Next Article in Journal
Application of Acidulants to Control Salmonella spp. in Rendered Animal Fats and Oils with Different Levels of Unsaturation
Previous Article in Journal
Beaver Dams and Fallen Trees as Ecological Corridors Allowing Movements of Mammals across Water Barriers—A Case Study with the Application of Novel Substrate for Tracking Tunnels
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 8
10.3390/ani13081303
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Supplementation with Mono-Lactate Glyceride Enhances Intestinal Function of Weaned Piglets

by
Hanbo Li
†,
Yanyan Zhang
†,
Jiaqian Xie
†,
Chao Wang
,
Dan Yi
,
Tao Wu
,
Lei Wang
,
Di Zhao
and
Yongqing Hou
*
Engineering Research Center of Feed Protein Resources on Agricultural By-Products, Ministry of Education, Wuhan Polytechnic University, Wuhan 430023, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2023, 13(8), 1303; https://doi.org/10.3390/ani13081303
Submission received: 3 March 2023 / Revised: 31 March 2023 / Accepted: 10 April 2023 / Published: 11 April 2023
(This article belongs to the Section Animal Nutrition)
Browse Figure
Review Reports Versions Notes

Abstract

:

Simple Summary

The aim of this study is to investigate the effects of mono-lactate glyceride on growth performance and the morphology and function of the intestine in weaned piglets, which provided a theoretical basis for its practical application as a new feed additive. Dietary supplementation with 0.6% mono-lactate glyceride (LG) essentially decreased diarrhea rate and the contents of malondialdehyde (MDA) and hydrogen peroxide (H2O2) in the ileum and jejunum, increased the expression of intestinal tight junction protein (Occludin) and the activities of superoxide dismutase (SOD) and catalase (CAT) in the ileum and colon, and improved the intestinal morphologic structure. In addition, mono-lactate glyceride supplementation could enhance intestinal mucosal growth, promote intestinal mucosal water and nutrient transport and lipid metabolism, and enhance antiviral and immune function and antioxidant capacity. Overall, these results suggested that dietary supplementation with mono-lactate glyceride could decrease the diarrhea rate.

Abstract

Mono-lactate glyceride (LG) is a short-chain fatty acid ester. It has been shown that short-chain fatty acid esters play an important role in maintaining intestinal structure and function. The aim of this study is to investigate the effects of mono-lactate glyceride on growth performance and intestinal morphology and function in weaned piglets. Sixteen 21-day-old weaned piglets of similar weight were distributed arbitrarily to two treatments: The control group (basal diet) and the LG group (basal diet + 0.6% mono-lactate glyceride). The experiment lasted for 21 days. On day 21 of the trial, piglets were weighed, and blood and intestinal samples were collected for further analysis. Results showed that dietary supplementation with 0.6% mono-lactate glyceride decreased (p < 0.05) the diarrhea rate and the contents of malondialdehyde and hydrogen peroxide in the ileum and jejunum and increased (p < 0.05) the expression of intestinal tight junction protein (Occludin) and the activities of superoxide dismutase and catalase in the ileum and colon. In addition, mono-lactate glyceride supplementation could enhance intestinal mucosal growth by increasing (p < 0.05) the mRNA levels of extracellular regulated protein kinases, promote intestinal mucosal water and nutrient transport and lipid metabolism by increasing (p < 0.05) the mRNA levels of b0,+ amino acid transporter, aquaporin 3, aquaporin 10, gap junction protein alpha 1, intestinal fatty acid-binding protein, and lipoprotein lipase, enhance antiviral and immune function by increasing (p < 0.05) the mRNA levels of nuclear factor kappa-B, interferon-β, mucovirus resistance protein II, 2’-5’-oligoadenylate synthetase-like, interferon-γ, C-C motif chemokine ligand 2, and toll-like receptor 4, and enhance antioxidant capacity by increasing (p < 0.05) the mRNA levels of NF-E2-related factor 2 and glutathione S-transferase omega 2 and decreasing (p < 0.05) the mRNA level of NADPH oxidase 2. These results suggested that dietary supplementation with mono-lactate glyceride could decrease the diarrhea rate by improving intestinal antioxidant capacity, intestinal mucosal barrier, intestinal immune defense function, and intestinal mucosal water and nutrient transport. Collectively, dietary supplementation with 0.6% mono-lactate glyceride improved the intestinal function of weaned piglets.

1. Introduction

Social, environmental, and nutritional changes will reduce piglet feed intake during the critical period of piglet adaptation to the initial diet. [1]. After weaning, the diet is changed from highly digestible liquid milk to more indigestible and complex solid feeds, which can impair the structure and function of the intestine [2]. Thus, the weaning period is one of the most critical developmental stages of the digestive tract of piglets. Symptoms caused by weaning profoundly affect the health of piglets, resulting in reduced growth performance and sometimes death [3]. These effects have resulted in economic losses to pig production and increased public health risks due to the production of pathogenic bacteria-infected pork [4]. Therefore, it is urgent to develop high-quality and safe antibiotic replacement products to improve adverse impacts caused by weaned piglet syndrome and promote piglet intestinal health.
Short-chain fatty acid esters are low molecular weight chemicals formed by the esterification of short-chain fatty acids (SCFAs) and alcohols under acid catalysis, i.e., the substrates are common with chain lengths of less than ten carbon atoms. It is an important substance to provide energy and fat metabolism to the animal body [5]. When the body is in a state of energy demand, short-chain fatty acid esters are gradually hydrolyzed by lipases to free fatty acids and glycerol, released into the blood, and oxidized and utilized by other tissues [6]. In recent years, it has been shown that dietary supplementation with tributyrin can improve the growth performance of weaned piglets and promote the development of immune organs and small intestine of weaned piglets. [7]. Previous research reported that glyceryl butyrate attenuated the inflammatory responses in ETEC-challenged piglets by inhibiting NF-κB/MAPK pathways and modulating gut microbiota, thereby improving the intestinal health of piglets [8].
Studies have shown that SCFA inhibits inflammatory responses by inhibiting immune cell chemotaxis and reducing the release of pro-inflammatory cytokines and reactive oxygen species [9]. As fatty acids, acetic acid, propionic acid, and butyric acid play an important role. Butyric acid can play an anti-inflammatory role by inhibiting the release of IL-12, IL-1β, TNF-α, and NO in monocytes, promoting the expression of IL-10 and reducing the activity of NF-κB [9]. Acetic acid and the propionic acid act as antimicrobial agents by promoting the secretion of defense peptides in the host [10]. Butyrate can increase the secretion of antimicrobial peptides that are intrinsically immune in the host, clearing Salmonella enterica before an inflammatory response is triggered [11]. SCFAs are primarily produced not only from food sources but also from microbial fermentation of non-digestible sugar in the colon and cecum [12].
As a short-chain fatty acid ester, mono-lactate glyceride (LG) is water-soluble. When administered parenterally, mono-lactate glyceride is rapidly hydrolyzed to glycerol and free fatty acids in the small intestine [6]. It has been shown that SCFAs can change chemotaxis and phagocytosis of immune cells, induce reactive oxygen species (ROS), and alter cell proliferation and function, which has anti-inflammatory, antitumorigenic, and antimicrobial effects [13]. Therefore, dietary supplementation with SCFAs can effectively replace antibiotics and improve the growth performance of weaned piglets. We hypothesize that LG can attenuate weaning-induced intestinal oxidative stress and inflammatory responses, thereby improving intestinal function in weaned piglets. However, the effects of mono-lactate glyceride on growth performance and intestinal function in weaned piglets remain unclear. In this experiment, the effects of LG supplementation on growth performance and intestinal function in weaned piglets were investigated by detecting the growth indexes, plasma biochemical parameters, intestinal histomorphology, antioxidant parameters, gene expression levels, and protein expression levels in piglets.

2. Materials and Methods

2.1. Experimental Animals and Design

The animal experiment for this research was approved by the Animal Care and Use Committee of the Hubei Province (WPU201508001). The sixteen healthy crossbred female piglets (Duroc × Landrace × Yorkshire) with similar body weights were weaned at 21 days of age. Each piglet was individually housed in a 1.20 × 1.10 m2 steel metabolic cage with eight replicate cages per treatment. After a period of 3 days of adaptation, piglets (average body weight of 6.59 ± 1.19 kg) were assigned randomly into the two treatments: Control group (piglets were fed with the basal diet) and LG group (piglets were fed with the basal diet supplemented with 0.6% mono-lactate glyceride). The basal diet was prepared according to the nutritional needs of NRC (2012) pigs (8~20 kg), and the basal diet nutritional levels were consistent in each treatment group, and its composition and nutritional content are shown in Table 1. On days 7 and 14 of the trial, blood samples were collected from the anterior vena cava of piglets. On day 21 of the trial, each pig was anesthetized with 10% pentobarbital sodium by intramuscular injection at a dose of 80 mg/kg BW and slaughtered 15 min later. Then, the pig‘s abdomen was incised from the sternum to the pubic bone to expose the entire gastrointestinal tract. Blood, intestine, and intestinal contents were collected and stored at −80 °C until assay [14].

2.2. Plasma Biochemical Indices

On the 21st day of the experiment, piglets in each group were aseptically bled from the anterior vena cava 1 h after feeding D-xylose, and the blood samples were allowed to stand for 15 min and centrifuged (3000 rpm, 10 min), and the supernatant was taken after the end of centrifugation, that is, plasma was separated, and the blood samples were aliquoted and placed in a −80 °C freezer for testing [15]. Plasma biochemical Indices (ALT, AST, TBIL, TP, ALB, CHOL, BUN, ALP, CK, and GGT) were measured by the Testing and Analysis Center of the Hubei Institute of Pharmaceutical Industry.

2.3. Intestinal Morphology and Intestinal Redox Status

To investigate intestinal morphology, paraformaldehyde-fixed jejunum, ileum, and duodenum were dehydrated and embedded in paraffin. Next, 4-µm sections were cut and then stained with hematoxylin and eosin stain. Intestinal morphology was carried out with a light microscope (Leica, Solms, Germany) with the Leica Application Suite image analysis software (Leica, Solms, Germany) [14]. There are 6 villus and crypts that were counted per histological cutting. Intestinal villus height, crypt depth, and villus surface area were measured to calculate the ratio of villus height to crypt depth. The activities of GSH-Px, SOD, and CAT and the contents of MDA and H2O2 were determined by using commercially available kits (Jiancheng Bioengineering Institute, Nanjing, China).

2.4. Expression Levels of Protein

The expression of proteins was analyzed by using Western blotting as described by Hou et al. [16]. The primary antibodies used in this study included Villin, Occludin (rabbit, 1:1000; Cell Signaling Technology, Inc., Danvers, MA, USA), Caspase-3, Bax, MAX1, and β-actin (mouse 1:2000; Sigma-Aldrich Inc., St. Louis, MI, USA). The secondary antibodies used in this study included Anti-mouse (mouse, 1:5000; Zhongshan Golden Bridge Biological Technology Co., Ltd., Beijing, China) and Anti-rabbit (rabbit, 1:3000; Zhongshan Golden Bridge Biological Technology Co., Ltd., Beijing, China). Blots were developed using an enhanced chemiluminescence kit (Amersham Biosciences, Uppsala, Sweden) and then analyzed by an imaging system (Alpha Innotech, New York, NY, USA).

2.5. Expression Levels of Genes

The quantification of gene mRNA levels was performed by the real-time PCR method, as described by Yi et al. [17]. The primers used in this study were shown in Table 2. The reference gene was ribosomal protein L 4 (RPL4). SYBR® Premix Ex TaqTM (Takara, Dalian, China) was used for real-time PCR 7500 System Fast Real-Time RT-PCR (Applied Biosystems, Foster City, CA, USA). Results were analyzed by the 2−ΔΔCt method as described [1].

2.6. Statistical Analysis

All data were analyzed using Student’s t-test, and data were expressed as mean ± standard deviation. All results were analyzed using SPSS (Version 17.0, SPSS Inc., Chicago, IL, USA). A p-value ≤ 0.05 was considered statistically significant.

3. Results

3.1. Growth Performance

During the experimental period, the average daily gain (ADG), average daily feed intake (ADFI), feed to gain (F/G), and diarrhea rate (DR) were shown in (Table 3). Although there was no significant difference (p > 0.05) in ADG and ADFI between control and LG groups, dietary LG supplementation had a tendency to increase ADG. Moreover, compared with the control group, dietary supplementation with 0.6% LG reduced (p < 0.05) DR between days 0 to 10, days 10 to 21, and days 0 to 21.

3.2. Plasma Biochemical Indices

Plasma biochemical indicators were shown in Table S1 to reflect the metabolic function of piglets. Compared with the control group, alkaline phosphatase (ALP) and blood urea nitrogen (BUN) on day 7 and alanine aminotransferase (ALT) on day 21 in plasma were increased (p < 0.05) in the LG group, total protein (TP), total cholesterol (CHOL), and glutamyl transpeptidase (GGT) were decreased (p < 0.05) in the LG group on day 7, total bilirubin (TBIL), albumin (ALB), creatine kinase (CK), and glutamyl transaminase (GGT) were decreased (p < 0.05) in the LG group on day 14, and creatine kinase (CK) were decreased (p < 0.05) in plasma on day 21.

3.3. The Effects of Dietary Supplementation with LG on Piglet Intestinal Morphology

Results showed that the villus surface area and the ratio of villus height to crypt depth in the jejunum and the ratio of villus height to crypt depth in the ileum were increased (p < 0.05) in the LG group, whereas the crypt depth in the jejunum and ileum and villus surface area in the ileum were decreased (p < 0.05), compared with the control group (Table 4).

3.4. Intestinal Redox Status

Compared with the control group, LG supplementation increased (p < 0.05) the activities of SOD in the ileum and CAT in the colon and decreased (p < 0.05) the activity of GSH-Px in the duodenum and jejunum and the contents of MDA in the jejunum and ileum, and H2O2 in the jejunum (Table 5).

3.5. Protein Abundances

Compared with the control group, piglets in the LG group exhibited an increase (p < 0.05) in the protein abundances of Occludin and MX1. There were no significant differences in other protein abundances, including Villin, Caspase-3, and Bax (Figure 1).

3.6. Gene Expression

Compared with the control group, LG supplementation increased (p < 0.05) the mRNA levels of ERK in the jejunum while decreasing (p < 0.05) the mRNA levels of Bax in the jejunum in the LG group (Table 6).
Compared with the control group, piglets in the LG group exhibited obvious increases (p < 0.05) in the mRNA levels of b0,+AT in the colon, and AQP3 in the ileum and colon, GJA1 in the jejunum, and AQP10 in the ileum (Table 7).
Compared with the control group, LG supplementation increased (p < 0.05) the mRNA levels of NF-κB, IFN-β, MX1, MX2, TLR4, and OASL in the jejunum and TFF3, NF-κB, IFN-α, IFN-β, MX2, and OASL in the ileum (Table 8).
Compared with the control group, piglets in the LG group exhibited significant increases (p < 0.05) in the mRNA levels of IL-1β and IFN-γ in the jejunum and IL-1β, IL-4, CCL-2, and IFN-γ in the ileum, while also exhibiting a decrease in (p < 0.05) the mRNA levels of CXCL-9 in the ileum, and of IFN-γ in the colon (Table S2).
Compared with the control group, LG supplementation increased (p < 0.05) the mRNA levels of LPL, Nrf-2, and GSTO2 in the jejunum and LPL and Nrf-2 in the ileum and INSR in the colon, while also decreasing (p < 0.05) the mRNA levels of I-FABP in the jejunum and I-FABP and PCK1 in the ileum and I-FABP and NOX2 in the colon (Table 9).

4. Discussion

Early weaning causes stress and diarrhea in piglets, which is one of the most challenging problems in the pig industry [1]. Previous research suggested that dietary supplementation with SCFAs could promote intestinal health by improving intestinal absorption and immunity in piglets [18]. Previous studies suggested that dietary supplementation of calcium butyrate significantly reduced diarrhea rates in piglets [19,20]. In good agreement with these studies, our results demonstrated that dietary supplementation with 0.6% LG effectively reduced the diarrhea rate.
Plasma protein synthesized by the liver can be used as an indicator of protein metabolism function, and an increase in total protein in plasma can indicate enhanced immune function [14,21]. In the present study, although dietary LG supplementation decreased the total protein content in plasma on day 7, there was no significant difference at a later stage, which may be because LG helps to improve piglet immunity and promote body protein synthesis. The level of enzyme activity in plasma is an indicator of tissue damage. Alkaline phosphatase (ALP) is a ubiquitous membrane-bound glycoprotein involved in protein phosphorylation and plays a role in the transport of intestinal epithelial cells [22]. The results showed that LG intervention increased plasma ALP activity and may promote protein synthesis in piglets. In addition, ALT, AST, AST/ALT, and ALP in plasma are indicators of liver function, and liver dysfunction causes an increase in AST/ALT activities, which are gradually decreased when liver function is repaired [23,24,25]. In this study, LG intervention decreased AST/ALT activities at day 21, indicating that LG may help repair liver function. Total bilirubin is an indicator of liver function. It has been shown that TBIL content in the plasma is decreased when liver function is enhanced [25]. In good agreement with these studies, our results showed that there was a significant decrease in TBIL levels in the plasma of piglets in the LG group. GGT is an essential enzyme for protein and amino acid metabolism, and it could reflect the injury of various cells by oxygen free radicals [14]. The elevated plasma GGT levels might be an indicator of oxidative stress and liver damage [26]. We found that LG intervention reduced GGT activity in plasma on days 7 and 14, thereby alleviating the stress experienced by piglets at the early weaning stage. Creatine kinase plays an important role in the process of energy metabolism, and its level is often used as an indicator of cardiac and skeletal muscle disease [27]. A previous study suggested that the CK level was increased in blood when the skeletal muscle was compromised. [28]. In this study, we found that LG intervention decreased CK level in plasma on days 14 and 21, indicating that LG may help repair bone damage caused by stress in piglets. These results showed that supplementation with LG could regulate the metabolism of proteins, improve the immune level of piglets, and relieve stress in piglets, which plays a role in protecting functions of the liver and skeletal muscle in piglets.
Insulin receptor (INSR) is a single-pass transmembrane receptor with tyrosine kinase activity, which is primarily involved in cell growth and metabolic homeostasis. Its main function is to mediate IGF-2 and insulin signaling pathways and then regulate the metabolic activity of the body [29]. Lipoprotein lipase (LPL) is one of the key enzymes in the systemic partitioning and metabolism of lipids. It plays an important role in lipid metabolism, transport, and energy metabolism and affects the growth and development of animals [30]. Intestinal fatty acid binding protein (I-FABP) is a key protein in lipid transport and can transport lipids from the intestinal lumen to enterocytes, bind excess fatty acids, and maintain a stable fatty acid pool in epithelial cells [31]. In this study, we found that LG intervention could regulate lipid metabolism, transport, and fat deposition and activate the insulin signaling pathway. Aquaporins (AQPs) are a family of membrane channel proteins, of which AQP3 and AQP10 are important aquaporins, which can rapidly absorb water in the intestinal cavity into the blood and alter the endocrine environment of the intestinal cavity [14,32]. It has been shown that intestinal absorption of basic amino acids mainly transports and absorbs basic amino acids and cystine into epithelial cells through the b0,+ system at the brush border, and b0,+AT plays an important role in the b0,+ system [33]. GJA1 is a gap junction protein that plays an important role in the exchange of nutrients, ions, and cellular regulators between cells [34]. In this study, dietary supplementation with LG significantly increased the mRNA levels of AQP3, AQP10, GJA1, and b0,+AT, suggesting that dietary LG supplementation may improve the transport of water and nutrients in intestinal mucosa, promote the intestinal water metabolism, and effectively relieve diarrhea in piglets.
Indicators of intestinal morphology, such as villus height, surface area, crypt depth, and the ratio of villus height to crypt depth, are commonly used to reflect intestinal morphological development and intestinal morphological integrity. Generally, the decrease in crypt depth and the increases in villus height, and the ratio of villus height to crypt depth reflect improved healthy intestinal development and nutrient absorption [35]. We found that the crypt depth in the jejunum of piglets in the LG group was decreased to a greater extent than the villus height, possibly because LG intervention increased the number of mature cells in the intestinal mucosa and promoted the complete development of the intestinal mucosa, while the growth and proliferation of cells or the cell maturation rate in the intestine had a great relationship with the crypt depth and the increase of the cell maturation rate could reduce the crypt depth. Bax is a representative pro-apoptotic protein in the Bcl-2 family, and Bcl-2 protein can block the apoptosis signal transmission system, thereby inhibiting apoptosis [36]. ERK1/2 is involved in processes such as cell proliferation, growth, and apoptosis [37]. These results showed that LG inhibited intestinal mucosal cell apoptosis by decreasing the relative expression of the Bax gene in the jejunal mucosa. Moreover, the ERK1/2 signaling pathway was activated, and intestinal mucosal growth was promoted by regulating the relative expression of the ERK1/2 gene.
NOX2 is widespread in phagocytes and tissues where it can be activated to induce increased ROS and is one of the major sources of ROS [38]. A previous study found that Nrf2 improves abnormal oxidative stress by increasing the expression of antioxidant-related genes [39]. GSTO2 can affect the expression of corresponding active proteins by changing the transcriptional activity of related genes, thereby regulating the activity of related antioxidant enzymes and reducing the negative effects of oxidative stress [40]. In this study, LG intervention significantly increased the relative expression of Nrf-2, GSTO2 gene in the jejunum, and Nrf-2 gene in the ileum and significantly decreased the relative expression of the NOX2 gene in the colon, suggesting that LG can improve the antioxidant function of the body by regulating the expression of antioxidant related genes. Superoxide dismutase and catalase are antioxidant enzymes, both of which are involved in neutralizing ROS reactions, thereby protecting tissue cells from oxidative damage [41]. MDA is a major product of polyunsaturated fatty acid peroxidation, which can induce toxic stress in cells and is a marker for the assessment of oxidative stress levels in biosomes [42]. H2O2 is the main product of oxidative stress in the body [43]. We found that dietary supplementation with LG increased the activities of SOD in the ileum and CAT in the colon and decreased the contents of MDA in the jejunum and ileum and H2O2 in the jejunum. These results are consistent with Yu et al.‘s study that supplementation of 500 mg/kg B. licheniformis in the diet of weaned piglets enhanced antioxidant capacity [44]. In summary, dietary supplementation of 0.6% LG enhanced the antioxidant capacity of the intestine by regulating the expression of antioxidant-related genes and increasing the activity of intestinal antioxidant enzymes. Of note, dietary LG supplementation improved the activity of SOD in the ileum but decreased the activity of GSH-Px in the duodenum and jejunum. This may be due to the existence of a dynamic balance mechanism in the body’s antioxidant system. When one mechanism is activated, the other may be inhibited [45].
Intestinal trefoil peptide (ITF, i.e., TFF3) plays an important role in maintaining and repairing mucosa, inhibiting tumors, and regulating cell growth and apoptosis in animals [46]. It has been shown that secretion of TFF3 contributes to improving intestinal mucosal morphology, reduces the generation of inflammatory cells, and repairs and maintains intestinal mucosa [47]. Our results are consistent with that study. IFN-α and IFN-β belong to type I interferons, which can induce cells to produce antiviral enzymes to interfere with viral transcription and translation, thereby achieving the effect of inhibiting viral proliferation [48]. MX protein has a wide range of antiviral effects and GTPase activity, MX1 protein inhibits myxovirus replication, and MX2 protein has a strong inhibitory effect on vesicular stomatitis virus [49,50,51]. Zhou et al. found that porcine Mx1 has activity against classical swine fever virus (CSFV) [52]. TLR4 is an important member of TLR, which plays an important role in innate immunity and inflammation by sensing pathogen-associated molecular patterns [53]. It has been shown that TLR4 signaling in macrophages can activate hundreds of genes that contribute to the protection against bacterial infection [54]. Furthermore, 2‘-5’ oligoadenylates synthesis (OAS) is an antiviral protein induced by interferon, of which OASL belongs to this class of proteins [55]. NF-κB can induce the expression of inhibitors of apoptosis (IAP) and certain members of anti-apoptotic Bcl2 by activating the transcription of genes involved in the inhibition of cell death through intrinsic and extrinsic pathways [56]. Occludin protein is an extremely important protein in the TJ, which promotes tight junctions in the intestinal epithelial cell space [57]. In this study, dietary supplementation with LG increased the mRNA levels of TFF3, NF-κB, IFN-α, IFN-β, MX1, MX2, TLR4, and OASL, as well as the protein expression of Occludin and Mx1. These results supported the notion that mono-lactate glyceride could regulate mucosal protection and repair, regulate apoptosis and anti-virus, and then improve intestinal immunity and intestinal barrier function.
IL-1β is a pro-inflammatory cytokine produced by cells of the innate immune system and is essential in host defense responses [58]. It has been shown that short-chain fatty acids are beneficial in increasing the abundance of IL-1beta and IL-6 in the small intestine without producing intestinal inflammation [59]. IL-4, a Th2 cytokine, is an important regulator of the humoral immune response, which can regulate B cells and other non-immune cells and reflect the cellular and humoral immunity of animals [60,61]. These results showed that LG significantly up-regulated the relative expression of IL-1β in jejunal mucosa and IL-4 and IL-1β genes in ileal mucosa and then regulated Thl/Th2 immune balance, thus, LG played an inflammatory regulatory role. IFN-γ is the only member of the type II interferon family and is mainly produced by activated T cells, and has immunomodulatory functions [62]. Chemokine 9 (C-X-C motif 9, CXCL9), a member of the CXC family of chemokines, has the induction and chemotaxis of T cells and monocytes [63]. The C-C motif chemokine ligand 2 (CCL2) is a crucial mediator of immune cell recruitment during microbial infections and tissue damage [64]. Ferrari et al. found that IFN-γ had a synergistic effect on the secretion of CCL2 [65]. In this study, LG intervention significantly up-regulated the relative expression of CCL2 in ileal mucosa and IFN-γ gene in jejunoileal mucosa, indicating that glyceryl mono-lactate can regulate the immune function of the body.

5. Conclusions

Dietary supplementation with 0.6% LG significantly reduced diarrhea by improving intestinal histomorphology, maintaining intestinal integrity, and promoting the intestinal antioxidant capacity and mucosal barrier function, thereby improving intestinal function. Taken together, our results demonstrate the importance of LG in improving gut health in weaned piglets.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani13081303/s1, Figure S1: original western blot figures for Figure 1; Table S1: The effects of dietary supplementation with mono-lactate glyceride (LG) on biochemical indices in the plasma of piglets; Table S2: The effects of mono-lactate glyceride (LG) supplementation on the mRNA levels of genes related to intestinal mucositis in piglets.

Author Contributions

H.L.: writing—original draft. Y.Z.: writing—review & editing. J.X.: data curation. C.W.: validation. D.Y.: investigation. T.W.: formal analysis. L.W.: investigation. D.Z.: investigation. Y.H.: Project administration. All authors have read and agreed to the published version of the manuscript.

Funding

This work was jointly supported by National Natural Science Foundation of China (32172763, 32072762) and Hubei Provincial Key R&D Program (2021BBA083, 2019ABA083).

Institutional Review Board Statement

This study was approved by the Animal Care and Use Committee at Wuhan Polytechnic University (No. WPU201508001, App Date 20 July 2015). All animal experiments were conducted following the guidelines of the Research Ethics Committee of the College of Animal Science and Nutritional Engineering, Wuhan Polytechnic University.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding authors on reasonable request.

Acknowledgments

We thank our students and technicians for their contributions to this research.

Conflicts of Interest

The authors declare that there is no conflict of interest regarding the publication of this paper.

Abbreviations

DRdiarrhea rateIFN-βinterferon-β
MDAmalondialdehydeMX1mucovirus resistance protein I
H2O2hydrogen peroxideMX2mucovirus resistance protein II
SODsuperoxide dismutaseTLR4toll-like receptor 4
CATcatalaseOASL2’-5’-oligoadenylate synthetase-like
GSH-Pxglutathione peroxidaseIL-1βinterleukin-1 beta
ERK1/2extracellular regulated protein kinasesIL-4interleukin-4
Bcl-xlB-cell lymphoma-XLIFN-γinterferon-γ
BaxBCL2-Associated XCCL-2C-C motif chemokine ligand 2
b0,+ATb0,+ amino acid transporterCXCL-9C-X-C motif chemokine 9
AQP3aquaporin 3LPLlipoprotein lipase
GJA1gap junction protein alpha 1I-FABPintestinal fatty acid-binding protein
AQP10aquaporin 10INSRinsulin receptor
TFF3intestinal trefoil peptidePCK1phosphoenolpyruvate Carboxykinase 1
NF-κBnuclear factor kappa-BRPL4ribosomal protein L4
IFN-αinterferon-αF/Gfeed to gain
Nrf2NF-E2-related factor 2ALTalanine aminotransferase
NOX2NADPH oxidase 2ASTaspartate transaminase
GSTO2glutathione S-transferase omega 2TBIL total bilirubin
ADGaverage daily gainTPtotal protein
ADFIaverage daily feed intakeALBalbumin
ALPalkaline phosphataseCHOLtotal cholesterol
CK creatine kinaseBUNblood urea nitrogen
GGT glutamyl transpeptidase

References

  1. Montagne, L.; Boudry, G.; Favier, C.; Le Huërou-Luron, I.; Lallès, J.P.; Sève, B. Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning. Br. J. Nutr. 2007, 97, 45–57. [Google Scholar] [CrossRef] [PubMed]
  2. Barba-Vidal, E.; Martín-Orúe, S.M.; Castillejos, L. Review: Are we using probiotics correctly in post-weaning piglets? Animal 2018, 12, 2489–2498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut Microbiota Dysbiosis in Postweaning Piglets: Understanding the Keys to Health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef] [PubMed]
  4. Hamard, A.; Sève, B.; Le Floc’h, N. Intestinal development and growth performance of early-weaned piglets fed a low-threonine diet. Animal 2007, 1, 1134–1142. [Google Scholar] [CrossRef] [Green Version]
  5. Xu, Y.; Wang, X.; Liu, X.; Li, X.; Zhang, C.; Li, W.; Sun, X.; Wang, W.; Sun, B. Discovery and development of a novel short-chain fatty acid ester synthetic biocatalyst under aqueous phase from Monascus purpureus isolated from Baijiu. Food Chem. 2021, 338, 128025. [Google Scholar] [CrossRef]
  6. Wang, J.; Fu, H.; Geng, X. Application of short-chain fatty acid esters in piglet diet. Feed Wide Horn. 2009, 6, 24–25 + 29. [Google Scholar]
  7. Dong, L.; Zhong, X.; He, J.; Zhang, L.; Bai, K.; Xu, W.; Wang, T.; Huang, X. Supplementation of tributyrin improves the growth and intestinal digestive and barrier functions in intrauterine growth-restricted piglets. Clin. Nutr. 2016, 35, 399–407. [Google Scholar] [CrossRef]
  8. Tian, M.; Li, L.; Tian, Z.; Zhao, H.; Chen, F.; Guan, W.; Zhang, S. Glyceryl butyrate attenuates enterotoxigenic Escherichia coli-induced intestinal inflammation in piglets by inhibiting the NF-κB/MAPK pathways and modulating the gut microbiota. Food Funct. 2022, 13, 6282–6292. [Google Scholar] [CrossRef]
  9. Ni, Y.-F.; Wang, J.; Yan, X.-L.; Tian, F.; Zhao, J.-B.; Wang, Y.-J.; Jiang, T. Histone deacetylase inhibitor, butyrate, attenuates lipopolysaccharide-induced acute lung injury in mice. Respir. Res. 2010, 11, 33. [Google Scholar] [CrossRef] [Green Version]
  10. Alva-Murillo, N.; Ochoa-Zarzosa, A.; López-Meza, J.E. Short chain fatty acids (propionic and hexanoic) decrease Staphylococcus aureus internalization into bovine mammary epithelial cells and modulate antimicrobial peptide expression. Vet. Microbiol. 2012, 155, 324–331. [Google Scholar] [CrossRef]
  11. Sunkara, L.T.; Jiang, W.; Zhang, G. Modulation of antimicrobial host defense peptide gene expression by free fatty acids. PLoS ONE 2012, 7, e49558. [Google Scholar] [CrossRef] [Green Version]
  12. Beards, E.; Tuohy, K.; Gibson, G. Bacterial, SCFA and gas profiles of a range of food ingredients following in vitro fermentation by human colonic microbiota. Anaerobe 2010, 16, 420–425. [Google Scholar] [CrossRef]
  13. Tan, J.; McKenzie, C.; Potamitis, M.; Thorburn, A.N.; Mackay, C.R.; Macia, L. The role of short-chain fatty acids in health and disease. Adv. Immunol. 2014, 121, 91–119. [Google Scholar]
  14. Wu, T.; Li, K.; Yi, D.; Wang, L.; Zhao, D.; Lv, Y.; Zhang, L.; Chen, H.; Ding, B.; Hou, Y.; et al. Dietary Supplementation with Trihexanoin Enhances Intestinal Function of Weaned Piglets. Int. J. Mol. Sci. 2018, 19, 3277. [Google Scholar] [CrossRef] [Green Version]
  15. Wu, M.; Yi, D.; Zhang, Q.; Wu, T.; Yu, K.; Peng, M.; Wang, L.; Zhao, D.; Hou, Y.; Wu, G. Puerarin enhances intestinal function in piglets infected with porcine epidemic diarrhea virus. Sci. Rep. 2021, 11, 6552. [Google Scholar] [CrossRef]
  16. Hou, Y.; Yao, K.; Wang, L.; Ding, B.; Fu, D.; Liu, Y.; Zhu, H.; Liu, J.; Li, Y.; Kang, P.; et al. Effects of α-ketoglutarate on energy status in the intestinal mucosa of weaned piglets chronically challenged with lipopolysaccharide. Br. J. Nutr. 2011, 106, 357–363. [Google Scholar] [CrossRef] [Green Version]
  17. Yi, D.; Hou, Y.; Wang, L.; Zhao, D.; Ding, B.; Wu, T.; Chen, H.; Liu, Y.; Kang, P.; Wu, G. Gene expression profiles in the intestine of lipopolysaccharide-challenged piglets. Front. Biosci. 2016, 21, 487–501. [Google Scholar]
  18. Zhou, H.; Sun, J.; Ge, L.; Liu, Z.; Chen, H.; Yu, B.; Chen, D. Exogenous infusion of short-chain fatty acids can improve intestinal functions independently of the gut microbiota. J. Anim. Sci. 2020, 98, skaa371. [Google Scholar] [CrossRef]
  19. Maito, C.D.; Melo, A.D.B.; Oliveira, A.C.D.F.D.; Genova, J.L.; Filho, J.R.E.; de Macedo, R.E.F.; Monteiro, K.M.; Weber, S.H.; Koppenol, A.; Costa, L.B. Simultaneous feeding of calcium butyrate and tannin extract decreased the incidence of diarrhea and proinflammatory markers in weaned piglets. Anim. Biosci. 2022, 35, 87–95. [Google Scholar] [CrossRef]
  20. Huang, C.; Song, P.; Fan, P.; Hou, C.; Thacker, P.; Ma, X. Dietary Sodium Butyrate Decreases Postweaning Diarrhea by Modulating Intestinal Permeability and Changing the Bacterial Communities in Weaned Piglets. J. Nutr. 2015, 145, 2774–2780. [Google Scholar] [CrossRef] [Green Version]
  21. Yu, H.; Liang, H.; Ren, M.; Ji, K.; Yang, Q.; Ge, X.; Xi, B.; Pan, L. Effects of dietary fenugreek seed extracts on growth performance, plasma biochemical parameters, lipid metabolism, Nrf2 antioxidant capacity and immune response of juvenile blunt snout bream (Megalobrama amblycephala). Fish Shellfish. Immunol. 2019, 94, 211–219. [Google Scholar] [CrossRef] [PubMed]
  22. Sharma, U.; Pal, D.; Prasad, R. Alkaline phosphatase: An overview. Indian J. Clin. Biochem. 2013, 29, 269–278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Miandare, H.K.; Niknejad, M.; Shabani, A.; Safari, R. Exposure of Persian sturgeon (Acipenser persicus) to cadmium results in biochemical, histological and transcriptional alterations. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2016, 181–182, 1–8. [Google Scholar] [CrossRef] [PubMed]
  24. Huo, J.; Dong, A.; Yan, J.; Dong, A. Effects of cadmium on the activities of ALT and AST as well as the content of TP in plasma of freshwater turtle Mauremys reevesii. Environ. Sci. Pollut. Res. Int. 2020, 27, 18025–18028. [Google Scholar] [CrossRef] [PubMed]
  25. Lei, F.; Liu, Y.; Zhou, F.; Qin, J.; Zhang, P.; Zhu, L.; Zhang, X.; Cai, J.; Lin, L.; Ouyang, S.; et al. Longitudinal Association Between Markers of Liver Injury and Mortality in COVID-19 in China. Hepatology 2020, 72, 389–398. [Google Scholar] [CrossRef]
  26. Yu, K.; Canalias, F.; Solà-Oriol, D.; Arroyo, L.; Pato, R.; Saco, Y.; Terré, M.; Bassols, A. Age-Related Serum Biochemical Reference Intervals Established for Unweaned Calves and Piglets in the Post-weaning Period. Front. Vet. Sci. 2019, 6, 123. [Google Scholar] [CrossRef]
  27. McLeish, M.J.; Kenyon, G.L. Relating Structure to Mechanism in Creatine Kinase. Crit. Rev. Biochem. Mol. Biol. 2005, 40, 1–20. [Google Scholar] [CrossRef]
  28. Schlattner, U.; Tokarska-Schlattner, M.; Wallimann, T. Mitochondrial creatine kinase in human health and disease. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2006, 1762, 164–180. [Google Scholar] [CrossRef]
  29. Payankaulam, S.; Raicu, A.-M.; Arnosti, D.N. Transcriptional Regulation of INSR, the Insulin Receptor Gene. Genes 2019, 10, 984. [Google Scholar] [CrossRef] [Green Version]
  30. Wu, S.A.; Kersten, S.; Qi, L. Lipoprotein Lipase and Its Regulators: An Unfolding Story. Trends Endocrinol. Metab. 2021, 32, 48–61. [Google Scholar] [CrossRef]
  31. Huang, X.; Zhou, Y.; Sun, Y.; Wang, Q. Intestinal fatty acid binding protein: A rising therapeutic target in lipid metabolism. Prog. Lipid. Res. 2022, 87, 101178. [Google Scholar] [CrossRef]
  32. Yang, M.; Gao, F.; Liu, H.; Yu, W.H.; Zhuo, F.; Qiu, G.P.; Ran, J.H.; Sun, S.Q. Hyperosmotic induction of aquaporin expression in rat astrocytes through a different MAPK pathway. J. Cell. Biochem. 2012, 114, 111–119. [Google Scholar] [CrossRef]
  33. Romeo, E.; Dave, M.H.; Bacic, D.; Ristic, Z.; Camargo, S.M.R.; Loffing, J.; Wagner, C.A.; Verrey, F. Luminal kidney and intestine SLC6 amino acid transporters of B0AT-cluster and their tissue distribution in Mus musculus. Am. J. Physiol. Physiol. 2006, 290, F376–F383. [Google Scholar] [CrossRef] [Green Version]
  34. Beyer, E.C.; Berthoud, V.M. Gap junction gene and protein families: Connexins, innexins, and pannexins. Biochim. Biophys. Acta (BBA) Biomembr. 2018, 1860, 5–8. [Google Scholar] [CrossRef]
  35. Wang, K.; Cao, G.; Zhang, H.; Li, Q.; Yang, C. Effects of Clostridium butyricum and Enterococcus faecalis on growth performance, immune function, intestinal morphology, volatile fatty acids, and intestinal flora in a piglet model. Food Funct. 2019, 10, 7844–7854. [Google Scholar] [CrossRef]
  36. Zheng, J.Y.; Boustany, N.N. Alterations in the characteristic size distributions of subcellular scatterers at the onset of apoptosis: Effect of Bcl-xL and Bax/Bak. J. Biomed. Opt. 2010, 15, 045002. [Google Scholar] [CrossRef] [Green Version]
  37. Roskoski, R., Jr. ERK1/2 MAP kinases: Structure, function, and regulation. Pharmacol. Res. 2012, 66, 105–143. [Google Scholar] [CrossRef]
  38. Satoh, M.; Fujimoto, S.; Haruna, Y.; Arakawa, S.; Horike, H.; Komai, N.; Sasaki, T.; Tsujioka, K.; Makino, H.; Kashihara, N. NAD(P)H oxidase and uncoupled nitric oxide synthase are major sources of glomerular superoxide in rats with experimental diabetic nephropathy. Am. J. Physiol. Physiol. 2005, 288, F1144–F1152. [Google Scholar] [CrossRef]
  39. Ko, K.; Wahyudi, L.D.; Kwon, Y.-S.; Kim, J.-H.; Yang, H. Nuclear Factor Erythroid 2-Related Factor 2 Activating Triterpenoid Saponins from Camellia japonica Roots. J. Nat. Prod. 2018, 81, 2399–2409. [Google Scholar] [CrossRef]
  40. Ozturk, A.; Desai, P.P.; Minster, R.L.; Dekosky, S.T.; Kamboh, M.I. Three SNPs in the GSTO1, GSTO2 and PRSS11 genes on chromosome 10 are not associated with age-at-onset of Alzheimer’s disease. Neurobiol. Aging. 2005, 26, 1161–1165. [Google Scholar] [CrossRef]
  41. Cecerska-Heryć, E.; Surowska, O.; Heryć, R.; Serwin, N.; Napiontek-Balińska, S.; Dołęgowska, B. Are antioxidant enzymes essential markers in the diagnosis and monitoring of cancer patients—A review. Clin. Biochem. 2021, 93, 1–8. [Google Scholar] [CrossRef] [PubMed]
  42. Del Rio, D.; Stewart, A.J.; Pellegrini, N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr. Metab. Cardiovasc. Dis. 2005, 15, 316–328. [Google Scholar] [CrossRef] [PubMed]
  43. Sies, H. Role of metabolic H2O2 generation: Redox signaling and oxidative stress. J. Biol. Chem. 2014, 289, 8735–8741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Yu, X.; Cui, Z.; Qin, S.; Zhang, R.; Wu, Y.; Liu, J.; Yang, C. Effects of Bacillus licheniformis on Growth Performance, Diarrhea Incidence, Antioxidant Capacity, Immune Function, and Fecal Microflora in Weaned Piglets. Animals 2022, 12, 1609. [Google Scholar] [CrossRef]
  45. Alkadi, H. A Review on Free Radicals and Antioxidants. Infect. Disord. Drug Targets 2020, 20, 16–26. [Google Scholar]
  46. Peng, X.; Sun, Y.; Zhang, Y.; Lv, S.; Wu, W.; Wang, S. Stability and biological activity of human intestinal trefoil factor produced by Pichia pastoris. Protein Pept. Lett. 2008, 15, 255–259. [Google Scholar] [CrossRef]
  47. Li, H.; Xu, C.; Wen, B.; Li, A.; Zha, G.; Jin, X.; Zhao, Y.; Feng, L.; Cao, Y.; Yang, G.; et al. Extracellular production of recombinant sus scrofa trefoil factor 3 by Brevibacillus choshinensis. Exp. Ther. Med. 2020, 19, 2149–2154. [Google Scholar] [CrossRef] [Green Version]
  48. Tan, P.-H.; Ji, J.; Yeh, C.-C.; Ji, R.-R. Interferons in Pain and Infections: Emerging Roles in Neuro-Immune and Neuro-Glial Interactions. Front. Immunol. 2021, 12, 783725. [Google Scholar] [CrossRef]
  49. Pavlovic, J.; Schröder, A.; Blank, A.; Pitossi, F.; Staeheli, P. Mx proteins: GTPases involved in the interferon-induced antiviral state. Ciba Found. Symp. 1993, 176, 233–243, discussion 243–247. [Google Scholar]
  50. Calmon, M.F.; Rodrigues, R.V.; Kaneto, C.M.; Moura, R.P.; Silva, S.D.; Mota, L.D.C.; Pinheiro, D.G.; Torres, C.; de Carvalho, A.F.; Cury, P.M.; et al. Epigenetic silencing of CRABP2 and MX1 in head and neck tumors. Neoplasia 2009, 11, 1329–1339. [Google Scholar] [CrossRef]
  51. Jin, H.K.; Takada, A.; Kon, Y.; Haller, O.; Watanabe, T. Identification of the murine MX2 gene: Interferon-induced expression of the MX2 protein from the feral mouse gene confers resistance to vesicular stomatitis virus. J. Virol. 1999, 73, 4925–4930. [Google Scholar] [CrossRef] [Green Version]
  52. Zhou, J.; Chen, J.; Zhang, X.-M.; Gao, Z.-C.; Liu, C.-C.; Zhang, Y.-N.; Hou, J.-X.; Li, Z.-Y.; Kan, L.; Li, W.-L.; et al. Porcine Mx1 Protein Inhibits Classical Swine Fever Virus Replication by Targeting Nonstructural Protein NS5B. J. Virol. 2018, 92, e02147-17. [Google Scholar] [CrossRef] [Green Version]
  53. Niu, Y.; Zhao, Y.; He, J.; Yun, Y.; Shen, M.; Gan, Z.; Zhang, L.; Wang, T. Dietary dihydroartemisinin supplementation alleviates intestinal inflammatory injury through TLR4/NOD/NF-κB signaling pathway in weaned piglets with intrauterine growth retardation. Anim. Nutr. 2021, 7, 667–678. [Google Scholar] [CrossRef]
  54. Wang, J.; Pan, Z.; Zheng, X.; Wu, Z.; Su, X.; Zhu, G.; Huang, X.; Wu, S.; Bao, W. TLR4 gene expression in pig populations and its association with resistance to Escherichia coli F18. Genet. Mol. Res. 2013, 12, 2625–2632. [Google Scholar] [CrossRef]
  55. Leisching, G.; Wiid, I.; Baker, B. The Association of OASL and Type I Interferons in the Pathogenesis and Survival of Intracellular Replicating Bacterial Species. Front. Cell. Infect. Microbiol. 2017, 7, 196. [Google Scholar] [CrossRef] [Green Version]
  56. Dolcet, X.; Llobet, D.; Pallares, J.; Matias-Guiu, X. NF-kB in development and progression of human cancer. Virchows Arch. 2005, 446, 475–482. [Google Scholar] [CrossRef]
  57. Feldman, G.J.; Mullin, J.M.; Ryan, M.P. Occludin: Structure, function and regulation. Adv. Drug Deliv. Rev. 2005, 57, 883–917. [Google Scholar] [CrossRef]
  58. Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1β secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef]
  59. Milo, L.; Reardon, K.; Tappenden, K. Effects of short-chain fatty acid-supplemented total parenteral nutrition on intestinal pro-inflammatory cytokine abundance. Dig. Dis. Sci. 2002, 47, 2049–2055. [Google Scholar] [CrossRef]
  60. Wang, N.; Shen, O.; Bai, H. Research progress of Interleukin-4 Gene. Chin. J. Anim. Husb. Vet. Med. 2005, 1, 23–25. [Google Scholar]
  61. Mosmann, T.R.; Sad, S. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol. Today 1996, 17, 138–146. [Google Scholar] [CrossRef] [PubMed]
  62. Lin, F.-C.; Young, H.A. Interferons: Success in anti-viral immunotherapy 2014, 25, 369–376. Cytokine Growth Factor Rev. 2014, 25, 369–376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Tokunaga, R.; Zhang, W.; Naseem, M.; Puccini, A.; Berger, M.D.; Soni, S.; McSkane, M.; Baba, H.; Lenz, H.J. CXCL9, CXCL10, CXCL11/CXCR3 axis for immune activation—A target for novel cancer therapy. Cancer Treat. Rev. 2018, 63, 40–47. [Google Scholar] [CrossRef] [PubMed]
  64. O’Connor, T.; Heikenwalder, M. CCL2 in the Tumor Microenvironment. Adv. Exp. Med. Biol. 2021, 1302, 1–14. [Google Scholar]
  65. Ferrari, S.M.; Elia, G.; Piaggi, S.; Baldini, E.; Ulisse, S.; Miccoli, M.; Materazzi, G.; Antonelli, A.; Fallahi, P. CCL2 is Modulated by Cytokines and PPAR-γ in Anaplastic Thyroid Cancer. Anti-Cancer Agents Med. Chem. 2018, 18, 458–466. [Google Scholar] [CrossRef]
Animals 13 01303 g001 550
Figure 1. Effect of mono-lactate glyceride (LG) on relative expression of Villin, Occludin, Caspase3, Bax, and MX1 in jejunum of weaned piglets Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05). Original western blot figures in Figure S1.
Figure 1. Effect of mono-lactate glyceride (LG) on relative expression of Villin, Occludin, Caspase3, Bax, and MX1 in jejunum of weaned piglets Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05). Original western blot figures in Figure S1.
Animals 13 01303 g001
Table
Table 1. Basal diet composition and nutrient content (air-dried basis) %.
Table 1. Basal diet composition and nutrient content (air-dried basis) %.
IngredientContentNutrient LevelContent
Corn38.40DE (MJ/kg)14.27
Soybean meal16.00CP18.54
Flour12.00Lys1.50
Whey powder (low Protein)8.00Met0.42
Soybean protein concentrate5.00Met + Cys0.71
Wheat middling5.00Thr0.93
Fish meal4.50Trp0.23
Glucose3.00Ca0.75
CaHPO41.33AP0.49
Limestone0.37TP0.68
NaCl0.25Na0.31
Plant oil3.95CF6.26
a Premix1.00NaCl0.61
Lys0.64
Met0.13
Thr0.21
Choline0.12
Mildew preventive0.10
a Premix is provided per kg ration: Fe 100 mg; Cu 150 mg; Mn 40 mg; Zn 100 mg; I 0.5 mg; Se 0.3 mg; VA 1800 IU; VD3 4000 IU; VE 40 IU; VK 34 mg; Thiamine (VB1) 6 mg; Riboflavin (VB2) 12 mg; Pyridoxine (VB6) 6 mg; Cobalamin (VB12) 0.05mg; Biotin 0.2 mg; Folic acid 2 mg; Niacin 50 mg; Calcium pantothenate 5 mg.
Table
Table 2. Primers for real-time PCR analysis.
Table 2. Primers for real-time PCR analysis.
GenesForward SequencesReverse Sequences
Bcl-xlTGAATCAGAAGCGGAAACCCGCTCTAGGTGGTCATTCAGGTAAG
ERKAAGCTCTTGAAGACGCAGCACCAGCAGGTTGGAAGGTTTGAG
BaxTTTCTGACGGCAACTTCAACTGAGCCACAAAGATGGTCACTGTCT
b0,+ATCGAGTACCCGTACCTGATGGATGCGTAGAAGGGCGAAGAA
AQP3AAGCTGTCCCAAGTAAAGCACAAGCCCTACTTCCTGTTTCACCAC
GJA1CAAATCCTTCCCCATCTCTCACTCAGTTTCTCTTCCTTTCGCATC
AQP10TGTCTGCTTTCTGTGCCTCTGGGATGCCATTGCTCAAGGATAGATAA
TFF3AGTGTGCCGTCCCTGCCAAGGCAGCCCCGGTTGTTGCACT
NF-κBCTCGCACAAGGAGACATGAAACTCAGCCGGAAGGCATTAT
IFN-αACTCCATCCTGGCTGTGAGGAAATATCTCATGACTTCTGCCCTGACGA
IFN-βATGTCAGAAGCTCCTGGGACAGTTAGGTCATCCATCTGCCCATCAAGT
MX1AGTGCGGCTGTTTACCAAGTTCACAAACCCTGGCAACTC
MX2CGCATTCTTTCACTCGCATCCCTCAACCCACCAACTCACA
TLR4GCCTTTCTCTCCTGCCTGAGAGCTCCATGCATTGGTAACTAATG
OASLGGCACCCCTGTTTTCCTCTAGCACCGCTTTTGGATGG
IL-1βCAACGTGCAGTCTATGGAGTGAGGTGCTGATGTACCAGTTG
IL-4TACCAGCAACTTCGTCCACATCGTCTTTAGCCTTTCCAA
IFN-γTCTGGGAAACTGAATGACTTCGGACTTCTCTTCCGCTTTCTTAGGTT
CCL-2CATAAGCCACCTGGACAAGAAAAGGGTATTTAGGGCAAGTTAGAAGGA
CXCL-9CTTGCTTTTGGGTATCATCTTCCTTCATCCTTTGGCTGGTGTTG
LPLAGCCTGAGTTGGACCCATGTCTCTGTTTTCCCTTCCTCTCTCC
I-FABPAGATAGACCGCAATGAGATCCTTCTTGTGTAATTATCATCAGT
INSRGGGGCTAAAGAGGAACTATGAGGAGAGGAAAGCGAAGACAGGAAA
PCK1CGGGATTTCGTGGAGACCTCTTGATGACACCCTCT
Nrf2GAAGTGATCCCCTGATGTTGCATGCCTTCTCTTTCCCCTATTTCT
NOX2TGTATCTGTGTGAGAGGCTGGTGCGGGACGCTTGACGAAA
GSTO2GCCTTGAGATGTGGGAGAGAAAAGATGGTGTTCTGATAGCCAAGA
RPL4GAGAAACCGTCGCCGAATGCCCACCAGGAGCAAGTT
Table
Table 3. The effects of dietary supplementation with mono-lactate glyceride (LG) on the growth performance and diarrhea rate of piglets.
Table 3. The effects of dietary supplementation with mono-lactate glyceride (LG) on the growth performance and diarrhea rate of piglets.
ItemsControlLGp-Value
0–10 days
ADG (g)239.40 ± 84.79262.60 ± 46.960.459
ADFI (g)295.35 ± 70.08296.18 ± 30.610.981
F/G1.28 ± 0.211.15 ± 0.230.390
DR (%)27.00 a 13.00 b 0.013
10–21 days
ADG (g)403.27 ± 119.00425.82 ± 82.120.628
ADFI (g)592.00 ± 122.76634.09 ± 46.560.494
F/G1.48 ± 0.061.51 ± 0.210.770
DR (%)11.80 a 2.70 b 0.009
0–21 days
ADG (g)325.24 ± 97.15348.10 ± 43.530.506
ADFI (g)450.74 ± 96.12473.18 ± 29.660.631
F/G1.40 ± 0.101.37 ± 0.160.697
DR (%)19.00 a 7.60 b 0.001
Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05).
Table
Table 4. The effects of dietary supplementation with mono-lactate glyceride (LG) on piglet intestinal morphology.
Table 4. The effects of dietary supplementation with mono-lactate glyceride (LG) on piglet intestinal morphology.
ItemJejunumIleum
ControlLGp-ValueControlLGp-Value
Villus height (µm)304.4 ± 26.8335.0 ± 40.10.075237.6 ± 26.8221.8 ± 32.80.281
Crypt depth (µm)223.2 ± 19.0 a180.9 ± 12.9 b<0.001168.9 ± 17.9 a140.0 ± 17.0 b0.003
Ratio of villus height/crypt depth1.37 ± 0.08 b1.85 ± 0.20 a<0.0011.41 ± 0.09 b1.58 ± 0.06 a<0.001
Villus surface area (µm2)27,127 ± 291730,727 ± 41860.05026,287 ± 750 a23,224 ± 3256 b0.014
Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05).
Table
Table 5. The effects of dietary supplementation with mono-lactate glyceride (LG) on intestinal redox status of piglets.
Table 5. The effects of dietary supplementation with mono-lactate glyceride (LG) on intestinal redox status of piglets.
ItemsControlLGp-ValueControlLGp-Value
Duodenum Ileum
SOD (U/mg)42.25 ± 3.7642.11 ± 3.090.93984.16 ± 6.22 b110.03 ± 23.44 a0.009
GSH-Px (U/mg)45.82 ± 8.31 a32.56 ± 6.40 b0.00373.60 ± 16.4687.31 ± 14.840.161
CAT (U/mg)17.92 ± 4.4116.11 ± 2.390.3259.54 ± 3.088.84 ± 2.800.641
H2O2 (nmol/mg)5.06 ± 1.115.16 ± 1.360.8698.34 ± 1.809.81 ± 2.450.191
MDA (nmol/mg)3.99 ± 1.185.06 ± 1.500.1366.57 ± 1.78 a4.66 ± 1.12 b0.022
Jejunum Colon
SOD (U/mg)85.39 ± 11.4093.66 ± 14.660.228100.54 ± 25.07112.40 ± 17.820.294
GSH-Px (U/mg)14.01 ± 4.74 a8.40 ± 1.99 b0.01437.31 ± 7.1530.44 ± 10.520.215
CAT (U/mg)7.64 ± 1.227.98 ± 1.050.6546.56 ± 1.15 b9.21 ± 1.62 a0.018
H2O2 (nmol/mg)28.16 ± 7.23 a20.46 ± 5.14 b0.02825.25 ± 6.4327.59 ± 6.810.491
MDA (nmol/mg)10.55 ± 3.45 a4.73 ± 1.32 b0.001---
Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05).
Table
Table 6. The effects of mono-lactate glyceride (LG) supplementation on the mRNA levels of genes related to proliferation and growth of jejunal mucosa in piglets.
Table 6. The effects of mono-lactate glyceride (LG) supplementation on the mRNA levels of genes related to proliferation and growth of jejunal mucosa in piglets.
ItemsControlLGp-Value
Bc1-x11.00 ± 0.091.10 ± 0.170.172
ERK1.00 ± 0.10 b1.16 ± 0.07 a0.003
Bax1.00 ± 0.12 a0.78 ± 0.16 b0.010
Values are mean and SD, n = 8. a,b Values within a row with different letters differ p < 0.05).
Table
Table 7. The effects of mono-lactate glyceride (LG) supplementation on mRNA levels of genes related to transport channel-related in piglets.
Table 7. The effects of mono-lactate glyceride (LG) supplementation on mRNA levels of genes related to transport channel-related in piglets.
ItemsJejunumIleumColon
ControlLGp-ValueControlLGp-ValueControlLGp-Value
b0,+AT------1.00 ± 0.22 b1.62 ± 0.40 a0.002
AQP3---1.00 ± 0.22 b2.32 ± 0.39 a<0.0011.00 ± 0.23 b1.67 ± 0.37 a0.001
GJA11.00 ± 0.20 b1.21 ± 0.18 a0.0401.00 ± 0.180.84 ± 0.140.071---
AQP10---1.00 ± 0.22 b2.99 ± 0.76 a<0.001---
Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05).
Table
Table 8. The effects of mono-lactate glyceride (LG) supplementation on mRNA levels of genes related to intestinal mucosal immunity in piglets.
Table 8. The effects of mono-lactate glyceride (LG) supplementation on mRNA levels of genes related to intestinal mucosal immunity in piglets.
ItemsJejunumIleumColon
ControlLGp-ValueControlLGp-ValueControlLGp-Value
TFF31.00 ± 0.200.86 ± 0.120.1091.00 ± 0.15 b1.26 ± 0.27 a0.0291.00 ± 0.131.06 ± 0.210.536
NF-κB1.00 ± 0.10 b1.13 ± 0.07 a0.0091.00 ± 0.10 b1.22 ± 0.07 a<0.0011.00 ± 0.101.07 ± 0.100.211
IFN-α1.00 ± 0.200.88 ± 0.100.1431.00 ± 0.16 b1.55 ± 0.36 a0.0021.00 ± 0.250.83 ± 0.150.126
IFN-β1.00 ± 0.26 b1.67 ± 0.38 a0.0011.00 ± 0.24 b1.69 ± 0.42 a0.0011.00 ± 0.141.02 ± 0.170.772
MX11.00 ± 0.24 b1.82 ± 0.47 a0.0011.00 ± 0.141.00 ± 0.210.9891.00 ± 0.171.26 ± 0.320.057
MX21.00 ± 0.27 b2.39 ± 0.54 a<0.0011.00 ± 0.14 b2.09 ± 0.47 a<0.0011.00 ± 0.220.89 ± 0.190.291
TLR41.00 ± 0.14 b1.23 ± 0.24 a0.0361.00 ± 0.050.99 ± 0.030.7961.00 ± 0.141.04 ± 0.230.672
OASL1.00 ± 0.18 b2.72 ± 0.59 a<0.0011.00 ± 0.25 b1.90 ± 0.39 a<0.0011.00 ± 0.260.94 ± 0.200.631
Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05).
Table
Table 9. The effects of mono-lactate glyceride (LG) supplementation on the mRNA levels of genes related to energy metabolism in intestinal mucosa and intestinal mucosal oxidation in piglets.
Table 9. The effects of mono-lactate glyceride (LG) supplementation on the mRNA levels of genes related to energy metabolism in intestinal mucosa and intestinal mucosal oxidation in piglets.
ItemsJejunumIleumColon
ControlLGp-ValueControlLGp-ValueControlLGp-Value
LPL1.00 ± 0.23 b2.22 ± 0.30 a<0.0011.00 ± 0.20 b1.38 ± 0.33 a0.0141.00 ± 0.201.05 ± 0.190.600
I-FABP1.00 ± 0.22 a0.71 ± 0.13 b0.0071.00 ± 0.27 a0.76 ± 0.15 b0.0401.00 ± 0.19 a0.66 ± 0.15 b0.001
INSR1.00 ± 0.190.87 ± 0.120.1311.00 ± 0.241.17 ± 0.260.2011.00 ± 0.20 b1.29 ± 0.29 a0.037
PCK11.00 ± 0.200.86 ± 0.220.2091.00 ± 0.28 a0.73 ± 0.20 b0.0441.00 ± 0.201.04 ± 0.190.719
NOX21.00 ± 0.150.97 ± 0.210.7621.00 ± 0.171.09 ± 0.260.4281.00 ± 0.19 a0.77 ± 0.15 b0.017
Nrf-21.00 ± 0.20 b1.41 ± 0.33 a0.0091.00 ± 0.20 b1.29 ± 0.27 a0.0281.00 ± 0.220.92 ± 0.180.464
GSTO21.00 ± 0.13 b1.34 ± 0.21 a0.0021.00 ± 0.091.17 ± 0.230.0741.00 ± 0.221.05 ± 0.280.691
Values are mean and SD, n = 8. a,b Values within a row with different letters differ (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, H.; Zhang, Y.; Xie, J.; Wang, C.; Yi, D.; Wu, T.; Wang, L.; Zhao, D.; Hou, Y. Dietary Supplementation with Mono-Lactate Glyceride Enhances Intestinal Function of Weaned Piglets. Animals 2023, 13, 1303. https://doi.org/10.3390/ani13081303

AMA Style

Li H, Zhang Y, Xie J, Wang C, Yi D, Wu T, Wang L, Zhao D, Hou Y. Dietary Supplementation with Mono-Lactate Glyceride Enhances Intestinal Function of Weaned Piglets. Animals. 2023; 13(8):1303. https://doi.org/10.3390/ani13081303

Chicago/Turabian Style

Li, Hanbo, Yanyan Zhang, Jiaqian Xie, Chao Wang, Dan Yi, Tao Wu, Lei Wang, Di Zhao, and Yongqing Hou. 2023. "Dietary Supplementation with Mono-Lactate Glyceride Enhances Intestinal Function of Weaned Piglets" Animals 13, no. 8: 1303. https://doi.org/10.3390/ani13081303

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop