Next Article in Journal
Sex Determination in Japanese Quails (Coturnix japonica) Using Geometric Morphometrics of the Skull
Previous Article in Journal
Analysis of Indirect Biomarkers of Effect after Exposure to Low Doses of Bisphenol A in a Study of Successive Generations of Mice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 3
10.3390/ani12030301
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Virulence Factors in Enterotoxin-Producing Staphylococcus aureus from Bulk Tank Milk

by
Hye-Ri Jung
and
Young Ju Lee
*
College of Veterinary Medicine & Zoonoses Research Institute, Kyungpook National University, Daegu 41566, Korea
*
Author to whom correspondence should be addressed.
Animals 2022, 12(3), 301; https://doi.org/10.3390/ani12030301
Submission received: 23 December 2021 / Revised: 22 January 2022 / Accepted: 23 January 2022 / Published: 26 January 2022
(This article belongs to the Section Veterinary Clinical Studies)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Staphylococcus aureus, apathogen that causes bovine mastitis, produces various virulence factors, and human consumption of milk contaminated with the S. aureus enterotoxin may pose a public health risk. This study analyzed the genetic characteristics of bovine-mastitis-related virulence factors to evaluate the potential pathogenesis of S. aureus isolated from bulk tank milk. The results show that S. aureus isolated from bulk tank milk, not from mastitis, had a high prevalence of virulence factors and that the high presence of enterotoxins may be due to poor hygiene. Therefore, developing a strong monitoring and sanitation program for dairy factories is important to ensure hygienic milk production.

Abstract

Staphylococcus aureus, a persistent mastitis-causing pathogen, produces various virulence factors, including enterotoxins. This study analyzed the genetic characteristics of bovine-mastitis-related virulence factors to evaluate the potential pathogenesis of S. aureus isolated from bulk tank milk. Among 93 S. aureus isolates from 396 dairy farms operated by 3 dairy companies in Korea, 40 (43.0%) isolates carried one or more enterotoxin genes. Moreover, S. aureus carrying enterotoxin genes showed a higher prevalence in all virulence genes tested in this study except for pvl and lukM, which were not detected in any isolate, than in the isolates without enterotoxin genes. In particular, the prevalence of six genes (hla, hlb, lukED, fnbA, clfA, and clfB) was significantly higher in S. aureus carrying the enterotoxin genes than in the isolates without the enterotoxin genes (p < 0.05). The most common multilocus sequence type of enterotoxin-producing isolates was ST188, and all isolates of ST188 harbored the see gene. S. aureus isolated from bulk tank milk, not from mastitis, had a high prevalence of virulence factors, posing a public health threat. Moreover, a high presence of enterotoxins in bulk tank milk is probably because of poor hygiene; therefore, it is important to develop strong monitoring and sanitation programs for dairy factories.

1. Introduction

Staphylococcus aureus (S. aureus) is one of the most common pathogens causing contagious mastitis in the dairy industry [1]. In particular, S. aureus is persistent and causes chronic mastitis, and consumption of these dairy products transmits virulence factors from the contaminated milk to humans and may pose a public health risk [2,3].
S. aureus has various virulence factors, such as toxic shock syndrome toxin-1 (TSST-1), enterotoxins, and leukotoxins. In particular, the staphylococcal enterotoxin, belonging to the superantigen family, is the most potent because it can induce polyclonal activation of T cells at picomolar concentrations [4]. This activity is suspected to enhance virulence by inhibiting the host response to staphylococcal antigens produced during infection or present during toxinoses. Moreover, ingestion of enterotoxins causes severe food poisoning with vomiting, nausea, and diarrhea [5]. To date, more than 20 types of enterotoxins have been identified, of which classical enterotoxin types (sea-see) pose serious public health concerns because they retain their biological and immunological activities after pasteurization [6]. Additionally, classical enterotoxins account for more than 90% of staphylococcal food poisoning cases worldwide [7], and some new enterotoxins (seg-sei) exhibit emetic activity [5].
Other virulence factors, such as adhesion and biofilm-related genes in S. aureus, can also cause various diseases in humans, ranging from mild skin infections to severe life-threatening infections. Moreover, Panton–Valentine leukocidin (PVL) disrupts the membranes of host defense cells and erythrocytes by the synergistic action of two specific proteins, lukS-PV and lukF-PV; therefore, it is also associated with bovine mastitis [8,9]. Although S. aureus was isolated from normal bulk tank milk, not from mastitis in this study, we analyzed the genetic characteristics of bovine-mastitis-associated virulence factors to evaluate the potential pathogenesis of S. aureus.

2. Materials and Methods

2.1. Bacterial Isolation

S. aureus was isolated from 1,588 batches of bulk tank milk from 396 dairy farms in 6 factories (A1, A2, B1, B2, B3, and C1) operated by 3 dairy companies (A, B, and C) according to standard microbial protocols published by the Ministry of Food and Drug Safety (2018) [10]. Briefly, 1 mL of the milk sample was inoculated in 9 mL of tryptic soy broth with 6% NaCl (BD Biosciences, Sparks, MD, USA). After incubation at 37 °C for 24 h, each medium was streaked onto 5% sheep blood agar (KOMED, Seoul, Korea). Confirmation of S. aureus was performed using PCR with a species-specific primer as described previously [11]. If two isolates of the same origin showed the same antimicrobial susceptibility patterns, only one isolate was randomly chosen. A total of 93 S. aureus isolates were tested for this study.

2.2. Detection of Virulence Factors

The presence of the genes encoding the enterotoxins (sea, seb, sec, sed, see, seg, seh, sei, and sej), the toxic shock syndrome toxin (tsst-1), hemolysins (hla and hlb), Panton–Valentine leukocidin (pvl), leukocidins (lukED and lukM), fibronectin binding proteins (fnbA and fnbB), clumping factors (clfA and clfB), and intercellular adhesion (icaA and icaD) were detected by PCR using the Accupower PCR PreMix (Bioneer, Daejeon, Korea). The primers are listed in Table 1.

2.3. Molecular Typing

The genetic relationship of S. aureus with one or more enterotoxins was analyzed with multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). MLST was performed as previously described by Saunders and Holmes (2014) [20], and seven housekeeping genes (arcC, aroE, glpF, gmk, pta, tpi, and yqiL) purified using the GFX PCR DNA and Gel Band Purification Kit (Amersham Bioscience, Freiburg, Germany) were sequenced with an automatic sequencer (Cosmogenetech, Deajeon, Korea). Sequence types (STs) were obtained by combination using the S. aureus database (https://pubmlst.org/organisms/staphylococcus-aureus (accessed on 22 January 2022)). Moreover, PFGE was conducted by digesting genomic DNA using the SmaI enzyme (Takara Bio Inc., Shiga, Japan) according to a standard protocol of the Centers for Disease Control and Prevention (CDC, USA) [21], using a CHEF-MAPPER apparatus (Bio-Rad Laboratories, Hercules, CA), as described previously [22], and analyzed using the BioNumerics software (Applied Maths, Kortrijk, Belgium).

2.4. Statistical Analysis

The Statistical Package for the Social Sciences (SPSS) v.25 (IBM Corp., Armonk, NY, USA) was used for statistical analyses. Pearson’s chi-squared and Fisher’s exact test with Bonferroni correction were performed. Differences were considered significant at p < 0.05.

3. Results

3.1. Prevalence of S. aureus with Enterotoxingenes

Among the 93 S. aureus isolates, 40 (43.0%) carried at least 1 or more enterotoxin genes (Figure 1). However, the prevalence of enterotoxin genes was significantly high in S. aureus from factory A1 (89.5%), followed by factory C1 (66.7%), B1 (60.0%), and B2 (46.2%) (p < 0.05). Otherwise, the prevalence of enterotoxin genes in S. aureus from factory A2, owned by the same company as A1, was only 28.0%. Moreover, there was no S. aureus-carrying enterotoxin gene from factory B3, owned by the same company as B1 and B2.

3.2. Distribution of Virulence Genes

The distribution of virulence genes in 93 S. aureus isolates is shown in Figure 2. The prevalence of virulence genes showed the difference depending on the presence of enterotoxin genes. In other words, S. aureus-carrying enterotoxin genes showed a higher prevalence in all virulence genes, except for pvl and lukM, which were not detected in any S. aureus isolates, than in the isolates without the enterotoxin genes. Among S. aureus isolates carrying the enterotoxin genes, hla (100.0%) and hlb (100.0%) were highly prevalent, followed by lukED (95.0%), fnbA (92.5%), clfA (50.0%), fnbB (47.5%), clfB (37.5%), icaD (35.0%), and icaA (15.0%). Moreover, the prevalence of six genes (hla, hlb, lukED, fnbA, clfA, and clfB) was significantly higher in S. aureus-carrying enterotoxin genes than in those without the enterotoxin genes (p < 0.05).
The distribution of virulence gene patterns in 40 S. aureus isolates carrying the enterotoxin genes is shown in Table 2. Although 19 virulence gene patterns showed no significant differences between the prevalence rate, S. aureus isolates carrying 8 virulence genes simultaneously were found in factory A1, which showed the highest prevalence of enterotoxin genes.

3.3. Genotypic Characteristics of S. aureus Carrying the Enterotoxin Genes

The genetic relationship of 40 S. aureus isolates carrying the enterotoxin genes is shown in Figure 3. Although PFGE revealed 29 clusters showing 85% similarity and no correlation with virulence factors, 5 STs were associated with virulence genes. In particular, none of the isolates of ST1 and ST72 carried the see gene; however, all isolates of ST188 harbored the see gene. Additionally, all isolates of ST1 carried the seh gene, whereas isolates of ST6, ST20, and ST72 did not harbor the seh gene. One isolate with both sea and sec genes and two isolates with the sed gene were only revealed in ST1. Although the relationship between ST and virulence factors, except for the enterotoxin genes, was not characterized in this study, all STs harbored hla and hlb genes; however, ST72 did not harbor fnbB, clfA, icaA, and icaD genes.

4. Discussion

S. aureus produces many potential virulence factors to promote host tissue colonization, adhere to host cells, resist physical removal, invade host cells, and compete for iron and other nutrients [23]. In particular, plasmids and transposons typically contain antibiotic-resistance genes, whereas phage-related and pathogenicity islands contain most S. aureus toxins and other virulence determinants [24]. Moreover, most S. aureus toxins and virulence factors are encoded on S. aureus pathogenicity islands (SaPIs) [24], and the transfer of virulence genes via SaPIs may increase the risk of pathogenicity because they are transmitted not only to the same species but also to completely unrelated bacteria such as L. monocytogenes.
In Korea, five major dairy companies produce 84% of the total milk and dairy products (ATFIS, 2020) [25], and S. aureus isolated from six factories operated by three dairy companies was investigated in this study. Although 93 S. aureus isolates were from normal bulk tank milk, not from mastitis, 40 (43.0%) carried at least 1 or more enterotoxin genes. Moreover, the presence of enterotoxin genes was significantly different among the factories. Interestingly, even in the same company, the prevalence of enterotoxin genes showed a significant difference among the factories. Previous studies reported the presence of enterotoxins in 27.1–79.0% of S. aureus in milk and dairy products, and the frequency of enterotoxin genes varied by geographic region [13,16,26]. Furthermore, Schelin et al. (2011) [27] reported that enterotoxin production was influenced by environmental factors, such as temperature, pH, and moisture; therefore, management programs of dairy factories may affect the level of enterotoxins.
In the distribution of several virulence factors, which implicate the pathogenesis of S. aureus, all virulence genes, except pvl and lukM tested in this study, were shown to be present at a higher rate in the enterotoxin-producing isolates than in non-producing isolates. Primarily, hla and hlb genes allow for more persistence of pathogens in the mammary gland and cause chronic infection [6]. Therefore, these genes are the most prevalent in S. aureus from bovine mastitis milk [17,28,29,30]. Moreover, enterotoxin-producing S. aureus from normal bulk tank milk in this study is highly likely to cause chronic mastitis.
Leukocidin, including PVL, a type of cytotoxin, is an important factor contributing to increased virulence [31,32]. In this study, although none of the S. aureus isolates carried pvl and lukM genes, 95.0% of enterotoxin-producing isolates carried the lukED gene, and the prevalence was significantly higher than that in the non-producing isolates. Previous studies have reported that lukED was the most prevalent in S. aureus isolated from bovine mastitis milk in South Africa (100.0%), Finland (96.6%), Japan (96.0%), and the US (95.0%) [16,33,34,35]. The lukED has the ability to penetrate and kill cells, such as neutrophils that carry the bovine chemokine receptor, and is essential for the pathogenesis of mastitis [36]. Although pvl and lukM, which are associated with leukocyte destruction and necrosis and severity of mastitis, respectively, were not detected in any of the isolates, the high prevalence of lukED in enterotoxin-producing isolates could imply that there is a potential to induce mastitis.
Adhesion is essential to invade host cells and evade immune responses [37], and the biofilm-forming ability causes chronic or persistent infections [38]. S. aureus harbors various adhesion- and biofilm-related genes, such as fnbA, fnbB, clfA, clfB, icaA, and icaD, and the prevalence of these genes has been reported to vary according to geographic regions [18]. In this study, the prevalence of fnbA (92.5% vs. 52.8%), clfA (50.0% vs. 20.8%), and clfB (37.5% vs. 3.8%) genes between enterotoxin-producing and non-producing isolates was significantly different. Previous studies have also reported a high prevalence of fnbA in S. aureus isolated from mastitis [29,39].
Another superantigen virulence factor, tsst-1, hyperactivates the host immune response, resulting in toxic shock syndrome in humans, and can retain biological activity in milk after pasteurization [6]. Although each enterotoxin-producing and non-producing isolates carried tsst-1 in this study, S. aureus carrying the tsst-1 gene can lead to a public health concern.
In this study, five STs, ST1, ST6, ST20, ST72, and ST188, were revealed in enterotoxin-producing isolates. Song et al. (2015) [40] reported that ST1, ST6, and ST188 are frequently found to be associated with staphylococcal food poisoning in East Asia. Wang et al. (2018) [41] also reported that S. aureus ST188, a major lineage-causing infection in humans and livestock, possesses high nasal colonization and biofilm formation abilities in several host species. Mechesso et al. (2021) [42] have identified ST188 from bovine mastitis in Korea, but its prevalence was 23.3%. In this study, the prevalence of ST188 was higher than that of other STs; therefore, it seems to have a high potential to induce mastitis. Moreover, interestingly, all isolates in ST188 harbored the classical enterotoxin gene, see.
The see gene, which has the highest prevalence (75.0%) in enterotoxin-producing S. aureus in this study, has reported no or only low detection in milk [1,13,43]. Homsombat et al. (2021) reported that the growth of see-positive staphylococci in milk was significantly faster at a temperature of more than 8 °C. In this study, each bulk tank milk sample was collected from factories and sent to the laboratory under 4 °C. However, the bulk tank milk might not have been refrigerated to the correct temperature during transportation from the farms to the factories, or the temperature of whole milk might have risen during the milk in/out process.
Moreover, novel SEs, seg, seh, and sei genes were detected in 40.0%, 25.0%, and 20.0% of isolates, respectively, and have also been reported in food poisoning and bovine mastitis-related S. aureus worldwide [40,42,44,45]. Although the mechanism of novel enterotoxins in S. aureus is not clearly known, several molecular studies have suggested that they may play an important role in enhancing virulence because they are widely distributed in S. aureus [46].

5. Conclusions

These data provide that S. aureus isolated from normal bulk tank milk, not from mastitis, has a high prevalence of enterotoxins and that S. aureus, which produces enterotoxins, has various virulence factors simultaneously, posing a public health threat. Moreover, the high presence of enterotoxins in bulk tank milk usually may be due to a combination of poor hygiene, bad milking technique, refrigeration failure, and unsanitary milking equipment. Therefore, developing a strong monitoring and sanitation program for dairy factories is important for hygienic milk production.

Author Contributions

Conceptualization, H.-R.J. and Y.J.L.; methodology, H.-R.J. and Y.J.L.; software, H.-R.J.; validation, H.-R.J. and Y.J.L.; formal analysis, H.-R.J. and Y.J.L.; investigation, H.-R.J.; resources, H.-R.J. and Y.J.L.; data curation, H.-R.J.; writing—original draft preparation, H.-R.J.; writing—review and editing, Y.J.L.; visualization, H.-R.J.; supervision, Y.J.L.; project administration, Y.J.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Monistero, V.; Graber, H.; Pollera, C.; Cremonesi, P.; Castiglioni, B.; Bottini, E.; Ceballos-Marquez, A.; Lasso-Rojas, L.; Kroemker, V.; Wente, N.; et al. Staphylococcus aureus Isolates from Bovine Mastitis in Eight Countries: Genotypes, Detection of Genes Encoding Different Toxins and Other Virulence Genes. Toxins 2018, 10, 247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Pereyra, E.A.L.; Picech, F.; Renna, M.S.; Baravalle, C.; Andreotti, C.S.; Russi, R.; Calvinho, L.F.; Diez, C.; Dallard, B.E. Detection of Staphylococcus aureus adhesion and biofilm-producing genes and their expression during internalization in bovine mammary epithelial cells. Vet. Microbiol. 2016, 183, 69–77. [Google Scholar] [CrossRef] [PubMed]
  3. Putz, E.J.; Palmer, M.V.; Ma, H.; Casas, E.; Reinhardt, T.A.; Lippolis, J.D. Case report: Characterization of a persistent, treatment-resistant, novel Staphylococcus aureus infection causing chronic mastitis in a Holstein dairy cow. BMC Vet. Res. 2020, 16, 1–8. [Google Scholar] [CrossRef] [PubMed]
  4. Krakauer, T. Staphylococcal superantigens: Pyrogenic toxins induce toxic shock. Toxins 2019, 11, 178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Gillaspy, A.F.; Iandolo, J.J. Staphylococcus: Introduction. In Encyclopedia of Food Microbiology, 2nd ed.; Academic Press: Cambridge, MA, USA, 2014; Volume 3, pp. 482–486. [Google Scholar] [CrossRef]
  6. Pérez, V.K.C.; da Costa, G.M.; Guimarães, A.S.; Heinemann, M.B.; Lage, A.P.; Dorneles, E.M.S. Relationship between virulence factors and antimicrobial resistance in Staphylococcus aureus from bovine mastitis. J. Glob. Antimicrob. Resist. 2020, 22, 792–802. [Google Scholar] [CrossRef]
  7. Homsombat, T.; Boonyayatra, S.; Awaiwanont, N.; Pichpol, D. Effect of temperature on the expression of classical enterotoxin genes among staphylococci associated with bovine mastitis. Pathogens 2021, 10, 975. [Google Scholar] [CrossRef]
  8. Lina, G.; Piémont, Y.; Godail-Gamot, F.; Bes, M.; Peter, M.O.; Gauduchon, V.; Vandenesch, F.; Etienne, J. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 1999, 29, 1128–1132. [Google Scholar] [CrossRef]
  9. Lo, W.T.; Wang, C.C. Panton-valentine leukocidin in the pathogenesis of community-associated methicillin-resistant staphylococcus aureus infection. Pediatr. Neonatol. 2011, 52, 59–65. [Google Scholar] [CrossRef] [Green Version]
  10. Ministry of Food and Drug Safety (MFDS). Processing Standards and Ingredient Specifications for Livestock Products; Ministry of Food and Drug Safety: Cheongju, Korea, 2018. [Google Scholar]
  11. Igbinosa, E.O.; Beshiru, A.; Akporehe, L.U.; Oviasogie, F.E.; Igbinosa, O.O. Prevalence of methicillin-resistant Staphylococcus aureus and other Staphylococcus species in raw meat samples intended for human consumption in Benin City, Nigeria: Implications for public health. Int. J. Environ. Res. Public Health 2016, 13, 949. [Google Scholar] [CrossRef]
  12. Faridi, A.; Kareshk, A.T.; Fatahi-Bafghi, M.; Ziasistani, M.; Ghahraman, M.R.K.; Seyyed-Yousefi, S.Z.; Shakeri, N.; Kalantar-Neyestanaki, D. Detection of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples of patients with external ocular infection. Iran. J. Microbiol. 2018, 10, 215–219. [Google Scholar]
  13. Mashouf, R.Y.; Hosseini, S.M.; Mousavi, S.M.; Arabestani, M.R. Prevalence of enterotoxin genes and antibacterial susceptibility pattern of Staphylococcus aureus strains isolated from animal originated foods in West of Iran. Oman Med. J. 2015, 30, 283–290. [Google Scholar] [CrossRef] [PubMed]
  14. Koosha, R.Z.; Hosseini, H.M.; Aghdam, E.M.; Fooladi, A.A.I.; Tajandareh, S.G. Distribution of tsst-1 and mecA genes in Staphylococcus aureus isolated from clinical specimens. Jundishapur J. Microbiol. 2016, 9, 1–8. [Google Scholar] [CrossRef] [Green Version]
  15. Jarraud, S.; Mougel, C.; Thioulouse, J.; Lina, G.; Meugnier, H.; Forey, F.; Nesme, X.; Etienne, J.; Vandenesch, F. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immun. 2002, 70, 631–641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Thomas, A.; Chothe, S.; Byukusenge, M.; Mathews, T.; Pierre, T.; Kariyawasam, S.; Luley, E.; Kuchipudi, S.; Jayarao, B. Prevalence and distribution of multilocus sequence types of Staphylococcus aureus isolated from bulk tank milk and cows with mastitis in Pennsylvania. PLoS ONE 2021, 16, e0248528. [Google Scholar] [CrossRef]
  17. Xu, J.; Tan, X.; Zhang, X.; Xia, X.; Sun, H. The diversities of staphylococcal species, virulence and antibiotic resistance genes in the subclinical mastitis milk from a single Chinese cow herd. Microb. Pathog. 2015, 88, 29–38. [Google Scholar] [CrossRef]
  18. Felipe, V.; Morgante, C.A.; Somale, P.S.; Varroni, F.; Zingaretti, M.L.; Bachetti, R.A.; Correa, S.G.; Porporatto, C. Evaluation of the biofilm forming ability and its associated genes in Staphylococcus species isolates from bovine mastitis in Argentinean dairy farms. Microb. Pathog. 2017, 104, 278–286. [Google Scholar] [CrossRef]
  19. Vasudevan, P.; Nair, M.K.M.; Annamalai, T.; Venkitanarayanan, K.S. Phenotypic and genotypic characterization of bovine mastitis isolates of Staphylococcus aureus for biofilm formation. Vet. Microbiol. 2003, 92, 179–185. [Google Scholar] [CrossRef]
  20. Saunders, N.A.; Holmes, A. Multilocus sequence typing (MLST) of staphylococcus aureus. Methods Mol. Biol. 2014, 1085, 113–130. [Google Scholar] [CrossRef]
  21. Centers for Disease Control and Prevention(CDC). Centers for Disease Control and Prevention; Centers for Disease Control and Prevention(CDC): Atlanta, GA, USA, 2020; ISBN 1115430610. [Google Scholar]
  22. McDougal, L.K.; Steward, C.D.; Killgore, G.E.; Chaitram, J.M.; McAllister, S.K.; Tenover, F.C. Pulsed-Field Gel Electrophoresis Typing of Oxacillin-Resistant Staphylococcus aureus Isolates from the United States: Establishing a National Database. J. Clin. Microbiol. 2003, 41, 5113–5120. [Google Scholar] [CrossRef] [Green Version]
  23. Bien, J.; Sokolova, O.; Bozko, P. Characterization of Virulence Factors of Staphylococcus aureus: Novel Function of Known Virulence Factors That Are Implicated in Activation of Airway Epithelial Proinflammatory Response. J. Pathog. 2011, 2011, 1–13. [Google Scholar] [CrossRef] [Green Version]
  24. Malachowa, N.; DeLeo, F.R. Mobile genetic elements of Staphylococcus aureus. Cell. Mol. Life Sci. 2010, 67, 3057–3071. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Korea Agro-Fisheries & Food Trade Corporation Food Information Statistics System (ATFIS). Available online: https://www.atfis.or.kr/ (accessed on 1 December 2021).
  26. Peles, F.; Wagner, M.; Varga, L.; Hein, I.; Rieck, P.; Gutser, K.; Keresztúri, P.; Kardos, G.; Turcsányi, I.; Béri, B.; et al. Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary. Int. J. Food Microbiol. 2007, 118, 186–193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Schelin, J.; Wallin-Carlquist, N.; Cohn, M.T.; Lindqvist, R.; Barker, G.C.; Rådström, P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence 2011, 2, 580–592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Wang, D.; Zhang, L.; Zhou, X.; He, Y.; Yong, C.; Shen, M.; Szenci, O.; Han, B. Antimicrobial susceptibility, virulence genes, and randomly amplified polymorphic DNA analysis of Staphylococcus aureus recovered from bovine mastitis in Ningxia, China. J. Dairy Sci. 2016, 99, 9560–9569. [Google Scholar] [CrossRef]
  29. Zaatout, N.; Ayachi, A.; Kecha, M.; Kadlec, K. Identification of staphylococci causing mastitis in dairy cattle from Algeria and characterization of Staphylococcus aureus. J. Appl. Microbiol. 2019, 127, 1305–1314. [Google Scholar] [CrossRef]
  30. Liu, K.; Tao, L.; Li, J.; Fang, L.; Cui, L.; Li, J.; Meng, X.; Zhu, G.; Bi, C.; Wang, H. Characterization of Staphylococcus aureus Isolates From Cases of Clinical Bovine Mastitis on Large-Scale Chinese Dairy Farms. Front. Vet. Sci. 2020, 7, 1–9. [Google Scholar] [CrossRef]
  31. Löffler, B.; Hussain, M.; Grundmeier, M.; Brück, M.; Holzinger, D.; Varga, G.; Roth, J.; Kahl, B.C.; Proctor, R.A.; Peters, G. Staphylococcus aureus Panton-Valentine Leukocidin Is a Very Potent Cytotoxic Factor for Human Neutrophils. PLoS Pathog. 2010, 6, e1000715. [Google Scholar] [CrossRef]
  32. Spaan, A.N.; van Strijp, J.A.G.; Torres, V.J. Leukocidins: Staphylococcal bi-component pore-forming toxins find their receptors. Nat. Rev. Microbiol. 2017, 15, 435–447. [Google Scholar] [CrossRef]
  33. Yamada, T.; Tochimaru, N.; Nakasuji, S.; Hata, E.; Kobayashi, H.; Eguchi, M.; Kaneko, J.; Kamio, Y.; Kaidoh, T.; Takeuchi, S. Leukotoxin family genes in Staphylococcus aureus isolated from domestic animals and prevalence of lukM–lukF-PV genes by bacteriophages in bovine isolates. Vet. Microbiol. 2005, 110, 97–103. [Google Scholar] [CrossRef]
  34. Haveri, M.; Roslöf, A.; Rantala, L.; Pyörälä, S. Virulence genes of bovine Staphylococcus aureus from persistent and nonpersistent intramammary infections with different clinical characteristics. J. Appl. Microbiol. 2007, 103, 993–1000. [Google Scholar] [CrossRef]
  35. Schmidt, T.; Kock, M.M.; Ehlers, M.M. Molecular Characterization of Staphylococcus aureus Isolated from Bovine Mastitis and Close Human Contacts in South African Dairy Herds: Genetic Diversity and Inter-Species Host Transmission. Front. Microbiol. 2017, 8. [Google Scholar] [CrossRef] [Green Version]
  36. Vrieling, M.; Boerhout, E.M.; van Wigcheren, G.F.; Koymans, K.J.; Mols-Vorstermans, T.G.; de Haas, C.J.C.; Aerts, P.C.; Daemen, I.J.J.M.; van Kessel, K.P.M.; Koets, A.P.; et al. LukMF′ is the major secreted leukocidin of bovine Staphylococcus aureus and is produced in vivo during bovine mastitis. Sci. Rep. 2016, 6, 37759. [Google Scholar] [CrossRef]
  37. Ren, Q.; Liao, G.; Wu, Z.; Lv, J.; Chen, W. Prevalence and characterization of Staphylococcus aureus isolates from subclinical bovine mastitis in southern Xinjiang, China. J. Dairy Sci. 2020, 103, 3368–3380. [Google Scholar] [CrossRef] [Green Version]
  38. Dhanawade, N.B.; Kalorey, D.R.; Srinivasan, R.; Barbuddhe, S.B.; Kurkure, N.V. Detection of intercellular adhesion genes and biofilm production in Staphylococcus aureus isolated from bovine subclinical mastitis. Vet. Res. Commun. 2010, 34, 81–89. [Google Scholar] [CrossRef]
  39. Li, T.; Lu, H.; Wang, X.; Gao, Q.; Dai, Y.; Shang, J.; Li, M. Molecular characteristics of Staphylococcus aureus causing bovine mastitis between 2014 and 2015. Front. Cell. Infect. Microbiol. 2017, 7, 1–10. [Google Scholar] [CrossRef] [Green Version]
  40. Song, M.; Bai, Y.; Xu, J.; Carter, M.Q.; Shi, C.; Shi, X. Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai. Int. J. Food Microbiol. 2015, 195, 1–8. [Google Scholar] [CrossRef]
  41. Wang, Y.; Liu, Q.; Liu, Q.; Gao, Q.; Lu, H.; Meng, H.; Xie, Y.; Huang, Q.; Ma, X.; Wang, H.; et al. Phylogenetic analysis and virulence determinant of the host-adapted Staphylococcus aureus lineage ST188 in China. Emerg. Microbes Infect. 2018, 7, 1–11. [Google Scholar] [CrossRef] [Green Version]
  42. Mechesso, A.F.; Kim, S.J.; Park, H.S.; Choi, J.H.; Song, H.J.; Kim, M.H.; Lim, S.K.; Yoon, S.S.; Moon, D.C. Short communication: First detection of Panton-Valentine leukocidin–positive methicillin-resistant Staphylococcus aureus ST30 in raw milk taken from dairy cows with mastitis in South Korea. J. Dairy Sci. 2021, 104, 969–976. [Google Scholar] [CrossRef]
  43. Vaughn, J.M.; Abdi, R.D.; Gillespie, B.E.; Kerro Dego, O. Genetic diversity and virulence characteristics of Staphylococcus aureus isolates from cases of bovine mastitis. Microb. Pathog. 2020, 144, 104171. [Google Scholar] [CrossRef]
  44. Hwang, S.Y.; Park, Y.K.; Koo, H.C.; Park, Y.H. spa typing and enterotoxin gene profile of Staphylococcus aureus isolated from bovine raw milk in Korea. J. Vet. Sci. 2010, 11, 125–131. [Google Scholar] [CrossRef] [Green Version]
  45. Viçosa, G.N.; Le Loir, A.; Le Loir, Y.; de Carvalho, A.F.; Nero, L.A. egc characterization of enterotoxigenic Staphylococcus aureus isolates obtained from raw milk and cheese. Int. J. Food Microbiol. 2013, 165, 227–230. [Google Scholar] [CrossRef] [PubMed]
  46. Fisher, E.L.; Otto, M.; Cheung, G.Y.C. Basis of virulence in enterotoxin-mediated staphylococcal food poisoning. Front. Microbiol. 2018, 9, 1–18. [Google Scholar] [CrossRef] [PubMed]
Animals 12 00301 g001 550
Figure 1. Prevalence of enterotoxin among 93 Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories (A1 to C1). Values with different superscript letters represent significant differences by factories (p < 0.05).
Figure 1. Prevalence of enterotoxin among 93 Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories (A1 to C1). Values with different superscript letters represent significant differences by factories (p < 0.05).
Animals 12 00301 g001
Animals 12 00301 g002 550
Figure 2. Distribution of virulence genes among 93 Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories. * Asterisks indicate significant differences in the distribution of virulence genes depending on the presence of enterotoxin genes (p < 0.05).
Figure 2. Distribution of virulence genes among 93 Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories. * Asterisks indicate significant differences in the distribution of virulence genes depending on the presence of enterotoxin genes (p < 0.05).
Animals 12 00301 g002
Animals 12 00301 g003 550
Figure 3. Phylogenetic dendrogram of PFGE patterns showing the relevance of the 40 enterotoxin-positive Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories. S. aureus showing similarities of <85% in PFGE were considered to be unrelated.
Figure 3. Phylogenetic dendrogram of PFGE patterns showing the relevance of the 40 enterotoxin-positive Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories. S. aureus showing similarities of <85% in PFGE were considered to be unrelated.
Animals 12 00301 g003
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
TargetSequence (5′ → 3′)Size (bp)References
nucF: GCGATTGATGGTGATACGGTT279[12]
R: AGCCAAGCCTTGACGAACTAAAGC
seaF: GAAAAAAGTCTGAATTGCAGGGAACA560[13]
R: CAAATAAATCGTAATTAACCGAAGGTTC
sebF:ATTCTATTAAGGACACTAAGTTAGGGA404[13]
R: ATCCCGTTTCATAAGGCGAGT
secF:CTTGTATGTATGGAGGAATAACAAAACATG275[13]
R: CATATCATACCAAAAAGTATTGCCGT
sedF:GAATTAAGTAGTACCGCGCTAAATAATATG492[13]
R: GCTGTATTTTTCCTCCGAGAGT
seeF: CAAAGAAATGCTTTAAGCAATCTTAGGC482[13]
R: CACCTTACCGCCAAAGCTG
segF:TCTCCACCTGTTGAAGG323[13]
R: AAGTGATTGTCTATTGTCG
sehF: CAATCACATCATATGCGAAAGCAG376[13]
R: CATCTACCCAAACATTAGCACC
seiF: GTACCGTTGAAAATTCAG461[13]
R: AGGCAGTCCATCTCCTG
sejF: TCAGAACTGTTGTTCCGCTAG138[13]
R: GAATTTTACCAYCAAAGGTAC
tstF: CTGGTATAGTAGTGGGTCTG271[14]
R: AGGTAGTTCTATTGGAGTAGG
hlaF: CTGATTACTATCCAAGAAATTCGATTG209[15]
R: CTTTCCAGCCTACTTTTTTATCAGT
hlbF: GTGCACTTACTGACAATAGTGC309[15]
R: GTTGATGAGTAGCTACCTTCAGT
lukS/F-PVF: ATCATTAGGTAAAATGTCTGGACATGATCCA433[15]
R: GCATCAASTGTATTGGATAGCAAAAGC
lukEDF: TGAAAAAGGTTCAAAGTTGATACGAG269[16]
R: TGTATTCGATAGCAAAAGCAGTGCA
lukMF: TGGATGTTACCTATGCAACCTAC780[15]
R: GTTCGTTTCCATATAATGAATCACTAC
fnbAF: GTGAAGTTTTAGAAGGTGGAAAGATTAG643[17]
R: GCTCTTGTAAGACCATTTTTCTTCAC
fnbBF: GTAACAGCTAATGGTCGAATTGATACT524[17]
R: CAAGTTCGATAGGAGTACTATGTTC
clfAF: ATTGGCGTGGCTTCAGTGCT292[18]
R: CGTTTCTTCCGTAGTTGCATTTG
clfBF: ACATCAGTAATAGTAGGGGGCAAC205[18]
R: TTCGCACTGTTTGTGTTTGCAC
icaAF: CCTAACTAACGAAAGGTAG1315[19]
R: AAGATATAGCGATAAGTGC
icaDF: AAACGTAAGAGAGGTGG381[19]
R: GGCAATATGATCAAGATAC
Table
Table 2. The virulence gene patterns of 40 enterotoxin-positive Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories.
Table 2. The virulence gene patterns of 40 enterotoxin-positive Staphylococcus aureus isolates from bulk tank milk in 6 dairy factories.
Virulence Gene PatternsNo. (%) of Isolates aFactory (No. of Isolates)
hla, hlb, clfA, lukED2 (5.0)A2 (1), B1 (1)
hla, hlb, clfB, lukED1 (2.5)A1 (1)
hla, hlb, fnbA, clfB1 (2.5)A1 (1)
hla, hlb, fnbA, fnbB, clfB1 (2.5)A2 (1)
hla, hlb, fnbA, clfA, lukED6 (15.0)A2 (6)
hla, hlb, fnbA, clfB, lukED4 (10.0)A1 (3), A2 (1)
hla, hlb, fnbA, fnbB, lukED1 (2.5)B2 (1)
hla, hlb, fnbA, clfA, icaD, lukED2 (5.0)A2 (1), B1 (1)
hla, hlb, fnbA, clfB, icaA, lukED1 (2.5)A1 (1)
hla, hlb, fnbA, clfB, icaD, lukED3 (7.5)A1 (2), A2 (1)
hla, hlb, fnbA, fnbB, clfA, lukED6 (15.0)A1 (3), B1 (1), C1 (2)
hla, hlb, fnbA, fnbB, icaD, lukED4 (10.0)B2 (4)
hla, hlb, fnbA, clfB, icaA, icaD, lukED1 (2.5)A1 (1)
hla, hlb, fnbA, fnbB, clfA, icaA, lukED2 (5.0)A1 (2)
hla, hlb, fnbA, fnbB, icaA, icaD, lukED1 (2.5)B2 (1)
hla, hlb, fnbA, fnbB, clfA, clfB, lukED1 (2.5)A2 (1)
hla, hlb, fnbA, fnbB, clfB, icaD, lukED1 (2.5)A1 (1)
hla, hlb, fnbA, fnbB, clfA, icaA, icaD, lukED1 (2.5)A1 (1)
hla, hlb, fnbA, fnbB, clfB, icaD, lukED, tsst-11 (2.5)A1 (1)
a No significant differences (p < 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jung, H.-R.; Lee, Y.J. Characterization of Virulence Factors in Enterotoxin-Producing Staphylococcus aureus from Bulk Tank Milk. Animals 2022, 12, 301. https://doi.org/10.3390/ani12030301

AMA Style

Jung H-R, Lee YJ. Characterization of Virulence Factors in Enterotoxin-Producing Staphylococcus aureus from Bulk Tank Milk. Animals. 2022; 12(3):301. https://doi.org/10.3390/ani12030301

Chicago/Turabian Style

Jung, Hye-Ri, and Young Ju Lee. 2022. "Characterization of Virulence Factors in Enterotoxin-Producing Staphylococcus aureus from Bulk Tank Milk" Animals 12, no. 3: 301. https://doi.org/10.3390/ani12030301

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop