.Y.; Lin, W.L.; Yang, W.Q.; Lin, Z.Y.; Guo, L.H.; Qiu, B.; Chen, G.N. Logic gates for multiplexed analysis of Hg2+ and Ag+. Analyst 2012, 137, 2687–2691. [Google Scholar] [CrossRef] [PubMed]
- Li, M.H.; Wang, Y.S.; Cao, J.X.; Chen, S.H.; Tang, X.; Zhu, X.F.; Zhu, Y.F.; Huang, Y.Q. Ultrasensitive detection of uranyl by graphene oxide-based background reduction and RCDzyme-based enzyme strand recycling signal amplification. Biosens. Bioelectron. 2015, 72, 294–299. [Google Scholar] [CrossRef] [PubMed]
- Ge, C.C.; Chen, J.H.; Wu, W.; Fang, Z.Y.; Chen, L.B.; Liu, Q.; Wang, L.; Xing, X.R.; Zeng, L.W. An enzyme-free and label-free assay for copper(II) ion detection based on self-assembled DNA concatamers and Sybr Green I. Analyst 2013, 138, 4737–4740. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, F.; Yang, X.R. Label-free colorimetric biosensing of copper(II) ions with unimolecular self-cleaving deoxyribozymes and unmodified gold nanoparticle probes. Nanotechnology 2010, 21, 205502. [Google Scholar] [CrossRef]
- Stefan, L.; Xu, H.J.; Gros, C.P.; Denat, F.; Monchaud, D. Harnessing Nature’s Insights: Synthetic Small Molecules with Peroxidase-Mimicking DNAzyme Properties. Chem. Eur. J. 2011, 17, 10857–10862. [Google Scholar] [CrossRef]
- Kong, D.M.; Wu, J.; Wang, N.; Yang, W.; Shen, H.X. Peroxidase activity-structure relationship of the intermolecular four-stranded G-quadruplex-hemin complexes and their application in Hg2+ ion detection. Talanta 2009, 80, 459–465. [Google Scholar] [CrossRef]
- Travascio, P.; Bennet, A.J.; Wang, D.Y.; Sen, D. A ribozyme and a catalytic DNA with peroxidase activity: Active sites versus cofactor-binding sites. Chem. Biol. 1999, 6, 779–787. [Google Scholar] [CrossRef]
- Zhou, X.H.; Kong, D.M.; Shen, H.X. Ag+ and Cysteine Quantitation Based on G-Quadruplex-Hemin DNAzymes Disruption by Ag+. Anal. Chem. 2010, 82, 789–793. [Google Scholar] [CrossRef]
- Yin, B.C.; Ye, B.C.; Tan, W.H.; Wang, H.; Xie, C.C. An Allosteric Dual-DNAzyme Unimolecular Probe for Colorimetric Detection of Copper(II). J. Am. Chem. Soc. 2009, 131, 14624–14625. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Cai, Y.; Li, H.; Kong, D.M.; Shen, H.X. Sensitive dual DNAzymes-based sensors designed by grafting self-blocked G-quadruplex DNAzymes to the substrates of metal ion-triggered DNA/RNA-cleaving DNAzymes. Biosens. Bioelectron. 2012, 38, 331–336. [Google Scholar] [CrossRef]
- Shang, Y.; Zhu, P.Y.; Xu, W.T.; Guo, T.X.; Tian, W.Y.; Luo, Y.B.; Huang, K.L. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis. Anal. Biochem. 2013, 443, 243–248. [Google Scholar] [CrossRef] [PubMed]
- Kong, H.S.; Lu, Y.L.; Dong, X.; Zeng, S.Y. Quantification of the Coordination Degree between Dianchi Lake Protection and Watershed Social-Economic Development: A Scenario-Based Analysis. Sustainability 2021, 13, 116. [Google Scholar] [CrossRef]
- Gao, L.; Yang, H.; Zhou, J.M.; Lu, J.J. Lake sediments from Dianchi Lake: A phosphorus sink or source? Pedosphere 2004, 14, 483–490. [Google Scholar]
- Wang, R.X.; Wu, F.; Chang, Y.Y.; Yang, X.J. Waterbirds and their Habitat Utilization of Artificial Wetlands at Dianchi Lake: Implication for Waterbird Conservation in Yunnan-Guizhou Plateau Lakes. Wetlands 2016, 36, 1087–1095. [Google Scholar] [CrossRef]
- Yin, L.; Chen, R.; Wang, X. Optimized strategies of pollution control for landscape lakes replenished with WWTP effluent based on pollutants balance analysis: A case study in Cuihu Lake in Kunming, China. Acta Sci. Circumstantiae 2015, 35, 449–455. [Google Scholar]
