Differential Cytotoxicity of Different Sizes of Graphene Oxide Nanoparticles in Leydig (TM3) and Sertoli (TM4) Cells
Abstract
:1. Introduction
2. Results and Discussion
2.1. Synthesis and Characterization of Different Sizes of Graphene Oxide
2.2. GO-100 and GO-20 Inhibit Cell Viability in TM3 and TM4 Cells
2.3. GO-100 and GO-20 Inhibit Proliferation of TM3 and TM4 Cells
2.4. Effect of GO-100 and GO-20 on LDH
2.5. GO-100 and GO-20 Decrease MMP
2.6. GO-100 and GO-20 Induce ROS Generation
2.7. GO-100 and GO-20 Cause DNA Damage in TM3 and TM4 Cells
2.8. ROS Increase Upregulation of Pro-Apoptotic Genes and Downregulation of Anti-Apoptotic Genes in TM3 and TM4 Cells
2.9. GO-100 and GO-20 Nanosheets Reduced Phosphorylation Level of EGFR and AKT
3. Materials and Methods
3.1. Preparation and Characterization of Different Sizes of GO Nanosheets
3.2. Cell Culture, Cell Viability, Cell Proliferation and Measurement of LDH and ROS
3.3. Measurement of 8-Oxo-dG
3.4. Mitochondrial Membrane Potential
3.5. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR) Assay
3.6. Western Blotting
3.7. Statistical Analyses
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Novoselov, K.S.; Geim, A.K.; Morozov, S.V.; Jiang, D.; Zhang, Y.; Dubonos, S.V.; Grigorieva, I.V.; Firsov, A.A. Electric field effect in atomically thin carbon films. Science 2004, 306, 666–669. [Google Scholar] [CrossRef]
- Geim, A.K. Graphene: Status and prospects. Science 2009, 324, 1530–1534. [Google Scholar] [CrossRef]
- Sanchez, M.D.; Chen, P.R.; Reinecke, T.; Muhler, M.; Xia, W. The Role of Oxygen- and Nitrogen-containing Surface Groups on the Sintering of Iron Nanoparticles on Carbon Nanotubes in Different Atmospheres. ChemCatChem 2012, 4, 1997–2004. [Google Scholar] [CrossRef]
- Gurunathan, S.; Kim, J.H. Synthesis, toxicity, biocompatibility, and biomedical applications of graphene and graphene-related materials. Int. J. Nanomed. 2016, 11, 1927–1945. [Google Scholar] [CrossRef]
- Avouris, P.; Dimitrakopoulos, C. Graphene: Synthesis and applications. Mater. Today 2012, 15, 86–97. [Google Scholar] [CrossRef]
- Subrahmanyam, K.S.; Panchakarla, L.S.; Govindaraj, A.; Rao, C.N.R. Simple Method of Preparing Graphene Flakes by an Arc-Discharge Method. J. Phys. Chem. C 2009, 113, 4257–4259. [Google Scholar] [CrossRef]
- Kim, K.S.; Zhao, Y.; Jang, H.; Lee, S.Y.; Kim, J.M.; Kim, K.S.; Ahn, J.H.; Kim, P.; Choi, J.Y.; Hong, B.H. Large-scale pattern growth of graphene films for stretchable transparent electrodes. Nature 2009, 457, 706–710. [Google Scholar] [CrossRef]
- Stankovich, S.; Dikin, D.A.; Piner, R.D.; Kohlhaas, K.A.; Kleinhammes, A.; Jia, Y.; Wu, Y.; Nguyen, S.T.; Ruoff, R.S. Synthesis of graphene-based nanosheets via chemical reduction of exfoliated graphite oxide. Carbon 2007, 45, 1558–1565. [Google Scholar] [CrossRef]
- Kosynkin, D.V.; Higginbotham, A.L.; Sinitskii, A.; Lomeda, J.R.; Dimiev, A.; Price, B.K.; Tour, J.M. Longitudinal unzipping of carbon nanotubes to form graphene nanoribbons. Nature 2009, 458, 872–876. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Peng, C.; Yang, J.; Lv, M.; Liu, R.; He, D.; Fan, C.; Huang, Q. Uniform different sizes graphene oxide nanosheets with low cytotoxicity and high cellular uptake. ACS Appl. Mater. Interfaces 2013, 5, 1761–1767. [Google Scholar] [CrossRef]
- Zhang, Y.; Ali, S.F.; Dervishi, E.; Xu, Y.; Li, Z.; Casciano, D.; Biris, A.S. Cytotoxicity effects of graphene and single-wall carbon nanotubes in neural phaeochromocytoma-derived PC12 cells. ACS Nano 2010, 4, 3181–3186. [Google Scholar] [CrossRef]
- Akhavan, O.; Ghaderi, E.; Akhavan, A. Size-dependent genotoxicity of graphene nanoplatelets in human stem cells. Biomaterials 2012, 33, 8017–8025. [Google Scholar] [CrossRef]
- Chang, Y.; Yang, S.T.; Liu, J.H.; Dong, E.; Wang, Y.; Cao, A.; Liu, Y.; Wang, H. In vitro toxicity evaluation of graphene oxide on A549 cells. Toxicol. Lett. 2011, 200, 201–210. [Google Scholar] [CrossRef]
- Mullick Chowdhury, S.; Dasgupta, S.; McElroy, A.E.; Sitharaman, B. Structural disruption increases toxicity of graphene nanoribbons. J. Appl. Toxicol. 2014, 34, 1235–1246. [Google Scholar] [CrossRef]
- Pelin, M.; Fusco, L.; Leon, V.; Martin, C.; Criado, A.; Sosa, S.; Vazquez, E.; Tubaro, A.; Prato, M. Differential cytotoxic effects of graphene and graphene oxide on skin keratinocytes. Sci. Rep. 2017, 7, 40572. [Google Scholar] [CrossRef] [Green Version]
- Mu, Q.; Su, G.; Li, L.; Gilbertson, B.O.; Yu, L.H.; Zhang, Q.; Sun, Y.P.; Yan, B. Size-dependent cell uptake of protein-coated graphene oxide nanosheets. ACS Appl. Mater. Interfaces 2012, 4, 2259–2266. [Google Scholar] [CrossRef]
- Ou, L.; Lin, S.; Song, B.; Liu, J.; Lai, R.; Shao, L. The mechanisms of graphene-based materials-induced programmed cell death: A review of apoptosis, autophagy, and programmed necrosis. Int. J. Nanomed. 2017, 12, 6633–6646. [Google Scholar] [CrossRef]
- Sasidharan, A.; Swaroop, S.; Chandran, P.; Nair, S.; Koyakutty, M. Cellular and molecular mechanistic insight into the DNA-damaging potential of few-layer graphene in human primary endothelial cells. Nanomed. Nanotechnol. Biol. Med. 2016, 12, 1347–1355. [Google Scholar] [CrossRef]
- Choi, Y.J.; Kim, E.; Han, J.W.; Kim, J.H.; Gurunathan, S. A Novel Biomolecule-Mediated Reduction of Graphene Oxide: A Multifunctional Anti-Cancer Agent. Molecules 2016, 21, 375. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Liu, Y.; Fu, Y.J.; Wei, T.T.; Le Guyader, L.; Gao, G.; Liu, R.S.; Chang, Y.Z.; Chen, C.Y. The triggering of apoptosis in macrophages by pristine graphene through the MAPK and TGF-beta signaling pathways. Biomaterials 2012, 33, 402–411. [Google Scholar] [CrossRef]
- Gurunathan, S.; Han, J.W.; Park, J.H.; Kim, E.; Choi, Y.J.; Kwon, D.N.; Kim, J.H. Reduced graphene oxide-silver nanoparticle nanocomposite: A potential anticancer nanotherapy. Int. J. Nanomed. 2015, 10, 6257–6276. [Google Scholar] [CrossRef]
- Zhang, X.F.; Liu, Z.G.; Shen, W.; Gurunathan, S. Silver Nanoparticles: Synthesis, Characterization, Properties, Applications, and Therapeutic Approaches. Int. J. Mol. Sci. 2016, 17, 1534. [Google Scholar] [CrossRef]
- Braydich-Stolle, L.K.; Lucas, B.; Schrand, A.; Murdock, R.C.; Lee, T.; Schlager, J.J.; Hussain, S.M.; Hofmann, M.C. Silver nanoparticles disrupt GDNF/Fyn kinase signaling in spermatogonial stem cells. Toxicol. Sci. 2010, 116, 577–589. [Google Scholar] [CrossRef]
- Zhang, X.F.; Choi, Y.J.; Han, J.W.; Kim, E.; Park, J.H.; Gurunathan, S.; Kim, J.H. Differential nanoreprotoxicity of silver nanoparticles in male somatic cells and spermatogonial stem cells. Int. J. Nanomed. 2015, 10, 1335–1357. [Google Scholar]
- Hummers, W.S., Jr.; Offeman, R.E. Preparation of graphitic oxide. J. Am. Chem. Soc. 1958, 80, 1339. [Google Scholar] [CrossRef]
- McAllister, M.J.; Li, J.-L.; Adamson, D.H.; Schniepp, H.C.; Abdala, A.A.; Liu, J.; Herrera-Alonso, M.; Milius, D.L.; Car, R.; Prud’homme, R.K. Single sheet functionalized graphene by oxidation and thermal expansion of graphite. Chem. Mater. 2007, 19, 4396–4404. [Google Scholar] [CrossRef]
- Muthoosamy, K.; Bai, R.G.; Abubakar, I.B.; Sudheer, S.M.; Lim, H.N.; Loh, H.S.; Huang, N.M.; Chia, C.H.; Manickam, S. Exceedingly biocompatible and thin-layered reduced graphene oxide nanosheets using an eco-friendly mushroom extract strategy. Int. J. Nanomed. 2015, 10, 1505–1519. [Google Scholar]
- Gurunathan, S.; Han, J.W.; Dayem, A.A.; Eppakayala, V.; Kim, J.H. Oxidative stress-mediated antibacterial activity of graphene oxide and reduced graphene oxide in Pseudomonas aeruginosa. Int. J. Nanomed. 2012, 7, 5901–5914. [Google Scholar] [CrossRef]
- Stobinski, L.; Lesiak, B.; Malolepszy, A.; Mazurkiewicz, M.; Mierzwa, B.; Zemek, J.; Jiricek, P.; Bieloshapka, I. Graphene oxide and reduced graphene oxide studied by the XRD, TEM and electron spectroscopy methods. J. Electron Spectrosc. Relat. Phenom. 2014, 195, 145–154. [Google Scholar] [CrossRef]
- Gurunathan, S.; Kim, J.H. Graphene Oxide-Silver Nanoparticles Nanocomposite Stimulates Differentiation in Human Neuroblastoma Cancer Cells (SH-SY5Y). Int. J. Mol. Sci. 2017, 18, 2549. [Google Scholar] [CrossRef]
- Ferrari, A.C. Raman spectroscopy of graphene and graphite: Disorder, electron–phonon coupling, doping and nonadiabatic effects. Solid State Commun. 2007, 143, 47–57. [Google Scholar] [CrossRef]
- Cho, E.S.; Ruminski, A.M.; Aloni, S.; Liu, Y.-S.; Guo, J.; Urban, J.J. Graphene oxide/metal nanocrystal multilaminates as the atomic limit for safe and selective hydrogen storage. Nat. Commun. 2016, 7, 10804. [Google Scholar] [CrossRef] [Green Version]
- Fiorillo, M.; Verre, A.F.; Iliut, M.; Peiris-Pagés, M.; Ozsvari, B.; Gandara, R.; Cappello, A.R.; Sotgia, F.; Vijayaraghavan, A.; Lisanti, M.P. Graphene oxide selectively targets cancer stem cells, across multiple tumor types: Implications for non-toxic cancer treatment, via “differentiation-based nano-therapy”. Oncotarget 2015, 6, 3553. [Google Scholar] [CrossRef]
- Liao, K.-H.; Lin, Y.-S.; Macosko, C.W.; Haynes, C.L. Cytotoxicity of graphene oxide and graphene in human erythrocytes and skin fibroblasts. ACS Appl. Mater. Interfaces 2011, 3, 2607–2615. [Google Scholar] [CrossRef]
- Choi, Y.-J.; Gurunathan, S.; Kim, J.-H. Graphene Oxide–Silver Nanocomposite Enhances Cytotoxic and Apoptotic Potential of Salinomycin in Human Ovarian Cancer Stem Cells (OvCSCs): A Novel Approach for Cancer Therapy. Int. J. Mol. Sci. 2018, 19, 710. [Google Scholar] [CrossRef]
- Gurunathan, S.; Kim, J.-H. Biocompatible gold nanoparticles ameliorate retinoic acid-induced cell death and induce differentiation in f9 teratocarcinoma stem cells. Nanomaterials 2018, 8, 396. [Google Scholar] [CrossRef]
- Lammel, T.; Boisseaux, P.; Fernández-Cruz, M.-L.; Navas, J.M. Internalization and cytotoxicity of graphene oxide and carboxyl graphene nanoplatelets in the human hepatocellular carcinoma cell line Hep G2. Part. Fibre Toxicol. 2013, 10, 27. [Google Scholar] [Green Version]
- Xu, M.; Zhu, J.; Wang, F.; Xiong, Y.; Wu, Y.; Wang, Q.; Weng, J.; Zhang, Z.; Chen, W.; Liu, S. Improved in vitro and in vivo biocompatibility of graphene oxide through surface modification: Poly (acrylic acid)-functionalization is superior to PEGylation. ACS Nano 2016, 10, 3267–3281. [Google Scholar] [CrossRef]
- Li, Y.; Wu, Q.; Zhao, Y.; Bai, Y.; Chen, P.; Xia, T.; Wang, D. Response of microRNAs to in vitro treatment with graphene oxide. ACS Nano 2014, 8, 2100–2110. [Google Scholar] [CrossRef]
- Gurunathan, S.; Han, J.W.; Eppakayala, V.; Jeyaraj, M.; Kim, J.-H. Cytotoxicity of biologically synthesized silver nanoparticles in MDA-MB-231 human breast cancer cells. Biomed. Res. Int. 2013, 535796. [Google Scholar] [CrossRef]
- Chatterjee, N.; Eom, H.-J.; Choi, J. A systems toxicology approach to the surface functionality control of graphene–cell interactions. Biomaterials 2014, 35, 1109–1127. [Google Scholar] [CrossRef]
- Cho, Y.C.; Pak, P.J.; Joo, Y.H.; Lee, H.-S.; Chung, N. In vitro and in vivo comparison of the immunotoxicity of single-and multi-layered graphene oxides with or without pluronic F-127. Sci. Rep. 2016, 6, 38884. [Google Scholar] [CrossRef]
- Qin, Y.; Zhou, Z.-W.; Pan, S.-T.; He, Z.-X.; Zhang, X.; Qiu, J.-X.; Duan, W.; Yang, T.; Zhou, S.-F. Graphene quantum dots induce apoptosis, autophagy, and inflammatory response via p38 mitogen-activated protein kinase and nuclear factor-κB mediated signaling pathways in activated THP-1 macrophages. Toxicology 2015, 327, 62–76. [Google Scholar] [CrossRef] [PubMed]
- Pelin, M.; Sosa, S.; Prato, M.; Tubaro, A. Occupational exposure to graphene based nanomaterials: Risk assessment. Nanoscale 2018, 10, 15894–15903. [Google Scholar] [CrossRef]
- Tabish, T.A.; Pranjol, M.Z.I.; Jabeen, F.; Abdullah, T.; Latif, A.; Khalid, A.; Ali, M.; Hayat, H.; Winyard, P.G.; Whatmore, J.L. Investigation into the toxic effects of graphene nanopores on lung cancer cells and biological tissues. Appl. Mater. Today 2018, 12, 389–401. [Google Scholar] [CrossRef]
- Valavanidis, A.; Vlachogianni, T.; Fiotakis, C. 8-hydroxy-2′-deoxyguanosine (8-OHdG): A critical biomarker of oxidative stress and carcinogenesis. J. Environ. Sci. Health Part C 2009, 27, 120–139. [Google Scholar] [CrossRef]
- Liu, Y.; Luo, Y.; Wu, J.; Wang, Y.; Yang, X.; Yang, R.; Wang, B.; Yang, J.; Zhang, N. Graphene oxide can induce in vitro and in vivo mutagenesis. Sci. Rep. 2013, 3, 3469. [Google Scholar] [CrossRef] [Green Version]
- Gurunathan, S.; Han, J.W.; Eppakayala, V.; Kim, J.-H. Green synthesis of graphene and its cytotoxic effects in human breast cancer cells. Int. J. Nanomed. 2013, 8, 1015. [Google Scholar] [CrossRef]
- Gurunathan, S.; Han, J.W.; Kim, E.S.; Park, J.H.; Kim, J.-H. Reduction of graphene oxide by resveratrol: A novel and simple biological method for the synthesis of an effective anticancer nanotherapeutic molecule. Int. J. Nanomed. 2015, 10, 2951. [Google Scholar] [CrossRef]
- Zhi, X.; Fang, H.; Bao, C.; Shen, G.; Zhang, J.; Wang, K.; Guo, S.; Wan, T.; Cui, D. The immunotoxicity of graphene oxides and the effect of PVP-coating. Biomaterials 2013, 34, 5254–5261. [Google Scholar] [CrossRef]
- Ma, J.; Liu, R.; Wang, X.; Liu, Q.; Chen, Y.; Valle, R.P.; Zuo, Y.Y.; Xia, T.; Liu, S. Crucial role of lateral size for graphene oxide in activating macrophages and stimulating pro-inflammatory responses in cells and animals. ACS Nano 2015, 9, 10498–10515. [Google Scholar] [CrossRef]
- Redza-Dutordoir, M.; Averill-Bates, D.A. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2016, 1863, 2977–2992. [Google Scholar] [CrossRef]
- Yuan, Y.-G.; Gurunathan, S. Combination of graphene oxide–silver nanoparticle nanocomposites and cisplatin enhances apoptosis and autophagy in human cervical cancer cells. Int. J. Nanomed. 2017, 12, 6537. [Google Scholar] [CrossRef]
- Yoshida, K.; Miki, Y. The cell death machinery governed by the p53 tumor suppressor in response to DNA damage. Cancer Sci. 2010, 101, 831–835. [Google Scholar] [CrossRef] [Green Version]
- Cheng, C.Y.; Wong, E.W.; Lie, P.P.; Li, M.W.; Su, L.; Siu, E.R.; Yan, H.H.; Mannu, J.; Mathur, P.P.; Bonanomi, M. Environmental toxicants and male reproductive function. Spermatogenesis 2011, 1, 2–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hechelhammer, L.; Störkel, S.; Odermatt, B.; Heitz, P.U.; Jochum, W. Epidermal growth factor receptor is a marker for syncytiotrophoblastic cells in testicular germ cell tumors. Virchows Arch. 2003, 443, 28–31. [Google Scholar] [CrossRef]
- Porta, C.; Paglino, C.; Mosca, A. Targeting PI3K/Akt/mTOR signaling in cancer. Front. Oncol. 2014, 4, 64. [Google Scholar] [CrossRef]
- Song, G.; Ouyang, G.; Bao, S. The activation of Akt/PKB signaling pathway and cell survival. J. Cell. Mol. Med. 2005, 9, 59–71. [Google Scholar] [CrossRef] [Green Version]
- Pei, S.; Zhao, J.; Du, J.; Ren, W.; Cheng, H.-M. Direct reduction of graphene oxide films into highly conductive and flexible graphene films by hydrohalic acids. Carbon 2010, 48, 4466–4474. [Google Scholar] [CrossRef]
- Qi, X.; Zhou, T.; Deng, S.; Zong, G.; Yao, X.; Fu, Q. Size-specified graphene oxide sheets: Ultrasonication assisted preparation and characterization. J. Mater. Sci. 2014, 49, 1785–1793. [Google Scholar] [CrossRef]
- Liu, X.; Gan, W.; Zou, Y.; Yang, B.; Su, Z.; Deng, J.; Wang, L.; Cai, J. Elevated levels of urinary markers of oxidative DNA and RNA damage in type 2 diabetes with complications. Oxidative Med. Cell. Longev. 2016, 4323198. [Google Scholar] [CrossRef]
- Gurunathan, S.; Qasim, M.; Park, C.; Yoo, H.; Kim, J.-H.; Hong, K. Cytotoxic Potential and Molecular Pathway Analysis of Silver Nanoparticles in Human Colon Cancer Cells HCT116. Int. J. Mol. Sci. 2018, 19, 2269. [Google Scholar] [CrossRef] [PubMed]
Name of the Sample | Hydrodynamic Diameter in Water | Hydrodynamic Diameter in DMEM Media | Hydrodynamic Diameter in DMEM Media +10% FBS |
---|---|---|---|
GO-100 (Size nm) | 100 | 150 | 120 |
GO-100 (Zeta potential mV) | −50.8 | −22.5 | −13.5 |
GO-20 (Size nm) | 20 | 40 | 30 |
GO-20 (Zeta potential mV) | −40.4 | −12.8 | −8.3 |
Gene | Primer | TM (°C) |
---|---|---|
P53 | F:AGAGACCGTACAGAAGA | 58 |
R:CTGTAGCATGGGATCCTTT | ||
P21 | F:GTTGCTGTCCGGACTACCG | 53 |
R:AAAAACAATGCCACCACTCC | ||
Caspase-3 | F:AGGGGTCATTTATGGGACA | 58 |
R:TACACGGGATCTGTTTCTTTG | ||
R:CAGGCCTGGATGAAGAAGAG | ||
Bax | F:CGAGCTGATCAGAACCATCA | 58 |
R:GAAAAATGCCTTTCCCCTTC | ||
R:AACCATACTCGAACCACATCCT | ||
Bcl-2 | F:TAAGCTGTCACAGAGGGGCT | 58 |
R:TGAAGAGTTCCTCCACCACC | ||
R:AAAGGAGGCTACACCCCAGT | ||
Bak | F: CTC AGA GTT CCA GAC CAT GTT G | 58 |
R: CAT GCT GGT AGA CGT GTA GGG | ||
R:CCTTTGTACCGTTGCATCCT | ||
GAPDH | F:AGGTCGGTGTGAACGGATTTG | 58 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gurunathan, S.; Kang, M.-H.; Jeyaraj, M.; Kim, J.-H. Differential Cytotoxicity of Different Sizes of Graphene Oxide Nanoparticles in Leydig (TM3) and Sertoli (TM4) Cells. Nanomaterials 2019, 9, 139. https://doi.org/10.3390/nano9020139
Gurunathan S, Kang M-H, Jeyaraj M, Kim J-H. Differential Cytotoxicity of Different Sizes of Graphene Oxide Nanoparticles in Leydig (TM3) and Sertoli (TM4) Cells. Nanomaterials. 2019; 9(2):139. https://doi.org/10.3390/nano9020139
Chicago/Turabian StyleGurunathan, Sangiliyandi, Min-Hee Kang, Muniyandi Jeyaraj, and Jin-Hoi Kim. 2019. "Differential Cytotoxicity of Different Sizes of Graphene Oxide Nanoparticles in Leydig (TM3) and Sertoli (TM4) Cells" Nanomaterials 9, no. 2: 139. https://doi.org/10.3390/nano9020139