Immune Responses and Protective Efficacy of a Formalin-Killed Francisella Noatunensis Subsp. Orientalis Vaccine Evaluated through Intraperitoneal and Immersion Challenge Methods in Oreochromis Niloticus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fish and Rearing Management
2.2. Bacteria Strain and Vaccine Preparation
2.3. Vaccine Safety and Fish Immunization
2.3.1. Vaccine Safety Test
2.3.2. Immunization and Sample Collection
2.3.3. Specific IgM Antibody Titer Analysis by ELISA
2.3.4. Immune Related Gene Analysis
2.3.5. Intraperitoneal and Immersion Challenge Tests
2.3.6. Blood Bacterial Invasion and Clearance after Challenge
2.3.7. Granuloma Score
2.3.8. Statistical Analysis
3. Results
3.1. Safety of the Vaccine
3.2. Specific IgM Antibody Titers
3.3. Immune Related Gene Analysis after Immunization
3.4. Protection of Fish after Immunization (RPS)
3.5. Blood Bacterial Invasion and Clearance
3.6. Granuloma Scores
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Birkbeck, T.H.; Feist, S.W.; Verner-Jeffreys, D.W. Francisella infections in fish and shellfish. J. Fish Dis. 2011, 34, 173–187. [Google Scholar] [CrossRef]
- Colquhoun, D.J.; Duodu, S. Francisella infections in farmed and wild aquatic organisms. Vet. Res. 2011, 42, 47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chern, R.S.; Chao, C.B. Outbreaks of a Disease Caused by Rickettsia-like Organism in Cultured Tilapias in Taiwan. Fish Pathol. 1994, 29, 61–71. [Google Scholar] [CrossRef] [Green Version]
- Hsieh, C.Y.; Tung, M.C.; Tu, C.; Chang, C.D.; Tsai, S.S. Enzootics of visceral granulomas associated with Francisella-like organism infection in tilapia (Oreochromis spp.). Aquaculture 2006, 254, 129–138. [Google Scholar] [CrossRef]
- Pulpipat, T.; Lin, K.H.; Chen, Y.H.; Wang, P.C.; Chen, S.C. Molecular characterization and pathogenicity of Francisella noatunensis subsp. orientalis isolated from cultured tilapia (Oreochromis sp.) in Taiwan. J. Fish Dis. 2019, 42, 643–655. [Google Scholar] [CrossRef]
- Liu, L.; Huang, P.-R.; Fang, W.; Luo, Z.P.; Peng, H.L.; Wang, Y.X.; Li, X. Chronic streptococcosis in Nile tilapia, Oreochromis niloticus (L.), caused by Streptococcus agalactiae. J. Fish Dis. 2013, 37, 757–763. [Google Scholar] [CrossRef]
- Azmai, M.N.A.; Saad, M. Streptococcosis in Tilapia (Oreochromis niloticus): A Review. Pertanika J. Trop. Agric. 2011, 34, 195–206. [Google Scholar]
- Ottem, K.F.; Nylund, A.; Karlsbakk, E.; Friis-Moller, A.; Kamaishi, T. Elevation of Francisella philomiragia subsp. noatunensis Mikalsen et al. (2007) to Francisella noatunensis comb. nov. [syn. Francisella piscicida Ottem et al. (2008) syn. nov.] and characterization of Francisella noatunensis subsp. orientalis subsp. nov., two important fish pathogens. J. Appl. Microbiol. 2009, 106, 1231–1243. [Google Scholar] [CrossRef]
- Ramírez-Paredes, J.G.; Thompson, K.D.; Metselaar, M.; Shahin, K.; Soto, E.; Richards, R.H.; Penman, D.J.; Colquhoun, D.J.; Adams, A. A polyphasic approach for phenotypic and genetic characterization of the fastidious aquatic pathogen Francisella noatunensis subsp. orientalis. Front. Microbiol. 2017, 8, 2324. [Google Scholar] [CrossRef]
- Bakkemo, K.R.; Mikkelsen, H.; Bordevik, M.; Torgersen, J.; Winther-Larsen, H.C.; Vanberg, C.; Olsen, R.; Johansen, L.H.; Seppola, M. Intracellular localisation and innate immune responses following Francisella noatunensis infection of Atlantic cod (Gadus morhua) macrophages. Fish Shellfish Immunol. 2011, 31, 993–1004. [Google Scholar] [CrossRef]
- Soto, E.; Fernandez, D.; Thune, R.; Hawke, J.P. Interaction of Francisella asiatica with tilapia (Oreochromis niloticus) innate immunity. Infect. Immun. 2010, 78, 2070–2078. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shahin, K.; Shinn, A.P.; Metselaar, M.; Ramirez-Paredes, J.G.; Monaghan, S.J.; Thompson, K.D.; Hoare, R.; Adams, A. Efficacy of an inactivated whole-cell injection vaccine for nile tilapia, Oreochromis niloticus (L), against multiple isolates of Francisella noatunensis subsp. orientalis from diverse geographical regions. Fish Shellfish Immunol. 2019, 89, 217–227. [Google Scholar] [CrossRef] [PubMed]
- Soto, E.; Wiles, J.; Elzer, P.; Macaluso, K.; Hawke, J.P. Attenuated Francisella asiatica iglC mutant induces protective immunity to francisellosis in tilapia. Vaccine 2011, 29, 593–598. [Google Scholar] [CrossRef] [PubMed]
- Ramírez-Paredes, J.G.; Mendoza-Roldan, M.A.; Lopez-Jimena, B.; Shahin, K.; Metselaar, M.; Thompson, K.D.; Penman, D.J.; Richards, R.H.; Adams, A. Whole cell inactivated autogenous vaccine effectively protects red Nile tilapia (Oreochromis niloticus) against francisellosis via intraperitoneal injection. J. Fish Dis. 2019, 42, 1191–1200. [Google Scholar] [CrossRef] [PubMed]
- Lagos, L.; Tandberg, J.I.; Repnik, U.; Boysen, P.; Ropstad, E.; Varkey, D.; Paulsen, I.T.; Winther-Larsen, H.C. Characterization and Vaccine Potential of Membrane Vesicles Produced by Francisella noatunensis subsp. orientalis in an Adult Zebrafish Model. Clin. Vaccine Immunol. 2017, 24, e00557-16. [Google Scholar] [CrossRef] [Green Version]
- Adams, A. Progress, challenges and opportunities in fish vaccine development. Fish Shellfish Immunol. 2019, 90, 210–214. [Google Scholar] [CrossRef]
- Brudal, E.; Lampe, E.O.; Reubsaet, L.; Roos, N.; Hegna, I.K.; Thrane, I.M.; Koppang, E.O.; Winther-Larsen, H.C. Vaccination with outer membrane vesicles from Francisella noatunensis reduces development of francisellosis in a zebrafish model. Fish Shellfish Immunol. 2015, 42, 50–57. [Google Scholar] [CrossRef] [Green Version]
- Mc Gann, P.; Rozak, D.A.; Nikolich, M.P.; Bowden, R.A.; Lindler, L.E.; Wolcott, M.J.; Lathigra, R. A novel brain heart infusion broth supports the study of common Francisella tularensis serotypes. J. Microbiol. Methods 2010, 80, 164–171. [Google Scholar] [CrossRef]
- Wang, Y.T.; Huang, H.Y.; Tsai, M.A.; Wang, P.C.; Jiang, B.H.; Chen, S.C. Phosphoglycerate kinase enhanced immunity of the whole cell of Streptococcus agalactiae in tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2014, 41, 250–259. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Soto, E.; Fernandez, D.; Hawke, J.P. Attenuation of the fish pathogen Francisella sp. by mutation of the iglC* gene. J. Aquat. Anim. Health 2009, 21, 140–149. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, H.T.; Thu Nguyen, T.T.; Tsai, M.-A.; Ya-Zhen, E.; Wang, P.-C.; Chen, S.-C. A formalin-inactivated vaccine provides good protection against Vibrio harveyi infection in orange-spotted grouper (Epinephelus coioides). Fish Shellfish Immunol. 2017, 65, 118–126. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.-C.; Tung, M.-C.; Chen, S.-P.; Tsai, J.-F.; Wang, P.-C.; Chen, R.-S.; Lin, S.-C.; Adams, A. Systematic granulomas caused by a rickettsia-like organism in Nile tilapia, Oreochronuis niloticus (L.), from southern Taiwan. J. Fish Dis. 1994, 17, 591–599. [Google Scholar] [CrossRef]
- Munang’andu, H.M.; Evensen, O. Correlates of protective immunity for fish vaccines. Fish Shellfish Immun. 2019, 85, 132–140. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.-J.; Huang, M.-Y.; Hong, J.-W.; Chuang, Y.-C.; Chou, R.-L.; Lee, Y.-H.; Chen, T.-I. The Efficacy of Inactivated Photobacterium damselae subsp. piscicida Combined with Levan/Alum as Vaccine against Photobacteriosis in Cobia, Rachycentron canadum. J. World Aquac. Soc. 2015, 46, 549–556. [Google Scholar] [CrossRef]
- Liu, G.; Zhu, J.; Chen, K.; Gao, T.; Yao, H.; Liu, Y.; Zhang, W.; Lu, C. Development of Streptococcus agalactiae vaccines for tilapia. Dis. Aquat. Org. 2016, 122, 163–170. [Google Scholar] [CrossRef] [Green Version]
- Crosbie, P.B.; Nowak, B.F. Immune responses of barramundi, Lates calcarifer (Bloch), after administration of an experimental Vibrio harveyi bacterin by intraperitoneal injection, anal intubation and immersion. J. Fish Dis. 2004, 27, 623–632. [Google Scholar] [CrossRef]
- Xu, Z.; Chen, C.-F.; Mao, Z.-J.; Zhu, W.-Y. Detection of serum and mucosal antibody production and antibody secreting cells (ASCs) in large yellow croaker (Pseudosciaena crocea) following vaccination with Vibrio harveyi via different routes. Aquaculture 2009, 287, 243–247. [Google Scholar] [CrossRef]
- Tsai, J.L.; Priya, T.A.; Hu, K.Y.; Yan, H.Y.; Shen, S.T.; Song, Y.L. Grouper interleukin-12, linked by an ancient disulfide-bond architecture, exhibits cytokine and chemokine activities. Fish Shellfish Immunol. 2014, 36, 27–37. [Google Scholar] [CrossRef]
- Zou, J.; Secombes, C.J. The Function of Fish Cytokines. Biology 2016, 5, 23. [Google Scholar] [CrossRef]
- Hong, S.; Peddie, S.; Campos-Perez, J.J.; Zou, J.; Secombes, C.J. The effect of intraperitoneally administered recombinant IL-1beta on immune parameters and resistance to Aeromonas salmonicida in the rainbow trout (Oncorhynchus mykiss). Dev. Comp. Immunol. 2003, 27, 801–812. [Google Scholar] [CrossRef]
- Taechavasonyoo, A.; Hirono, I.; Kondo, H. The immune-adjuvant effect of Japanese flounder Paralichthys olivaceus IL-1beta. Dev. Comp. Immunol. 2013, 41, 564–568. [Google Scholar] [CrossRef] [PubMed]
- Yin, Z.; Kwang, J. Carp interleukin-1 beta in the role of an immuno-adjuvant. Fish Shellfish Immunol. 2000, 10, 375–378. [Google Scholar] [CrossRef] [PubMed]
- Praveen, K.; Evans, D.L.; Jaso-Friedmann, L. Constitutive expression of tumor necrosis factor-alpha in cytotoxic cells of teleosts and its role in regulation of cell-mediated cytotoxicity. Mol. Immunol. 2006, 43, 279–291. [Google Scholar] [CrossRef] [PubMed]
- Omaima Harun, N.; Zou, J.; Zhang, Y.-A.; Nie, P.; Secombes, C.J. The biological effects of rainbow trout (Oncorhynchus mykiss) recombinant interleukin-8. Dev. Comp. Immunol. 2008, 32, 673–681. [Google Scholar] [CrossRef]
- Sun, J.-S.; Zhao, L.; Sun, L. Interleukin-8 of Cynoglossus semilaevis is a chemoattractant with immunoregulatory property. Fish Shellfish Immunol. 2011, 30, 1362–1367. [Google Scholar] [CrossRef]
- Chen, L.; He, C.; Baoprasertkul, P.; Xu, P.; Li, P.; Serapion, J.; Waldbieser, G.; Wolters, W.; Liu, Z. Analysis of a catfish gene resembling interleukin-8: cDNA cloning, gene structure, and expression after infection with Edwardsiella ictaluri. Dev. Comp. Immunol. 2005, 29, 135–142. [Google Scholar] [CrossRef]
- Wang, T.-T.; Song, X.-H.; Bao, G.-M.; Zhao, L.-X.; Yu, X.; Zhao, J. Molecular characterization, expression analysis, and biological effects of interleukin-8 in grass carp Ctenopharyngodon idellus. Fish Shellfish Immunol. 2013, 35, 1421–1432. [Google Scholar] [CrossRef]
- Oehlers, S.H.B.; Flores, M.V.; Hall, C.J.; O’Toole, R.; Swift, S.; Crosier, K.E.; Crosier, P.S. Expression of zebrafish cxcl8 (interleukin-8) and its receptors during development and in response to immune stimulation. Dev. Comp. Immunol. 2010, 34, 352–359. [Google Scholar] [CrossRef]
- Laing, K.J.; Zou, J.J.; Wang, T.; Bols, N.; Hirono, I.; Aoki, T.; Secombes, C.J. Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss. Dev. Comp. Immunol. 2002, 26, 433–444. [Google Scholar] [CrossRef]
- Thu Nguyen, T.T.; Nguyen, H.T.; Vu-Khac, H.; Wang, P.-C.; Chen, S.-C. Identification of protective protein antigens for vaccination against Streptococcus dysgalactiae in cobia (Rachycentron canadum). Fish Shellfish Immunol. 2018, 80, 88–96. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Zhang, Q.; Xu, L.; Li, S.; Wang, D.; Zhao, J.; Liu, H.; Feng, J.; Lu, T. Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model. Oncotarget 2017, 8, 112222–112235. [Google Scholar] [CrossRef] [Green Version]
- Jantrakajorn, S.; Wongtavatchai, J. Francisella Infection in Cultured Tilapia in Thailand and the Inflammatory Cytokine Response. J. Aquat. Anim. Health. 2016, 28, 97–106. [Google Scholar] [CrossRef] [PubMed]
- Thim, H.L.; Villoing, S.; McLoughlin, M.; Christie, K.E.; Grove, S.; Frost, P.; Jorgensen, J.B. Vaccine Adjuvants in Fish Vaccines Make a Difference: Comparing Three Adjuvants (Montanide ISA763A Oil, CpG/Poly I:C Combo and VHSV Glycoprotein) Alone or in Combination Formulated with an Inactivated Whole Salmonid Alphavirus Antigen. Vaccines 2014, 2, 228–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gaffen, S.L.; Kramer, J.M.; Yu, J.J.; Shen, F. The IL-17 cytokine family. Vitam. Horm. 2006, 74, 255–282. [Google Scholar] [CrossRef]
- Wang, T.; Martin, S.A.; Secombes, C.J. Two interleukin-17C-like genes exist in rainbow trout Oncorhynchus mykiss that are differentially expressed and modulated. Dev. Comp. Immunol. 2010, 34, 491–500. [Google Scholar] [CrossRef]
- Soto, E.; Kidd, S.; Mendez, S.; Marancik, D.; Revan, F.; Hiltchie, D.; Camus, A. Francisella noatunensis subsp. orientalis pathogenesis analyzed by experimental immersion challenge in Nile tilapia, Oreochromis niloticus (L.). Vet. Microbiol. 2013, 164, 77–84. [Google Scholar] [CrossRef]
- Nordmo, R.; Ramstad, A. Comparison of different challenge methods to evaluate the efficacy of furunculosis vaccines in Atlantic salmon, Salmo salar L. J. Fish Dis. 1997, 20, 119–126. [Google Scholar] [CrossRef]
Genes | Primer | Sequence (5ʹ-3ʹ) |
---|---|---|
RPL23 | otRPL23-F1 | GTGTGTACGAAACAAGAACGAGCA |
otRPL23-R1 | CACACACACACACACACACGAA | |
IL-1β | otIL-1βB-F1 | AGTTGTGCTGTTTCTGGAGCAATAC |
otIL-1βB-R1 | TCGCTCCATGTCTCTGTCAGTTAAA | |
TNFα | otTNFα-F1 | GCTGGTCTCACTCATATGCACCTA |
otTNFα-R1 | TGTCTTTTGGCAGACTGTACGGATA | |
CXCL8 | otCXCL8-F1 | CCTCCAAGAAACGGGCATAAATCC |
otCXCL8-R1 | TCAGTCATGGCTCAGTGGTCAG | |
IL-17C | otIL17C-F1 | CATCTTCGTACTGTTCATCGTGCC |
otIl17C-R1 | TCCTTGTCGTTATAGCAGCGGAA |
Group | Fish Number | Mortality (%) | Average Mortality (%) | Average RPS (%) |
---|---|---|---|---|
IP challenge | ||||
Control 1 | 30 | 90 | 91.65 | 71 |
Control 2 | 30 | 93.39 | ||
Vaccine 1 | 30 | 30 | 26.65 | |
Vaccine 2 | 30 | 23.3 | ||
Immersion challenge | ||||
Control 1 | 30 | 60 | 61.67 | 76 |
Control 2 | 30 | 63.33 | ||
Vaccine 1 | 30 | 16.67 | 15 | |
Vaccine 2 | 30 | 13.33 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pulpipat, T.; Maekawa, S.; Wang, P.-C.; Chen, S.-C. Immune Responses and Protective Efficacy of a Formalin-Killed Francisella Noatunensis Subsp. Orientalis Vaccine Evaluated through Intraperitoneal and Immersion Challenge Methods in Oreochromis Niloticus. Vaccines 2020, 8, 163. https://doi.org/10.3390/vaccines8020163
Pulpipat T, Maekawa S, Wang P-C, Chen S-C. Immune Responses and Protective Efficacy of a Formalin-Killed Francisella Noatunensis Subsp. Orientalis Vaccine Evaluated through Intraperitoneal and Immersion Challenge Methods in Oreochromis Niloticus. Vaccines. 2020; 8(2):163. https://doi.org/10.3390/vaccines8020163
Chicago/Turabian StylePulpipat, Theeraporn, Shun Maekawa, Pei-Chi Wang, and Shih-Chu Chen. 2020. "Immune Responses and Protective Efficacy of a Formalin-Killed Francisella Noatunensis Subsp. Orientalis Vaccine Evaluated through Intraperitoneal and Immersion Challenge Methods in Oreochromis Niloticus" Vaccines 8, no. 2: 163. https://doi.org/10.3390/vaccines8020163