- Liu, X.J.; Wang, H.L. Dianchi Lake, China: Geological formation, causes of eutrophication and recent restoration efforts. Aquat. Ecosyst. Health Manag. 2016, 19, 40–48. [Google Scholar] [CrossRef]
- Yunzeng, C.; Hao, Y.; Feng, J.I.N.; Junjie, L.V.; Zhenke, Z.; Mingzhou, Q.I.N. Metal Pollution and Potential Ecological Risk of the Sediment in Dianchi Lake. Soils 2007, 39, 737–741. [Google Scholar]
- Lin, H.X.; Zou, Y.; Huang, Y.S.; Chen, J.; Zhang, W.Y.; Zhuang, Z.X.; Jenkins, G.; Yang, C.J. DNAzyme crosslinked hydrogel: A new platform for visual detection of metal ions. Chem. Commun. 2011, 47, 9312–9314. [Google Scholar] [CrossRef] [Green Version]
- Qu, W.S.; Liu, Y.Y.; Liu, D.B.; Wang, Z.; Jiang, X.Y. Copper-Mediated Amplification Allows Readout of Immunoassays by the Naked Eye. Angew. Chem. Int. Ed. 2011, 50, 3442–3445. [Google Scholar] [CrossRef]
- Ma, J.P.; Chen, G.Z.; Bai, W.S.; Zheng, J.B. Amplified electrochemical hydrogen peroxide sensing based on Cu-porphyrin metal–organic framework nanofilm and G-quadruplex-hemin DNAzyme. ACS Appl. Mater. Interfaces 2020, 12, 58105–58112. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′→3′) | Length | Reference | Product Size (bp) |
---|---|---|---|---|
UP-F | CAGGCGCCGCATTTTTATTGC | 21 | This study | 86 |
UP-R | CGTCGATGACATTTGCCGTAG | 22 | ||
ligationP-F | CAGGCGCCGCATTTTTATTGCCCTTCCGCCCTTGGTAAGC | 40 | ||
ligationP-R | CGTATTAGAAAGAAGCTTTCCCGCCCTACGGCAAATGTCATCGACG | 46 | ||
Cu-Sub | GGCGGGAAAGCTTCTTTCTAATACGGCTTACCAAGGGCGGAAGG | 44 | [21] | |
Cu-Enz | GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC | 35 | ||
Hairpin DNA-1F (H1) | GGGTAGGGCGGGTTGGGTTspacer18AACCCAACCCGCCCTACCCAAACAGGCGCCGCATTTTTATTGC | 62 | This study | |
Hairpin DNA-1R (H2) | GGTAGGGCGGGTGGGTTspacer18AACCCAACCCGCCCTACCCAAAGTCGATGACATTTGCCGTAG | 62 |
Sample | C1 | C2 | C3 | Recovery | ||||
---|---|---|---|---|---|---|---|---|
(μM) | RSD (%) | (μM) | RSD (%) | (μM) | RSD (%) | (%) | ||
This method | Dianchi lake | 0.22 | 4.75 | 0.1 | 5.29 | 0.314 | 4.21 | 94 |
Cuihu lake | 0.179 | 6.86 | 0.1 | 6.24 | 0.275 | 4.84 | 96 | |
ICP-MS | Dianchi lake | 0.228 | 2.33 | 0.1 | 2.97 | 0.318 | 1.24 | 90 |
Cuihu lake | 0.184 | 2.15 | 0.1 | 2.97 | 0.281 | 1.23 | 97 |
Detection Method | LOD | Reference |
---|---|---|
Colorimetric detection/DNAzyme | 20 nM | [28] |
Fluorescence detection/DNAzyme | 1 nM | [36] |
Colorimetric detection/DNAzyme | 290 nM | [45] |
Colorimetric detection/DNAzyme | 1 μM | [50] |
Colorimetric detection/DNAzyme | 4 nM | [51] |
Colorimetric detection/DNAzyme | 10 μM | [59] |
Colorimetric detection/DNAzyme | 1 μM | [60] |
Electrochemical detection/DNAzyme | 30 nM | [61] |
Colorimetric detection/DNAzyme | 18.25 nM | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Dong, K.; Xiang, S.; Lin, Y.; Cha, X.; Shang, Y.; Xu, W. A Novel Cu2+ Quantitative Detection Nucleic Acid Biosensors Based on DNAzyme and “Blocker” Beacon. Foods 2023, 12, 1504. https://doi.org/10.3390/foods12071504
Zhang H, Dong K, Xiang S, Lin Y, Cha X, Shang Y, Xu W. A Novel Cu2+ Quantitative Detection Nucleic Acid Biosensors Based on DNAzyme and “Blocker” Beacon. Foods. 2023; 12(7):1504. https://doi.org/10.3390/foods12071504
Chicago/Turabian StyleZhang, Hanyue, Kai Dong, Shuna Xiang, Yingting Lin, Xiaoyan Cha, Ying Shang, and Wentao Xu. 2023. "A Novel Cu2+ Quantitative Detection Nucleic Acid Biosensors Based on DNAzyme and “Blocker” Beacon" Foods 12, no. 7: 1504. https://doi.org/10.3390/foods12071504