Next Article in Journal
Protein Biomarker Discovery Studies on Urinary sEV Fractions Separated with UF-SEC for the First Diagnosis and Detection of Recurrence in Bladder Cancer Patients
Previous Article in Journal
Mechanisms Suggesting a Relationship between Vitamin D and Erectile Dysfunction: An Overview
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomolecules
Volume 13
Issue 6
10.3390/biom13060931
biomolecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development

by
Zongyu Liu
1,2,3,†,
Xin Jin
1,2,3,†,
Yulin Miao
1,2,3,
Ping Wang
1,2,3,
Yang Gu
1,2,3,
Xiaozhao Shangguan
1,2,3,
Lijing Chen
4,* and
Guiling Wang
1,2,3,*
1
Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture and Rural Affairs, Shanghai Ocean University, Shanghai 201306, China
2
National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China
3
Shanghai Engineering Research Center of Aquaculture, Shanghai 201306, China
4
Shanghai Vocational College of Agriculture and Forestry, Shanghai 201699, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Biomolecules 2023, 13(6), 931; https://doi.org/10.3390/biom13060931
Submission received: 12 May 2023 / Revised: 29 May 2023 / Accepted: 31 May 2023 / Published: 1 June 2023
(This article belongs to the Section Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
C-Mos, a proto-oncogene, regulates oocyte maturation by activating the classical MAPK pathway in cells. To examine the function of C-Mos in Hyriopsis cumingii, C-Mos was identified in this study. The full-length cDNA of C-Mos was 2213 bp, including 144 bp in the 5′ UTR, 923 bp in 3′ the UTR, and 1146 bp in the open reading frame (ORF) region. During early gonad development, the expression of C-Mos from 4 to 6 months of age in H. cumingii was significantly higher than that in other months, with the highest expression in 6-month-old H. cumingii, suggesting that C-Mos may be involved in early gonadal development in H. cumingii. Clear hybridization signals were found by in situ hybridization in the oocytes, oocyte nucleus and oogonium, and a small number of hybridization signals were found in the follicular wall of the male gonads. In addition, the C-Mos RNA interference (RNAi) assay results showed that the knockdown of C-Mos caused a down-regulation of ERK and P90rsk. In summary, these results indicate that C-Mos has a crucial part to play in gonadal development in H. cumingii.

1. Introduction

The MAPK (mitogen-activated protein kinase) pathway is widely expressed in animals, regulates varieties fundamental cellular events and is closely related to cell proliferation and differentiation [1]. The MAPK pathway can be divided into four cascade pathways: classical MAPK, p38-MAPK, JNK-MAPK, and ERK5-MAPK. Each cascade comprises three to five layers, depending on the substrate being acted upon [2]. Three of these layers (Mapkkk, Mapkk, and Mapk) have been identified as essential layers. Upon extracellular stimulation and activation by various internal cellular processes, single or multiple kinases within their layers can phosphorylate and activate downstream signalling molecules to initiate the cascade. Much of the current research on the MAPK pathway in reproduction has focused on the classical MAPK pathway and the P38-MAPK pathway, which have a significant impact on promoting gonadal development and regulating oocyte maturation [3,4,5]. In Cladonema pacificum, dephosphorylation of MAPkinase leads to the release of eggs from the stagnant state. The same result was obtained after MAP kinase kinase (MEK) inhibition using U0126 [6]. In Urechis caupo, active MAPK appears to be required for normal meiotic divisions and suppressing the paternal centrosome until after the egg completes meiosis [7]. Upon receipt of a stimulus, the upstream scaffold protein organises the various members of the pathway, delivers the signal precisely to the nucleus, and activates various transcription factors [8]. In mice, the MAPK pathway is implicated in sex determination [9] and modulates Sox9 expression to influence testicular development [10]. In Caenorhabditis elegans, the MAPK pathway is essential for the development of oocyte [11].
C-Mos, a proto-oncogene, is homologous to Moloney’s murine sarcoma virus oncogene. It is specifically expressed in the gonads, and is able to activate the MAPK pathway in oocytes of numerous species, except for Caenorhabditis elegans, which do not possess C-Mos [12]. Progesterone secreted from peripheral follicle cells binds to membrane receptors in the oocyte to initiate egg maturation, inducing a downward trend in intracellular cAMP levels, which inactivates PKA and stimulates the translation of C-Mos. Cyclin-B1 (CCNB1) and Cyclin-dependent Kinase 1 (cdk1) together form the maturation-promoting factor (MPF), which plays a key role in meiosis entry. Works in various species have revealed that MPF is strongly connected to the MAPK pathway [13,14,15]. In the Xenopus, C-Mos activates MPF [16] and the injection of C-Mos RNA into oocytes can successfully activate MPF and cause oocytes germinal vesicle breakdown (GVBD), even if the oocytes are not stimulated by progesterone [17]. C-Mos shows significant spatiotemporal expression in mouse testes and is suggested to be involved in spermatogenesis [18]. Oocyte development in vivo is not continuous, and is influenced by many factors during the process [19,20,21]. Oogenic cells receive hormonal stimulation and are induced to enter meiosis by GVBD [22], followed by oocyte arrest in the MII phase awaiting fertilization in vertebrates and mostly in the MI phase in molluscs [23]. Cell cycle arrest in eggs is found in amphibian Rana pipens oocytes and is regulated by a cytostatic factor (CSF) closely related to the MAPK pathway [24]. C-Mos was first identified as part of the CSF in the Xenopus tropicalis in 1989 [25]. Several studies have pointed to an important function for the C-Mos-ERK (extracellular signal-associated kinase) pathway in oocyte arrest [26,27].
A rich variety of sex types have been identified in shellfish, such as hermaphroditism, male prematurity and sexual reversal [28,29], and the high plasticity of the gonads indicates that shellfish are ideal species for studying sex systems. Hyriopsis cumingii, a freshwater bivalve mollusc, is an important pearl-bearing mussel endemic to China, with a high pearl-producing performance, making it a highly desirable economic shellfish for aquaculture. It has been shown that male H. cumingii have a higher pearl production performance than females [30]. However, no mechanism for sex determination in H. cumingii has been identified, and no heteromorphic chromosomes have been found, so the genes involved in regulating sex and gametogenesis in H. cumingii are the focus of research.
In this study, C-Mos was identified. The expression characteristics of C-Mos in different tissues and at different ages was analysed. We also characterised the part played by C-Mos in the gonads by in situ hybridization and RNA interference (RNAi). The results indicate an importance of C-Mos for H. cumingii gonadal development and oocyte maturation.

2. Materials and Methods

2.1. Experimental Material and Sample Collection

Juvenile and sexually mature H. cumingii used in this study were taken from the Wuyi experimental farm in Jinhua, Zhejiang Province. After arrival at the laboratory, the H. cumingii were divided into tanks and kept at a water temperature of 26 °C ± 2 °C for 8 days. The tissues (liver, gill, adductor, mantle, foot and gonad) were collected from 36-month-old H. cumingii (three females and three males). Gonadal tissues with three biological replicates of each sample were collected from mussels between 1 and 8 months of age, and between 1 and 3 years old. All samples for RNA extraction were taken and rapidly frozen in a tube using liquid nitrogen before being stored at −80 °C. Then, 5 mm blocks of gonadal tissue were extracted from 36-month-old H. cumingii to be fixed in paraformaldehyde and used to make paraffin sections.

2.2. Obtaining RNA and cDNA

Total tissue RNA was obtained with the Trizol method, 1% agarose gel electrophoresis was used to detect whether the RNA was degraded and nanodrop2000 (Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the RNA concentration and the 260/280. The RNA was reverse transcribed to cDNA in vitro using the PrimeScript RT Reagent Kit with gDNA Eraser kit (TaKaRa, Dalian, Japan) according to the manufacturer’s instructions and then diluted fivefold and stored at −40 °C for PCR and quantitative real-time PCR (qRT-PCR).

2.3. The Full-Length Cloning of C-Mos and Its Sequence Analysis

Partial sequence information for C-Mos was obtained from the transcriptome library, and the 3′ race primers (Table 1) were designed according to this sequence. The SMARTer RACE 5′/3′ Kit (Clontech, Mountainview, CA, USA) was used for 3′ RACE cloning of C-Mos according to the instructions. The PCR product was cloned to the pmd19-T vector. The plasmid was transfected into receptor E. coli dh5α and amplified with AMP+ liquid medium at 37 °C and 200 rmp for 6 h. Then, 100 µL of the amplified broth was evenly applied to blue and white spot medium and cultured. The white spots were selected for sequencing.
NCBI ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder/) (accessed on 15 March 2023) was used to predict the ORF of C-Mos; analysis of basic physicochemical properties of proteins was undertaken using the ProtParam tool (https://web.expasy.org/aprotparam/) (accessed on 15 March 2023); SMART was used to predict the kind of protein domain and its position on the sequence (http://smart.embl-heidelberg.de/smart) (accessed on 15 March 2023); tertiary structures were predicted using the SWISS-MODEL program (https://swissmodel.expasy.org/) (accessed on 15 March 2023); the different amino acid sequences were analysed for homology using ClustalW in BioEdit 7.0.9.0 (BioEdit, Manchester, UK); and phylogenetic trees were constructed using Neighbour Joining (NJ) and repeated 1000 times to confirm confidence values among species in the Mega 11.0 program (Supplementary Table S1).

2.4. Quantitative Real-Time PCR

Biological triplicates cDNAs were mixed together and used for qRT-PCR. qRT-PCR was performed using the Bio-Rad real-time CFX96 PCR system (Bio-Rad, Hercules, CA, USA). The EFl-α was used as a reference gene. The qRT-PCR procedure is based on techniques from Gu [31]. Both the target and reference genes were analyzed in triplicate. The 2−∆∆CT method of calculating relative expressions was used and Prism 8.0 (GraphPad, San Diego, CA, USA) was used to produce the plots. The relative expression of the other groups was determined by using the expression of the control group as 1 in each graph. In cases where a control group was not available, the lowest expression value among all data sets was used as the reference value of 1.

2.5. Preparation of Paraffin Sections and In Situ Hybridization (ISH)

After sampling, the tissue was immediately placed into a 1.5 mL Eppendorf tube containing 1 mL of 4% paraformaldehyde. The tissue was soaked at 4 °C for 2 h prior to starting the dehydration process. The dehydration steps included soaking the tissue in 70% ethanol for 2 h, 80% ethanol for 30 min, 90% ethanol for 15 min, 95% ethanol for 10 min, and absolute ethanol twice for 10 min and 5 min, respectively. Next, the tissue was rendered transparent through immersion in a solution of xylene and absolute ethanol (1:1) for 20 min, followed by two immersions in xylene for 5 min and 2 min, respectively. After this, the tissue was embedded in a tissue embedding cassette and kept in a solution of paraffin and xylene (1:1) at 65 °C for 1 h, followed by another 1 h incubation in paraffin solution at 65 °C and a final incubation for 30 min in paraffin solution at 65 °C. Finally, the tissue was allowed to cool and then sectioned.
The probe template was synthesised by adding a T7 promoter to the 5′ end of a gene specific reverse primer (Table 1), amplified by PCR, purified, and then used for in vitro transcription. It was reverse transcribed as an antisense probe in vitro using the T7 High Efficiency Transcription Kit (Transgen, Beijing, China) and DIG RNA Labeling Mix. The probes were purified and then stored at −80 °C. After removal of paraffin, in situ hybridization was performed according to the instructions of the Enhanced Sensitive ISH Assay Kit II (Boster, Wuhan, China), catalog number MK1032. The thickness of the paraffin sections used for in situ hybridization was 6 µm. The main steps in ISH were as follows: the tissue was digested for 60 s using freshly diluted pepsin (two drops of pepsin per 1 mL of 3% citric acid), then washed with 0.5 M PBS at room temperature, and the procedure was repeated three times. A wet cassette was arranged using 20% glycerol moistened cotton balls, and the next steps were carried out in the wet cassette. Prehybridization solution was added and it was incubated for 3 h at 37 °C. The sections of the experimental group were then added with a concentration of 1 ng/µL of the probe, and the control group was not added. The coverslip was put in place on the section and it was incubated overnight (16 h) at 37 °C. Next, the tissue was washed at 37 °C with 2 × SSC for 5 min, repeated once. It was washed at 37 °C with 0.5 × SSC for 15 min, then at 37 °C with 0.2 × SSC for 15 min. The closure solution was added dropwise at 37 °C for 30 min. Biotinylated murine anti-digoxin was added dropwise, and it was incubated at 37 °C for 1 h. The tissue was washed with 0.5 M PBS at 37 °C for 5 min, repeated four times. SABC-AP was added dropwise, at 37 degrees for 30 min. Then, 0.01 M TBS was washed at 37 °C for 5 min, repeated four times. Finally, BCIP/NBT was added dropwise for colour development at 37 °C for 5 min, rinsed well with distilled water, and the film sealed. The tissue after in situ hybridization was observed using the microscope (Leica DM 2500, Leica, Wetzlar, Germay) photographed with a Leica DFC450, and the experimental results observed under a visible light source.

2.6. RNAi Assay

Three pairs of double-stranded RNA (dsRNA) primers G1, G2, and G3, were designed using primer 5.0 in the ORF region of the C-Mos (Table 1). The amplified regions of these primers did not contain those of the qRT-PCR primers for C-Mos. The length of the G1 interference chain was 518 bp, the length of the G2 interference chain was 437 bp and the length of the G3 interference chain was 470 bp. The green fluorescent protein (GFP) sequence, which had no similarity to the C-Mos of the H. cumingii, was selected as the interference chain for the negative control group (NG). The synthesis of dsRNA was based on the method of Wang [32]. dsRNA concentration was adjusted to 400 ng/µL working concentration and stored at −80 °C.
12-month-old H. cumingii with a shell length of 7 cm was selected for RNAi experiments. The gonads of H. cumingii were aspirated using a syringe, then applied to slides and finally observed with a microscope (Leica DM 2500) to pre-identify males and females. The mussels were randomly assigned to four groups (G1 group, G2 group, G3 group and NG group), each group having 30 mussels. Each mussel was injected with 50 µL of interfering chain at a concentration of 400 ng/µL using a 100 µL syringe; the location of the injection was the adductor. At the time of sampling, 10 gonadal tissue samples were collected from each group at 12, 24 and 48 h post-injection and used to make paraffin sections and for RNA extraction. After the paraffin sections had been stained with haematoxylin and eosin to identify the sex of the H. cumingii, three female gonads were randomly selected from each group at each time point to extract RNA, reverse transcribe it into cDNA and then perform qRT-PCR. The expression levels of C-Mos, ERK and P90rsk (90-kDa ribosomal S6 protein kinase) were measured using qRT-PCR. The primers are listed in Table 1.

2.7. Statistical Analysis

An independent samples t-test and one-way analysis of variance ANOVA was conducted using SPSS 26 software (IBM, Chicago, IL, USA) to verify whether there was a significant difference between the data sets. p < 0.05 was regarded as a significant difference, indicated by an asterisk. p < 0.01 was regarded as a highly significant difference, indicated by two asterisks. All data obtained were plotted as mean ± standard deviation.

3. Results

3.1. Full-Length and Sequence Characteristics of the cDNA of C-Mos

This study clones the C-Mos cDNA sequence from H. cumingii, with a 5′ UTR length of 144 bp, a 3′ UTR length of 923 bp and an ORF region length of 1146 bp, encoding 381 amino acids (Figure 1), the GenBank accession number is OQ161186. The calculated molecular mass of the C-Mos protein is predicted to be 43.07 kDa, with an isoelectric point of 8.63 and a hydrophilicity coefficient of −0.417. According to the analysis, it is a hydrophilic protein. However, it is assumed that the C-Mos protein is an intracellular protein as it possesses neither a transmembrane structure nor signal peptide properties. The C-Mos protein has a serine/threonine protein kinase catalytic (S-TKC) structural domain (111-374 aa), which possesses ATP-binding capacity and serine/threonine protein kinase activity (Figure 2). The protein tertiary structure of the C-Mos was predicted using SWISS-MODEL based on the 1k9a. 2. A template, which shared 31.13% identity with the C-Mos protein. The alpha helix accounted for 27%, the beta strand for 15% and irregular curl for 23% (Figure 3).
Sequence alignment between species was analysed using BioEdit (Figure 4). The C-Mos protein is conserved between the H. cumingii and other species. The highest homology was with Dreissena polymorpha (XP_052244251.1), at 62.23%. Homology with Mizuhopecten yessoensis (XP_021343629.1) and Patella vulgata (XP_050403259.1) was 60.07% and 59.78%. The high level of resemblance (up to 67.80%) between the S-TKC structural domain of the C-Mos protein of many organisms suggests evolutionary and structural conservation, thus predicting the functional conservation of C-Mos in protein kinases. The results of the phylogenetic tree show that H. cumingii are clustered on one branch with other bivalves. The vertebrates are also clustered on one branch. Among the bivalves, the evolutionary distance of H. cumingii is medium (Figure 5).

3.2. Expression Analysis of C-Mos in Different Tissues of the H. cumingii

The expression of C-Mos was examined by qRT-PCR across different tissues of H. cumingii (Figure 6). There were significant differences in C-Mos expression among H. cumingii tissues (p < 0.05). In males, C-Mos was expressed at the highest level in the adductor. In females, C-Mos was most highly expressed in the female gonads and significantly higher than in the male gonads and all other tissues (p < 0.01).

3.3. Analysis of C-Mos Expression at Different Ages in the H. cumingii

The expression of C-Mos in the gonads of H. cumingii at different ages was detected using qRT-PCR. The expression of C-Mos showed a gradual increase in 12 to 36-year-old H. cumingii, with the highest expression at age three. It was higher in females than in males at 12, 24 and 36 months old (p < 0.01), and almost absent in males (Figure 7).

3.4. Analysis of C-Mos Relative Expression during the Juvenile Period of the H. cumingii

The expression of C-Mos in the gonads of H. cumingii at different months of age was detected using qRT-PCR. In the early gonadal development of juvenile H. cumingii (1–8 months old), the expression of C-Mos showed an initial increase followed by a decrease over time. At 4, 5 and 6 months of age, a marked increase in the expression of C-Mos was detected (p < 0.05), when the gonads are differentiated in the H. cumingii, reaching a peak in 6 months of age (Figure 8).

3.5. Localization of the C-Mos

The sections were observed and the localization of C-Mos in the gonad was determined after in situ hybridization, with the signal stronger in the female gonads than in the male gonads, whereas no signal was found in either negative control (Figure 9). Clear hybridization signals were found by in situ hybridization in the oocytes and the nucleus of the oocyte and oogonium, and a small number of hybridization signals were found in the follicular wall of the male gonads; no signals were found in other areas.

3.6. RNAi of C-Mos

Interference chains G1, G2, G3 and GFP were injected into the adductor of each mussel of groups G1, G2, G3 and NG, respectively. Relative expression of C-Mos in female gonads of H. cumingii following RNAi experiments was detected using qRT-PCR. In comparison with the NG group, the G2 and the G3 groups showed a significant interference effect. According to the previous experimental experience, not every interference chain can produce interference effect. In this experiment, the G1 interference chain has no interference effect (Figure 10). The interference rates in the G2 group were 58.59%, 40.19% and 69.89% at 12 h, 24 h, and 48 h, respectively. After 12 h, 24 h, and 48 h, the G3 group experienced interference rates of 32.07%, 19.31%, and 39.72% respectively. The G2 group was chosen to explore the function of C-Mos based on the effect of interference.

3.7. Expression Analysis of ERK and P90rsk after RNAi

To assess the ability of C-Mos to function in H. cumingii, the expression levels of ERK and P90rsk in female gonads of the G2 group and the NG group were probed 48 h after injection (Figure 11). Compared to the NG group, the interference rate of ERK at 48 h was 31.83% and the interference rate of P90rsk at 48 h was 14.12%.

4. Discussion

The C-Mos gene was successfully cloned in this experiment. Its full length of 2213 bp encoded 381 amino acids (Figure 1), and a protein structure prediction analysis revealed that it contained an S-TKC structural domain (111-374 aa) (Figure 2) with conserved catalytic activity. C-Mos is a serine/threonine kinase whose main role is to regulate intracellular activity by phosphorylating or dephosphorylating substrates. An essential piece of the catalytic structural domain is 253D, a highly conserved residue positioned in the central region. A glycine-rich segment of the S-TKC structural domain is thought to participate in the ATP binding process. The S-TKC structural domain is conserved among various species [33,34], and participates in reproductive processes in a wide range of species. In Atrina pectinata, tssk plays a role in spermatogenesis [34] and the CDK of Dendrobium candidum has a function in regulating the embryonic cell cycle [35]. There was a high conservation of C-Mos across species, which implies that in vertebrates and molluscs it may share similar functions. The results of the phylogenetic tree showed that H. cumingii are clustered on one branch with other bivalves. The vertebrates are also clustered on one branch. This shows that H. cumingii has a high homology with bivalves and a low homology with vertebrates. Among the bivalves, the evolutionary distance of H. cumingii was medium, indicating that the evolutionary extent of the C-Mos protein in the mussel is intermediate in bivalves.
In the present study, the C-Mos gene was expressed in the foot, liver, gill, mantle, gonad, and adductor of the H. cumingii, with a high expression specifically in the female gonads and highly significant differences compared to other tissues (p < 0.01). This reveals a possible function in the female gonads. In mice, C-Mos was expressed at low levels in kidney, brain, mammary gland, and placenta, and at high levels in gonads [36], similar to the present results. The same result was also found in Clytia [37]. Past studies have found that the MAPK cascade is a participant that helps to control the cell cycle of mammalian oocytes, particularly spindle assembly and microtubule organization during mammalian oocyte meiosis [38], controlling the oocyte cycle and promoting oocyte maturation [39]. The precocious translation of C-Mos can also facilitate the meiotic maturation of oocytes [40]. The expression of C-Mos showed a gradual increase at 1, 2 and 3 years of age, with the highest expression at age 3 and with a highly significant difference in expression between males and females (p < 0.01). The gonads of the H. cumingii complete their differentiation at the age of one year and become sexually mature at 3 years old. This pattern of expression of C-Mos in H. cumingii suggests that it might have an important contribution in the maturation to the gonads. To examine the influence of C-Mos in the gonads of H. cumingii further, we examined the expression of C-Mos in the gonads of juvenile H. cumingii. The gonads of H. cumingii in this study showed a gradual increase in C-Mos expression from 1 to 6 months of age, reaching a maximum in 6 months of age and gradually decreasing from 7 to 8 months of age. Primordial germ cells (PGCs) appeared in the tissues of H. cumingii at 4 months of age [41]. C-Mos may be implicated in the H. cumingii PGCs’ proliferation due to its high expression between the ages of 4 and 6 months. In Rana esculenta, the MAPK pathway is able to regulate spermatogonia proliferation [42]. In zebrafish, the MAPK pathway can promote the proliferation of PGCs [43]. The results suggest that the C-Mos may be involved in the proliferation of PGCs in the H. cumingii through the regulation of the MAPK pathway.
Oocyte maturation goes through the physiological process of GVBD. This is accompanied by chromatin aggregation, nuclear membrane rupture and the inability to carry out physiological functions such as transcription and shearing. Therefore, residual maternal transcripts in cells can drive the oocyte maturation process. [44]. The translation timing of maternal transcripts of C-Mos, which accumulated gradually during the GV phase, are controlled by the combined action of factors such as Gld2 (germline development 2) and PARN (poly(A) ribonuclease) [45], which allows it to be expressed during meiosis. Our study clearly detected hybridization signals of C-Mos in oocytes, oocyte nucleus, and oogonium. A small number of hybridization signals were found in the follicular wall of the male gonads by in situ hybridization, suggesting that C-Mos may be involved in the oocyte development process of H. cumingii. In vertebrates, at MII stage, C-Mos expression in oocytes reaches its peak [16]. In zebrafish, transcripts of C-Mos were found to be detectable throughout the oocyte during early oogenesis [46].
In the absence of C-Mos proteins, sea star oocytes enter a repetitive embryonic mitotic cycle after meiosis I, and its rein-statement restores meiosis II and subsequent cell cycle arrest [47]. Here we knock down C-Mos by RNAi to examine the possible function of C-Mos in gonadal development. In this experiment, the interfering chain G2 group had the best interference effect at 48 h post-injection, with a 69.89% C-Mos gene interference rate compared to the NG group. Additionally, we measured both ERK and P90rsk expression, the genes of the MAPK pathway which mediates oocyte arrest, in order to better understand the function of C-Mos. ERK is a key kinase of the classical MAPK pathway and plays a major part in mammalian reproduction, such as in gametogenesis [48]. ERK deficiency leads to abnormal reproductive function, the knockout of ERK in mice results in abnormal spindle assembly [38], and the inhibition of ERK results in suppressed cell growth of PGCs [49]. In meiosis, P90rsk phosphorylates Erp1 [50,51] and plays a major part in the MAPK pathway [52]. The removal of the P90rsk protein from oocytes results in the inability of C-Mos to arrest oocytes [53]. In porcine oocytes, MAPK and P90rsk are dephosphorylated almost simultaneously after fertilization. The repression of the MAPK pathway by U0126 (MAPK kinase inhibitor) results in the release of 41.44% of MII-arrested oocytes from arrest [54]. In Asterina pectinifera, P90rsk is necessary for oocyte arrest and is the sole substrate of MAPK necessary for G1 arrest [55]. However, in mice although the MAPK pathway is associated with oocyte arrest, it is not mediated by P90rsk [56]. In the present experiment, interference with the upstream C-Mos gene resulted in the differential downregulation of both ERK and P90rsk, predicting that C-Mos has a role in regulating the MAPK pathway and the oocyte cycle in H. cumingii.

5. Conclusions

The C-Mos gene was cloned from the H. cumingii. An analysis of C-Mos expression in different tissues and gonadal tissues at different ages suggested that C-Mos may be involved in the gonadal development of the H. cumingii. In situ hybridization results showed that clear hybridization signals were found in the oocytes, oocyte nucleus and oogonium, and a small number of hybridization signals were found in the follicular wall of the male gonads. The results of RNAi experiments suggested that C-Mos had an association with the MAPK pathway and P90rsk in the H. cumingii. In conclusion, C-Mos is involved in the regulation of gonadal development in H. cumingii, but the exact process needs to be further investigated.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom13060931/s1, Table S1: List of amino acid sequences used for multiple alignment analysis and NJ phylogenetic tree of C-Mos protein in H. cumingii.

Author Contributions

Conceptualization, Z.L. and X.J.; Formal analysis, Z.L., Y.M. and P.W.; Funding acquisition, G.W.; Investigation, Z.L., X.J. and Y.G.; Methodology, L.C. and G.W.; Resources, G.W.; Supervision, L.C. and G.W.; Visualization, X.J. and X.S.; Writing—original draft, Z.L. and X.J. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Key R&D Program of China (2022YFD2400700), the earmarked fund for CARS (CARS-49) and the National Natural Science Foundation of China (grant no. 31772835). Supported by China Agriculture Research System of MOF and MARA.

Institutional Review Board Statement

No endangered or protected species were involved in this study. The study followed the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Shanghai Ocean University, China.

Informed Consent Statement

Not applicable.

Data Availability Statement

All experimental data for this article can be obtained by contacting the corresponding authors.

Acknowledgments

Thanks for the comments on the improvement of this experiment and the revision of the manuscript by Guiling Wang.

Conflicts of Interest

The authors state that there is no conflict of interest.

References

  1. Sun, Y.; Liu, W.-Z.; Liu, T.; Feng, X.; Yang, N.; Zhou, H.-F. Signaling Pathway of MAPK/ERK in Cell Proliferation, Differentiation, Migration, Senescence and Apoptosis. J. Recept. Signal Transduct. 2015, 35, 600–604. [Google Scholar] [CrossRef] [PubMed]
  2. Shaul, Y.D.; Seger, R. The MEK/ERK Cascade: From Signaling Specificity to Diverse Functions. Biochim. Biophys. Acta BBA—Mol. Cell Res. 2007, 1773, 1213–1226. [Google Scholar] [CrossRef] [PubMed]
  3. Shibuya, E.K.; Boulton, T.G.; Cobb, M.H.; Ruderman, J.V. Activation of P42 MAP Kinase and the Release of Oocytes from Cell Cycle Arrest. EMBO J. 1992, 11, 3963–3975. [Google Scholar] [CrossRef]
  4. Tachibana, K. MAP Kinase Links the Fertilization Signal Transduction Pathway to the G1/S-Phase Transition in Starfish Eggs. EMBO J. 1997, 16, 4333–4339. [Google Scholar] [CrossRef] [PubMed]
  5. Liang, C.-G.; Su, Y.-Q.; Fan, H.-Y.; Schatten, H.; Sun, Q.-Y. Mechanisms Regulating Oocyte Meiotic Resumption: Roles of Mitogen-Activated Protein Kinase. Mol. Endocrinol. 2007, 21, 2037–2055. [Google Scholar] [CrossRef]
  6. Kondoh, E.; Tachibana, K.; Deguchi, R. Intracellular Ca2+ Increase Induces Post-Fertilization Events via MAP Kinase Dephosphorylation in Eggs of the Hydrozoan Jellyfish Cladonema pacificum. Dev. Biol. 2006, 293, 228–241. [Google Scholar] [CrossRef] [PubMed]
  7. Gould, M.C.; Stephano, J.L. MAP Kinase, Meiosis, and Sperm Centrosome Suppression in Urechis caupo. Dev. Biol. 1999, 216, 348–358. [Google Scholar] [CrossRef] [PubMed]
  8. Almog, T.; Naor, Z. The Role of Mitogen Activated Protein Kinase (MAPK) in Sperm Functions. Mol. Cell. Endocrinol. 2010, 314, 239–243. [Google Scholar] [CrossRef]
  9. Bogani, D.; Siggers, P.; Brixey, R.; Warr, N.; Beddow, S.; Edwards, J.; Williams, D.; Wilhelm, D.; Koopman, P.; Flavell, R.A.; et al. Loss of Mitogen-Activated Protein Kinase Kinase Kinase 4 (MAP3K4) Reveals a Requirement for MAPK Signalling in Mouse Sex Determination. PLoS Biol. 2009, 7, e1000196. [Google Scholar] [CrossRef]
  10. Matsuyama, M.; Mizusaki, H.; Shimono, A.; Mukai, T.; Okumura, K.; Abe, K.; Shimada, K.; Morohashi, K. A Novel Isoform of Vinexin, Vinexin γ, Regulates Sox9 Gene Expression through Activation of MAPK Cascade in Mouse Fetal Gonad: Vinexin in Gonadal Sex Differentiation. Genes Cells 2005, 10, 421–434. [Google Scholar] [CrossRef]
  11. Matsubara, Y.; Kawasaki, I.; Urushiyama, S.; Yasuda, T.; Shirakata, M.; Iino, Y.; Shibuya, H.; Yamanashi, Y. The Adaptor-like Protein ROG-1 Is Required for Activation of the Ras-MAP Kinase Pathway and Meiotic Cell Cycle Progression in Caenorhabditis elegans. Genes Cells 2007, 12, 407–420. [Google Scholar] [CrossRef] [PubMed]
  12. Lee, M.-H.; Ohmachi, M.; Arur, S.; Nayak, S.; Francis, R.; Church, D.; Lambie, E.; Schedl, T. Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling in Caenorhabditis elegans Germline Development. Genetics 2007, 177, 2039–2062. [Google Scholar] [CrossRef] [PubMed]
  13. Masui, Y. From Oocyte Maturation to the in Vitro Cell Cycle: The History of Discoveries of Maturation-Promoting Factor (MPF) and Cytostatic Factor (CSF). Differentiation 2001, 69, 1–17. [Google Scholar] [CrossRef] [PubMed]
  14. Gotoh, Y.; Nishida, E. Activation Mechanism and Function of the MAP Kinase Cascade. Mol. Reprod. Dev. 1995, 42, 486–492. [Google Scholar] [CrossRef]
  15. Valencia, C.; Pérez, F.A.; Matus, C.; Felmer, R.; Arias, M.E. Activation of Bovine Oocytes by Protein Synthesis Inhibitors: New Findings on the Role of MPF/MAPKs. Biol. Reprod. 2021, 104, 1126–1138. [Google Scholar] [CrossRef]
  16. Gebauer, F.; Richter, J.D. Synthesis and Function of Mos: The Control Switch of Vertebrate Oocyte Meiosis. Bioessays 1997, 19, 23–28. [Google Scholar] [CrossRef]
  17. Sagata, N.; Daar, I.; Oskarsson, M.; Showalter, S.D.; Vande Woude, G.F. The Product of the Mos Proto-Oncogene as a Candidate “Initiator” for Oocyte Maturation. Science 1989, 245, 643–646. [Google Scholar] [CrossRef]
  18. Cao, S.-F.; Li, D.; Yuan, Q.; Guan, X.; Xu, C. Spatial and Temporal Expression of C-Mos in Mouse Testis during Postnatal Development. Asian J. Androl. 2008, 10, 277–285. [Google Scholar] [CrossRef]
  19. Funayama, S.; Matsumoto, T.; Kodera, Y.; Awaji, M. A Novel Peptide Identified from Visceral Ganglia Induces Oocyte Maturation, Spermatozoa Active Motility, and Spawning in the Pen Shell Atrina pectinata. Biochem. Biophys. Res. Commun. 2022, 598, 9–14. [Google Scholar] [CrossRef]
  20. Sinha, P.B.; Tesfaye, D.; Rings, F.; Hossien, M.; Hoelker, M.; Held, E.; Neuhoff, C.; Tholen, E.; Schellander, K.; Salilew-Wondim, D. MicroRNA-130b Is Involved in Bovine Granulosa and Cumulus Cells Function, Oocyte Maturation and Blastocyst Formation. J. Ovarian Res. 2017, 10, 37. [Google Scholar] [CrossRef]
  21. Wu, X.-J.; Thomas, P.; Zhu, Y. Pgrmc1 Knockout Impairs Oocyte Maturation in Zebrafish. Front. Endocrinol. 2018, 9, 560. [Google Scholar] [CrossRef] [PubMed]
  22. Quiroga Artigas, G.; Lapébie, P.; Leclère, L.; Bauknecht, P.; Uveira, J.; Chevalier, S.; Jékely, G.; Momose, T.; Houliston, E. A G Protein–Coupled Receptor Mediates Neuropeptide-Induced Oocyte Maturation in the Jellyfish Clytia. PLoS Biol. 2020, 18, e3000614. [Google Scholar] [CrossRef] [PubMed]
  23. Masui, Y. 8—Meiotic Arrest in Animal Oocytes. In Biology of Fertilization; Metz, C.B., Monroy, A., Eds.; Academic Press: Cambridge, MA, USA, 1985; pp. 189–219. ISBN 978-0-12-492601-1. [Google Scholar]
  24. Masui, Y. A Cytostatic Factor in Amphibian Oocytes: Its Extraction and Partial Characterization. J. Exp. Zool. 1974, 187, 141–147. [Google Scholar] [CrossRef] [PubMed]
  25. Sagata, N.; Watanabe, N.; Vande Woude, G.F.; Ikawa, Y. The C-Mos Proto-Oncogene Product Is a Cytostatic Factor Responsible for Meiotic Arrest in Vertebrate Eggs. Nature 1989, 342, 512–518. [Google Scholar] [CrossRef]
  26. Kajiura-Kobayashi, H.; Yoshida, N.; Sagata, N.; Yamashita, M.; Nagahama, Y. The Mos/MAPK Pathway Is Involved in Metaphase II Arrest as a Cytostatic Factor but Is Neither Necessary nor Sufficient for Initiating Oocyte Maturation in Goldfish. Dev. Genes Evol. 2000, 210, 416–425. [Google Scholar] [CrossRef]
  27. Yamamoto, D.S.; Tachibana, K.; Sumitani, M.; Lee, J.M.; Hatakeyama, M. Involvement of Mos–MEK–MAPK Pathway in Cytostatic Factor (CSF) Arrest in Eggs of the Parthenogenetic Insect, Athalia rosae. Mech. Dev. 2008, 125, 996–1008. [Google Scholar] [CrossRef]
  28. Collin, R. Phylogenetic Patterns and Phenotypic Plasticity of Molluscan Sexual Systems. Integr. Comp. Biol. 2013, 53, 723–735. [Google Scholar] [CrossRef]
  29. Otani, A.; Nakajima, T.; Okumura, T.; Fujii, S.; Tomooka, Y. Sex Reversal and Analyses of Possible Involvement of Sex Steroids in Scallop Gonadal Development in Newly Established Organ-Culture Systems. Zool. Sci. 2017, 34, 86. [Google Scholar] [CrossRef]
  30. Zhao, Y.; Bai, Z.; Fu, L.; Liu, Y.; Wang, G.; Li, J. Comparison of Growth and Pearl Production in Males and Females of the Freshwater Mussel, Hyriopsis cumingii, in China. Aquacult. Int. 2013, 21, 1301–1310. [Google Scholar] [CrossRef]
  31. Gu, Y.; Liu, M.; Wang, Y.; Huo, Y.; Liu, Z.; Jin, W.; Wang, G. Identification and Functional Analysis of MAPKAPK2 in Hyriopsis cumingii. Genes 2022, 13, 2060. [Google Scholar] [CrossRef]
  32. Wang, Y.; Wang, X.; Ge, J.; Wang, G.; Li, J. Identification and Functional Analysis of the Sex-Determiner Transformer-2 Homologue in the Freshwater Pearl Mussel, Hyriopsis cumingii. Front. Physiol. 2021, 12, 704548. [Google Scholar] [CrossRef] [PubMed]
  33. Qu, Y.; Zhou, M.; Peng, L.; Li, J.; Yan, J.; Yang, P.; Feng, H. Molecular Cloning and Characterization of IKKε Gene from Black Carp Mylopharyngodon Piceus. Fish Shellfish. Immunol. 2015, 47, 122–129. [Google Scholar] [CrossRef] [PubMed]
  34. Li, H.-H.; Kong, L.-F.; Yu, R.; Yu, H.; Li, Q. Characterization, Expression, and Functional Analysis of Testis-Specific Serine/Threonine Kinase 1 (Tssk1) in the Pen Shell Atrina pectinata. Invertebr. Reprod. Dev. 2016, 60, 118–125. [Google Scholar] [CrossRef]
  35. Zhang, G.; Song, C.; Zhao, M.-M.; Li, B.; Guo, S.-X. Characterization of an A-Type Cyclin-Dependent Kinase Gene from Dendrobium candidum. Biologia 2012, 67, 360–368. [Google Scholar] [CrossRef]
  36. Propst, F.; Rosenberg, M.P.; Iyer, A.; Kaul, K.; Vande Woude, G.F. C-Mos Proto-Oncogene RNA Transcripts in Mouse Tissues: Structural Features, Developmental Regulation, and Localization in Specific Cell Types. Mol. Cell. Biol. 1987, 7, 1629–1637. [Google Scholar] [CrossRef]
  37. Amiel, A.; Leclère, L.; Robert, L.; Chevalier, S.; Houliston, E. Conserved Functions for Mos in Eumetazoan Oocyte Maturation Revealed by Studies in a Cnidarian. Curr. Biol. 2009, 19, 305–311. [Google Scholar] [CrossRef]
  38. Zhang, Y.-L.; Zheng, W.; Ren, P.; Hu, H.; Tong, X.; Zhang, S.-P.; Li, X.; Wang, H.; Jiang, J.-C.; Jin, J.; et al. Biallelic Mutations in MOS Cause Female Infertility Characterized by Human Early Embryonic Arrest and Fragmentation. EMBO Mol. Med. 2021, 13, e14887. [Google Scholar] [CrossRef]
  39. Fan, H.-Y.; Sun, Q.-Y. Involvement of Mitogen-Activated Protein Kinase Cascade during Oocyte Maturation and Fertilization in Mammals. Biol. Reprod. 2004, 70, 535–547. [Google Scholar] [CrossRef]
  40. Cao, L.-R.; Jiang, J.-C.; Fan, H.-Y. Positive Feedback Stimulation of Ccnb1 and Mos MRNA Translation by MAPK Cascade during Mouse Oocyte Maturation. Front. Cell Dev. Biol. 2020, 8, 609430. [Google Scholar] [CrossRef]
  41. Wang, Y.; Wu, C.; Guo, P.; Wang, G.; Li, J. Molecular Characterization and Expression of the Feminization-1c (Fem-1c) in the Freshwater Mussel (Hyriopsis cumingii). Aquac. Fish. 2018, 3, 6–13. [Google Scholar] [CrossRef]
  42. Ferrara, D.; Palmiero, C.; Branno, M.; Pierantoni, R.; Minucci, S. Testicular Activity of Mos in the Frog, Rana Esculenta: A New Role in Spermatogonial Proliferation. Biol. Reprod. 2004, 70, 1782–1789. [Google Scholar] [CrossRef] [PubMed]
  43. Feng, K.; Cui, X.; Song, Y.; Tao, B.; Chen, J.; Wang, J.; Liu, S.; Sun, Y.; Zhu, Z.; Trudeau, V.L.; et al. Gnrh3 Regulates PGC Proliferation and Sex Differentiation in Developing Zebrafish. Endocrinology 2020, 161, bqz024. [Google Scholar] [CrossRef] [PubMed]
  44. Paronetto, M.P.; Giorda, E.; Carsetti, R.; Rossi, P.; Geremia, R.; Sette, C. Functional Interaction between P90Rsk2 and Emi1 Contributes to the Metaphase Arrest of Mouse Oocytes. EMBO J. 2004, 23, 4649–4659. [Google Scholar] [CrossRef] [PubMed]
  45. Richter, J.D.; Lasko, P. Translational Control in Oocyte Development. Cold Spring Harb. Perspect. Biol. 2011, 3, a002758. [Google Scholar] [CrossRef] [PubMed]
  46. Horie, M.; Kotani, T. Formation of Mos RNA Granules in the Zebrafish Oocyte That Differ from Cyclin B1 RNA Granules in Distribution, Density and Regulation. Eur. J. Cell Biol. 2016, 95, 563–573. [Google Scholar] [CrossRef]
  47. Tachibana, K.; Tanaka, D.; Isobe, T.; Kishimoto, T. C-Mos Forces the Mitotic Cell Cycle to Undergo Meiosis II to Produce Haploid Gametes. Proc. Natl. Acad. Sci. USA 2000, 97, 14301–14306. [Google Scholar] [CrossRef]
  48. Arur, S. Signaling-Mediated Regulation of Meiotic Prophase I and Transition during Oogenesis. In Signaling-Mediated Control of Cell Division; Springer: Cham, Switzerland, 2017; pp. 101–123. [Google Scholar] [CrossRef]
  49. Sorrenti, M.; Klinger, F.G.; Iona, S.; Rossi, V.; Marcozzi, S.; De Felici, M. Expression and Possible Roles of Extracellular Signal-Related Kinases 1-2 (ERK1-2) in Mouse Primordial Germ Cell Development. J. Reprod. Dev. 2020, 66, 399–409. [Google Scholar] [CrossRef]
  50. Nishiyama, T.; Ohsumi, K.; Kishimoto, T. Phosphorylation of Erp1 by P90rsk Is Required for Cytostatic Factor Arrest in Xenopus laevis Eggs. Nature 2007, 446, 1096–1099. [Google Scholar] [CrossRef]
  51. Inoue, D.; Ohe, M.; Kanemori, Y.; Nobui, T.; Sagata, N. A Direct Link of the Mos–MAPK Pathway to Erp1/Emi2 in Meiotic Arrest of Xenopus laevis Eggs. Nature 2007, 446, 1100–1104. [Google Scholar] [CrossRef]
  52. Gross, S.D.; Schwab, M.S.; Taieb, F.E.; Lewellyn, A.L.; Qian, Y.-W.; Maller, J.L. The Critical Role of the MAP Kinase Pathway in Meiosis II in Xenopus Oocytes Is Mediated by P90Rsk. Curr. Biol. 2000, 10, 430–438. [Google Scholar] [CrossRef]
  53. Bhatt, R.R.; Ferrell, J.E. The Protein Kinase P90 Rsk as an Essential Mediator of Cytostatic Factor Activity. Science 1999, 286, 1362–1365. [Google Scholar] [CrossRef] [PubMed]
  54. Fan, H.-Y.; Tong, C.; Lian, L.; Li, S.-W.; Gao, W.-X.; Cheng, Y.; Chen, D.-Y.; Schatten, H.; Sun, Q.-Y. Characterization of Ribosomal S6 Protein Kinase P90rsk during Meiotic Maturation and Fertilization in Pig Oocytes: Mitogen-Activated Protein Kinase-Associated Activation and Localization1. Biol. Reprod. 2003, 68, 968–977. [Google Scholar] [CrossRef] [PubMed]
  55. Mori, M.; Hara, M.; Tachibana, K.; Kishimoto, T. P90Rsk Is Required for G1 Phase Arrest in Unfertilized Starfish Eggs. Development 2006, 133, 1823–1830. [Google Scholar] [CrossRef] [PubMed]
  56. Dumont, J.; Umbhauer, M.; Rassinier, P.; Hanauer, A.; Verlhac, M.-H. P90Rsk Is Not Involved in Cytostatic Factor Arrest in Mouse Oocytes. J. Cell Biol. 2005, 169, 227–231. [Google Scholar] [CrossRef] [PubMed]
Biomolecules 13 00931 g001 550
Figure 1. C-Mos nucleotide sequence and amino acid sequence of H. cumingii. ATG is the start codon and TGA is the stop codon, both are marked with boxes. The shaded area is the amino acid sequence corresponding to the open reading frame, and the wavy part is the S-TKC structural domain (111-374 aa).
Figure 1. C-Mos nucleotide sequence and amino acid sequence of H. cumingii. ATG is the start codon and TGA is the stop codon, both are marked with boxes. The shaded area is the amino acid sequence corresponding to the open reading frame, and the wavy part is the S-TKC structural domain (111-374 aa).
Biomolecules 13 00931 g001
Biomolecules 13 00931 g002 550
Figure 2. The result of the secondary structure prediction of the C-Mos protein in H. cumingii indicates that the C-Mos protein has an S-TKC structural domain (111-374 aa). The C-Mos cDNA sequence encoding 381 amino acids. The number represents the position of the C-Mos protein amino acid.
Figure 2. The result of the secondary structure prediction of the C-Mos protein in H. cumingii indicates that the C-Mos protein has an S-TKC structural domain (111-374 aa). The C-Mos cDNA sequence encoding 381 amino acids. The number represents the position of the C-Mos protein amino acid.
Biomolecules 13 00931 g002
Biomolecules 13 00931 g003 550
Figure 3. The tertiary structure of the C-Mos protein predicted with SWISS-MODEL in H. cumingii, the darker the colour, the higher the level of confidence.
Figure 3. The tertiary structure of the C-Mos protein predicted with SWISS-MODEL in H. cumingii, the darker the colour, the higher the level of confidence.
Biomolecules 13 00931 g003
Biomolecules 13 00931 g004 550
Figure 4. Multiple alignment analysis of C-Mos protein between H. cumingii and other species. The amino acid sequence highlighted in the red box is the S-TKC structural domain of the C-Mos protein of the H. cumingii. The different colours in the image indicate the degree of consistency. The heavier the colour, the greater the degree of agreement.
Figure 4. Multiple alignment analysis of C-Mos protein between H. cumingii and other species. The amino acid sequence highlighted in the red box is the S-TKC structural domain of the C-Mos protein of the H. cumingii. The different colours in the image indicate the degree of consistency. The heavier the colour, the greater the degree of agreement.
Biomolecules 13 00931 g004
Biomolecules 13 00931 g005 550
Figure 5. NJ Phylogenetic tree of C-Mos protein of H. cumingii and other species. The length of the distance scale in the bottom left corner represents an evolutionary distance of 0.1, with larger distances representing higher levels of gene variation compared to the original ancestor.
Figure 5. NJ Phylogenetic tree of C-Mos protein of H. cumingii and other species. The length of the distance scale in the bottom left corner represents an evolutionary distance of 0.1, with larger distances representing higher levels of gene variation compared to the original ancestor.
Biomolecules 13 00931 g005
Biomolecules 13 00931 g006 550
Figure 6. Relative expression of C-Mos genes in different tissues of the H. cumingii. The expression of C-Mos in the gills of male H. cumingii was set as 1 to calculate the relative expression of C-Mos in other tissues. * indicate a significant difference between the data and ** indicate a highly significant difference between the data.
Figure 6. Relative expression of C-Mos genes in different tissues of the H. cumingii. The expression of C-Mos in the gills of male H. cumingii was set as 1 to calculate the relative expression of C-Mos in other tissues. * indicate a significant difference between the data and ** indicate a highly significant difference between the data.
Biomolecules 13 00931 g006
Biomolecules 13 00931 g007 550
Figure 7. Relative expression of C-Mos in gonadal tissues of H. cumingii at different ages. The expression of C-Mos in the 24-month-old male H. cumingii gonads was set as 1 to calculate the relative expression of C-Mos in the gonads of other conditions. ** indicate a highly significant difference between the data.
Figure 7. Relative expression of C-Mos in gonadal tissues of H. cumingii at different ages. The expression of C-Mos in the 24-month-old male H. cumingii gonads was set as 1 to calculate the relative expression of C-Mos in the gonads of other conditions. ** indicate a highly significant difference between the data.
Biomolecules 13 00931 g007
Biomolecules 13 00931 g008 550
Figure 8. Relative expression of C-Mos in gonadal tissues of H. cumingii at different months of age. The expression of C-Mos in the one-month-old H. cumingii was set as 1 to calculate the relative expression of C-Mos in the gonads of other conditions. Different letters (a, b, c, d, e) indicate significant differences between the data (p < 0.05), and the same letters indicate no significant difference between the data (p < 0.05).
Figure 8. Relative expression of C-Mos in gonadal tissues of H. cumingii at different months of age. The expression of C-Mos in the one-month-old H. cumingii was set as 1 to calculate the relative expression of C-Mos in the gonads of other conditions. Different letters (a, b, c, d, e) indicate significant differences between the data (p < 0.05), and the same letters indicate no significant difference between the data (p < 0.05).
Biomolecules 13 00931 g008
Biomolecules 13 00931 g009 550
Figure 9. In situ hybridization of C-Mos in female and male gonads. The hybridization signal is blue–purple. Io: immature oocyte, Mo: mature oocyte, Og: oogonium, Nu: nucleus, Sp: sperm, Fw: follicular wall.
Figure 9. In situ hybridization of C-Mos in female and male gonads. The hybridization signal is blue–purple. Io: immature oocyte, Mo: mature oocyte, Og: oogonium, Nu: nucleus, Sp: sperm, Fw: follicular wall.
Biomolecules 13 00931 g009
Biomolecules 13 00931 g010 550
Figure 10. Relative expression of C-Mos in female gonads of H. cumingii following RNAi experiments. The expression of C-Mos in the gonads of H. cumingii in the NG group was set as 1 to calculate the relative expression of C-Mos in the gonads of other conditions. * indicate that the data is significantly different from the control group (p < 0.05), and ** indicate that the data is highly significantly different from the control group (p < 0.01).
Figure 10. Relative expression of C-Mos in female gonads of H. cumingii following RNAi experiments. The expression of C-Mos in the gonads of H. cumingii in the NG group was set as 1 to calculate the relative expression of C-Mos in the gonads of other conditions. * indicate that the data is significantly different from the control group (p < 0.05), and ** indicate that the data is highly significantly different from the control group (p < 0.01).
Biomolecules 13 00931 g010
Biomolecules 13 00931 g011 550
Figure 11. Relative expression of ERK and P90rsk in female gonads of H. cumingii following RNAi experiments. The expression of ERK in the gonads of H. cumingii in the NG group was set as 1 to calculate the relative expression of ERK and P90rsk in the gonads of other conditions. * indicates a significant difference between the data.
Figure 11. Relative expression of ERK and P90rsk in female gonads of H. cumingii following RNAi experiments. The expression of ERK in the gonads of H. cumingii in the NG group was set as 1 to calculate the relative expression of ERK and P90rsk in the gonads of other conditions. * indicates a significant difference between the data.
Biomolecules 13 00931 g011
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer NameSequence (5′ to 3′)Application
M-OUTERCACCATGTCTAAATCCGGCCCTGTCT3′RACE
M-INNERCAGAAGTTGAACGCAGGGCCAGATTT3′RACE
qPCR-Mos-FAGTATGAACGAACATCGGAGGqRT-PCR
qPCR-Mos-RTGAGAACATCCAAAGTCGCCqRT-PCR
qPCR-P90rsk-FGGTCCTATGGCGTGCTAATGqRT-PCR
qPCR-P90rsk-RGATTCTTCCAGTCTATGCTTGCqRT-PCR
qPCR-ERK -FAGAATCACGGTAGAAGAGGCTqRT-PCR
qPCR-ERK-RTTCCTGTCCATTGGTTGTGTqRT-PCR
qPCR-EFl-αFGGAACTTCCCAGGCAGACTGTGCqRT-PCR
qPCR-EFl-αRTCAAAACGGGCCGCAGAGAATqRT-PCR
ISH-MOS-FTACATACGCCTACCGTGCCCISH
T7 + ISH-MOS-RTAATACGACTCACTATAGGGGTCCCATACGCAACAACCCISH
T7 + RNAi-MOS-F1TAATACGACTCACTATAGGGAGGCTGTGTTTTTGCTCTGARNAi
T7 + RNAi-MOS-R1TAATACGACTCACTATAGGGGCCGCTGGATTTTTCGTAARNAi
T7 + RNAi-MOS-F2TAATACGACTCACTATAGGGACTTGGCGACTTTGGATGTRNAi
T7 + RNAi-MOS-R2TAATACGACTCACTATAGGGCGTTTCAGTTACCGTAGGCARNAi
T7 + RNAi-MOS-F3TAATACGACTCACTATAGGGACTGTGAGTCCCACTGAAAGATRNAi
T7 + RNAi-MOS-R3TAATACGACTCACTATAGGGACTAAGACAGCCAAGGTTTCCRNAi
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Z.; Jin, X.; Miao, Y.; Wang, P.; Gu, Y.; Shangguan, X.; Chen, L.; Wang, G. Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development. Biomolecules 2023, 13, 931. https://doi.org/10.3390/biom13060931

AMA Style

Liu Z, Jin X, Miao Y, Wang P, Gu Y, Shangguan X, Chen L, Wang G. Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development. Biomolecules. 2023; 13(6):931. https://doi.org/10.3390/biom13060931

Chicago/Turabian Style

Liu, Zongyu, Xin Jin, Yulin Miao, Ping Wang, Yang Gu, Xiaozhao Shangguan, Lijing Chen, and Guiling Wang. 2023. "Identification and Characterization of C-Mos in Pearl Mussel Hyriopsis cumingii and Its Role in Gonadal Development" Biomolecules 13, no. 6: 931. https://doi.org/10.3390/biom13060931

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop