A Self-Assembling Ferritin Nanoplatform for Designing Classical Swine Fever Vaccine: Elicitation of Potent Neutralizing Antibody
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines and Virus Strains
2.2. Plasmids Construction and Transfection
2.3. Animal Study Design
2.4. Animal Warfare Statement
2.5. CSFV Antibody Blocking ELISA
2.6. Blood and Spleen Sample Collection and RT-qPCR Analyses
2.7. Confocal Microscopy
2.8. Lymphocyte Proliferation Assay
2.9. Viral Neutralizing Assay
2.10. Histidine (His) Tagged Affinity Purification
2.11. Statistical Analysis
3. Results
3.1. Internal Architecture and Intracellular Location of the Ferritin Nanoplatform
3.2. Amplification and Purification of the E2-Ferritin and Ferritin Np
3.3. The E2-Ferritin Nanospheres Efficiently Elicited Potent NAb In Vivo
3.4. The E2-Ferritin Nanocage Activated Sufficient Innate Immune Cytokine
3.5. The Novel E2-Ferritin Nanoplatform Vaccine Eliminated Viremia and Stereotyped Thermal Response in ATR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ganges, L.; Crooke, H.R.; Bohorquez, J.A.; Postel, A.; Sakoda, Y.; Becher, P.; Ruggli, N. Classical swine fever virus: The past, present and future. Virus Res. 2020, 289, 198151. [Google Scholar] [CrossRef]
- Xu, H.; Wang, Y.; Han, G.; Fang, W.; He, F. Identification of E2 with improved secretion and immunogenicity against CSFV in piglets. BMC Microbiol. 2020, 20, 26. [Google Scholar] [CrossRef] [Green Version]
- Graham, S.P.; Haines, F.J.; Johns, H.L.; Sosan, O.; La Rocca, S.A.; Lamp, B.; Rumenapf, T.; Everett, H.E.; Crooke, H.R. Characterisation of vaccine-induced, broadly cross-reactive IFN-gamma secreting T cell responses that correlate with rapid protection against classical swine fever virus. Vaccine 2012, 30, 2742–2748. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Chen, L.; Yun, J.; Cao, X. Expression of recombinant classical swine fever virus E2 glycoprotein by endogenous Txnip promoter in stable transgenic CHO cells. Eng. Life Sci. 2020, 20, 320–330. [Google Scholar] [CrossRef] [PubMed]
- Xia, S.L.; Xiang, G.T.; Lei, J.L.; Du, M.; Wang, Y.; Zhou, M.; Liu, Y.; Ji, S.; Wang, Y.L.; Luo, Y.; et al. Efficacy of the marker vaccine rAdV-SFV-E2 against classical swine fever in the presence of maternally derived antibodies to rAdV-SFV-E2 or C-strain. Vet. Microbiol. 2016, 196, 50–54. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.Y.; Wu, C.M.; Liao, C.M.; Chen, K.C.; You, C.C.; Wang, Y.W.; Huang, C.; Chien, M.S. The impact of porcine circovirus associated diseases on live attenuated classical swine fever vaccine in field farm applications. Vaccine 2019, 37, 6535–6542. [Google Scholar] [CrossRef] [PubMed]
- Choe, S.; Kim, J.H.; Kim, K.S.; Song, S.; Kang, W.C.; Kim, H.J.; Park, G.N.; Cha, R.M.; Cho, I.S.; Hyun, B.H.; et al. Impact of a Live Attenuated Classical Swine Fever Virus Introduced to Jeju Island, a CSF-Free Area. Pathogens 2019, 8, 251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, J.A.; Kang, Y.J.; Shin, C.; Ra, J.S.; Shin, H.H.; Hong, S.Y.; Do, Y.; Kang, S. Ferritin protein cage nanoparticles as versatile antigen delivery nanoplatforms for dendritic cell (DC)-based vaccine development. Nanomedicine 2014, 10, 561–569. [Google Scholar] [CrossRef] [PubMed]
- Englezou, P.C.; Sapet, C.; Demoulins, T.; Milona, P.; Ebensen, T.; Schulze, K.; Guzman, C.A.; Poulhes, F.; Zelphati, O.; Ruggli, N.; et al. Self-Amplifying Replicon RNA Delivery to Dendritic Cells by Cationic Lipids. Mol. Ther. Nucleic Acids 2018, 12, 118–134. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Jin, Q.; Ding, P.; Zhou, W.; Chai, Y.; Li, X.; Wang, Y.; Zhang, G. Gold nanoparticles enhance immune responses in mice against recombinant classical swine fever virus E2 protein. Biotechnol Lett. 2020, 42, 1169–1180. [Google Scholar] [CrossRef]
- Kanekiyo, M.; Wei, C.J.; Yassine, H.M.; McTamney, P.M.; Boyington, J.C.; Whittle, J.R.; Rao, S.S.; Kong, W.P.; Wang, L.; Nabel, G.J. Self-assembling influenza nanoparticle vaccines elicit broadly neutralizing H1N1 antibodies. Nature 2013, 499, 102–106. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Sagaseta, J.; Malito, E.; Rappuoli, R.; Bottomley, M.J. Self-assembling protein nanoparticles in the design of vaccines. Comput. Struct. Biotechnol. J. 2016, 14, 58–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Xie, L.; Zhang, L.; Wang, X.; Li, C.; Han, Y.; Hu, S.; Sun, Y.; Li, S.; Luo, Y.; et al. The E2 glycoprotein is necessary but not sufficient for the adaptation of classical swine fever virus lapinized vaccine C-strain to the rabbit. Virology 2018, 519, 10. [Google Scholar] [CrossRef] [PubMed]
- Cao, T.; Wang, Z.; Li, X.; Zhang, S.; Paudyal, N.; Zhang, X.; Li, X.; Fang, W. E2 and E(rns) of classical swine fever virus C-strain play central roles in its adaptation to rabbits. Virus Genes 2019, 55, 238–242. [Google Scholar] [CrossRef]
- Jiang, Z.; Zhu, L.; Cai, Y.; Yan, J.; Fan, Y.; Lv, W.; Gong, S.; Yin, X.; Yang, X.; Sun, X.; et al. Immunogenicity and protective efficacy induced by an mRNA vaccine encoding gD antigen against pseudorabies virus infection. Vet. Microbiol. 2020, 251, 108886. [Google Scholar] [CrossRef]
- Chen, Y.; Hu, Y.; Chen, H.; Li, X.; Qian, P. A ferritin nanoparticle vaccine for foot-and-mouth disease virus elicited partial protection in mice. Vaccine 2020, 38, 5647–5652. [Google Scholar] [CrossRef]
- Tao, L.N.; Liu, Z.H.; Xu, H.L.; Lu, Y.; Liao, M.; He, F. LvYY1 Activates WSSV ie1 Promoter for Enhanced Vaccine Production and Efficacy. Vaccines 2020, 8, 510. [Google Scholar] [CrossRef]
- Sliepen, K.; Ozorowski, G.; Burger, J.A.; van Montfort, T.; Stunnenberg, M.; LaBranche, C.; Montefiori, D.C.; Moore, J.P.; Ward, A.B.; Sanders, R.W. Presenting native-like HIV-1 envelope trimers on ferritin nanoparticles improves their immunogenicity. Retrovirology 2015, 12, 82. [Google Scholar] [CrossRef] [Green Version]
- Kelly, H.G.; Tan, H.X.; Juno, J.A.; Esterbauer, R.; Ju, Y.; Jiang, W.; Wimmer, V.C.; Duckworth, B.C.; Groom, J.R.; Caruso, F.; et al. Self-assembling influenza nanoparticle vaccines drive extended germinal center activity and memory B cell maturation. JCI Insight 2020, 5, e136653. [Google Scholar] [CrossRef]
- Zhang, H.; Wen, W.; Zhao, Z.; Wang, J.; Chen, H.; Qian, P.; Li, X. Enhanced protective immunity to CSFV E2 subunit vaccine by using IFN-gamma as immunoadjuvant in weaning piglets. Vaccine 2018, 36, 7353–7360. [Google Scholar] [CrossRef]
- Abid, M.; Teklue, T.; Li, Y.; Wu, H.; Wang, T.; Qiu, H.J.; Sun, Y. Generation and Immunogenicity of a Recombinant Pseudorabies Virus Co-Expressing Classical Swine Fever Virus E2 Protein and Porcine Circovirus Type 2 Capsid Protein Based on Fosmid Library Platform. Pathogens 2019, 8, 279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ismail, N.M.; El-Deeb, A.H.; Emara, M.M.; Tawfik, H.I.; Wanis, N.A.; Hussein, H.A. Prime-boost vaccination strategy against avian influenza and Newcastle disease viruses reduces shedding of the challenge viruses. Virusdisease 2018, 29, 324–332. [Google Scholar] [CrossRef] [PubMed]
- Tong, C.; Chen, N.; Liao, X.; Yuan, X.; Sun, M.; Li, X.; Fang, W. Continuous Passaging of a Recombinant C-Strain Virus in PK-15 Cells Selects Culture-Adapted Variants that Showed Enhanced Replication but Failed to Induce Fever in Rabbits. J. Microbiol. Biotechnol. 2017, 27, 1701–1710. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.; Li, X.; Peng, G.; Tang, C.; Zhu, S.; Qian, S.; Xu, J.; Qian, P. Glycoprotein E2 of classical swine fever virus expressed by baculovirus induces the protective immune responses in rabbits. Vaccine 2014, 32, 6607–6613. [Google Scholar] [CrossRef] [PubMed]
- Fan, H.; Xiao, S.; Tong, T.; Wang, S.; Xie, L.; Jiang, Y.; Chen, H.; Fang, L. Immunogenicity of porcine circovirus type 2 capsid protein targeting to different subcellular compartments. Mol. Immunol. 2008, 45, 653–660. [Google Scholar] [CrossRef]
- Wu, Q.; Xu, F.; Fang, L.; Xu, J.; Li, B.; Jiang, Y.; Chen, H.; Xiao, S. Enhanced immunogenicity induced by an alphavirus replicon-based pseudotyped baculovirus vaccine against porcine reproductive and respiratory syndrome virus. J. Virol. Methods 2013, 187, 251–258. [Google Scholar] [CrossRef]
- Zhao, F.; Liu, L.; Xu, M.; Shu, X.; Zheng, L.; Wei, Z. Assessments of different inactivating reagents in formulating transmissible gastroenteritis virus vaccine. Virol. J. 2020, 17, 163. [Google Scholar] [CrossRef]
- Bellini, M.; Riva, B.; Tinelli, V.; Rizzuto, M.A.; Salvioni, L.; Colombo, M.; Mingozzi, F.; Visioli, A.; Marongiu, L.; Frascotti, G.; et al. Engineered Ferritin Nanoparticles for the Bioluminescence Tracking of Nanodrug Delivery in Cancer. Small 2020, 16, e2001450. [Google Scholar] [CrossRef]
- Powell, A.E.; Zhang, K.; Sanyal, M.; Tang, S.; Weidenbacher, P.A.; Li, S.; Pham, T.D.; Pak, J.E.; Chiu, W.; Kim, P.S. A single immunization with spike-functionalized ferritin vaccines elicits neutralizing antibody responses against SARS-CoV-2 in mice. bioRxiv 2020. [Google Scholar] [CrossRef]
- Wang, M.; Sozzi, E.; Bohorquez, J.A.; Alberch, M.; Pujols, J.; Cantero, G.; Gaffuri, A.; Lelli, D.; Rosell, R.; Bensaid, A.; et al. Decrypting the Origin and Pathogenesis in Pregnant Ewes of a New Ovine Pestivirus Closely Related to Classical Swine Fever Virus. Viruses 2020, 12, 775. [Google Scholar] [CrossRef]
- Ji, S.; Luo, Y.; Zhang, T.; Shao, L.; Meng, X.Y.; Wang, Y.; Gao, Y.; Li, Y.; Li, S.; Sun, Y.; et al. An improved indirect ELISA for specific detection of antibodies against classical swine fever virus based on structurally designed E2 protein expressed in suspension mammalian cells. Arch. Virol. 2018, 163, 1831–1839. [Google Scholar] [CrossRef] [PubMed]
- Carty, M.; Guy, C.; Bowie, A.G. Detection of viral infections by innate immunity. Biochem. Pharmacol. 2020, 183, 114316. [Google Scholar] [CrossRef]
- Shan, H.; Dou, W.; Zhang, Y.; Qi, M. Targeted ferritin nanoparticle encapsulating CpG oligodeoxynucleotides induces tumor-associated macrophage M2 phenotype polarization into M1 phenotype and inhibits tumor growth. Nanoscale 2020, 12, 22268–22280. [Google Scholar] [CrossRef] [PubMed]
- Kęsik, M.; Sączyńska, V.; Szewczyk, B.; Płucienniczak, A. Inclusion bodies from recombinant bacteria as a novel system for delivery of vaccine antigen by the oral route. Immunol. Lett. 2004, 91, 197–204. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; Nishi, K.; Macleod, E.; Sabara, M.I.; Lin, M.; Handel, K.; Pasick, J. Baculovirus expression and antigenic characterization of classical swine fever virus E2 proteins. Transbound. Emerg. Dis. 2013, 60, 143–151. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequences (5′–3′) | Products |
---|---|---|
CSFV-E2 | Forward: GGTACCCGGCTAGCCTGCAAGGAAG | 1159-bp |
Reverse: ACGCGTTTAATGATGATGATGATGATGTTCTGCGAAGTAATC | ||
RT-qPCR (5′UTR/strain C) | Forward: GAACTGGGCTAGCCATG | 98-bp |
Reverse: ACTGTCCTGTACTCAGGAC | ||
Probe: FAM-TAGGACTAGCAAAACGGAGGGACTAGCCA-TAMARA | ||
GAPDH (rabbit) | Forward: AGAGCACCAGAGGAGGACG | 108-bp |
Reverse: TGGGATGGAAACTGTGAAGAG | ||
IFN-gamma (rabbit) | Forward: CTGGTCCAGCGTAAAGCAGT | 116-bp |
Reverse: TCAGTACTTGGATGCTCGCC | ||
IL-4 (rabbit) | Forward: CAGGGGCGACATCATCCTAC | 102-bp |
Reverse: CTCGGTTGTGTTCTTGGGG |
Cohort (n = 4) | Dosage | Antigens | Immunization | Challenge | Sacrifice (56 dpi) |
---|---|---|---|---|---|
PBS | 1 mL (IM) | Prime vaccination: Day 1; Booster vaccination: Day 21; Intramuscular injection (IM) | Viral challenge: C-strain (1 dose) Intravenous injection (IV) | Spleen collection for viral tissue load assay | |
pfe | 40 μg (IM) | 40 μg purified | |||
pE2-fe | 40 μg (IM) | 40 μg purified | |||
pE2-fe/Gel02 | 40 μg (IM) | 40 μg purified | |||
E2-fe/Gel02 | 40 μg (IM) | 20 μg (unpurified) | |||
pE2/Gel02 | 40 μg (IM) | 40 μg purified | |||
C-strain | 1-dose (IV) | 1-dose |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Z.; Chen, X.; Chen, Y.; Li, H.; Fang, K.; Chen, H.; Li, X.; Qian, P. A Self-Assembling Ferritin Nanoplatform for Designing Classical Swine Fever Vaccine: Elicitation of Potent Neutralizing Antibody. Vaccines 2021, 9, 45. https://doi.org/10.3390/vaccines9010045
Zhao Z, Chen X, Chen Y, Li H, Fang K, Chen H, Li X, Qian P. A Self-Assembling Ferritin Nanoplatform for Designing Classical Swine Fever Vaccine: Elicitation of Potent Neutralizing Antibody. Vaccines. 2021; 9(1):45. https://doi.org/10.3390/vaccines9010045
Chicago/Turabian StyleZhao, Zekai, Xinghua Chen, Yibao Chen, Hui Li, Kui Fang, Huanchun Chen, Xiangmin Li, and Ping Qian. 2021. "A Self-Assembling Ferritin Nanoplatform for Designing Classical Swine Fever Vaccine: Elicitation of Potent Neutralizing Antibody" Vaccines 9, no. 1: 45. https://doi.org/10.3390/vaccines9010045