Early Weaning Affects Liver Antioxidant Function in Piglets
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval
2.2. Experimental Design
2.3. Sample Collection
2.4. Histomorphometry Determination
2.5. Determination of Activity of Antioxidant Enzymes
2.6. RT-qPCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Effects of Weaning on Piglet Liver Index
3.2. Effects of Weaning on Piglet Liver Morphology
3.3. Effect of Weaning on Antioxidant Enzymes Activity in Piglet Liver
3.4. Effect of Weaning on the Expression of Antioxidant Enzymes Genes in Piglet Liver
3.5. Effect of Weaning on the Expression of Nrf2 Related Genes in the Liver of Piglets
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Novais, A.K.; Deschêne, K.; Martel-Kennes, Y.; Roy, C.; Laforest, J.P.; Lessard, M.; Matte, J.J.; Lapointe, J. Weaning differentially affects mitochondrial function, oxidative stress, inflammation and apoptosis in normal and low birth weight piglets. PLoS ONE 2021, 16, e0247188. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.H.; Xiao, K.; Luan, Z.S.; Song, J. Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs. J. Anim. Sci. 2013, 91, 1094–1101. [Google Scholar] [CrossRef] [Green Version]
- Parola, M.; Robino, G. Oxidative stress-related molecules and liver fibrosis. J. Hepatol. 2001, 35, 297–306. [Google Scholar] [CrossRef]
- Cichoż-Lach, H.; Michalak, A. Oxidative stress as a crucial factor in liver diseases. World J. Gastroenterol. 2014, 20, 8082–8091. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Zhu, W.; Guo, Q.; Luo, W.; Zhang, J.; Xu, W.; Xu, J. Weaning induced hepatic oxidative stress, apoptosis, and ami-notransferases through MAPK signaling pathways in piglets. Oxidative Med. Cell. Longev. 2016, 2016, 4768541. [Google Scholar] [CrossRef]
- Alía, M.; Horcajo, C.; Bravo, L.; Goya, L. Effect of grape antioxidant dietary fiber on the total antioxidant capacity and the activity of liver antioxidant enzymes in rats. Nutr. Res. 2003, 23, 1251–1267. [Google Scholar] [CrossRef] [Green Version]
- Yuan, S.B.; Chen, D.W.; Zhang, K.Y.; Yu, B. Effects of oxidative stress on growth performance, nutrient digestibilities and ac-tivities of antioxidative enzymes of weanling pigs. Asian-Australas. J. Anim. Sci. 2007, 20, 1600–1605. [Google Scholar] [CrossRef]
- Storz, G.; Imlay, J.A. Mitochondria and apoptosis. Curr. Opin. Microbiol. 1999, 2, 188–194. [Google Scholar] [CrossRef]
- Zheng, P.; Yu, B.; He, J.; Yu, J.; Mao, X.; Luo, Y.; Luo, J.; Huang, Z.; Tian, G.; Zeng, Q.; et al. Arginine metabolism and its protective effects on intestinal health and functions in weaned piglets under oxidative stress induced by diquat. Br. J. Nutr. 2017, 117, 1495–1502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, S.; Wu, H.; Wang, C.; Zhang, Q.; Jiao, L.; Lin, F.; Hu, C.H. Diquat-induced oxidative stress increases intestinal permeability, impairs mitochondrial function, and triggers mitophagy in piglets. J. Anim. Sci. 2018, 96, 1795–1805. [Google Scholar] [CrossRef]
- Song, Z.H.; Tong, G.; Xiao, K.; Jiao, L.F.; Ke, Y.L.; Hu, C.H. L-cysteine protects intestinal integrity, attenuates intestinal inflammation and oxidant stress, and modulates NF-kappaB and Nrf2 pathways in weaned piglets after LPS challenge. Innate Immun. 2016, 22, 152–161. [Google Scholar] [CrossRef]
- Li, Y.; Zhao, X.; Jiang, X.; Chen, L.; Hong, L.; Zhuo, Y.; Lin, Y.; Fang, Z.; Che, L.; Feng, B.; et al. Effects of dietary supplementation with exogenous catalase on growth performance, oxidative stress, and hepatic apoptosis in weaned piglets challenged with lipo-polysaccharide. J. Anim. Sci. 2020, 98. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Tan, H.Y.; Wang, N.; Zhang, Z.J.; Lao, L.; Wong, C.W.; Feng, Y. The role of oxidative stress and antioxidants in liver diseases. Int. J. Mol. Sci. 2015, 16, 26087–26124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, Q.; Guo, T.; Li, G.; Sun, S.; He, S.; Cheng, B.; Shi, B.; Shan, A. Dietary resveratrol improves antioxidant status of sows and piglets and regulates antioxidant gene expression in placenta by Keap1-Nrf2 pathway and Sirt1. J. Anim. Sci. Biotechnol. 2018, 9, 34. [Google Scholar] [CrossRef] [PubMed]
- Xiao, D.; Yuan, D.; Tan, B.; Wang, J.; Liu, Y.; Tan, B. The role of Nrf2 signaling pathway in Eucommia ulmoides flavones regulating oxidative stress in the intestine of piglets. Oxidative Med. Cell. Longev. 2019, 2019, 9719618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, J.; Duan, J.; Cui, Z.; Ren, W.; Li, T.; Yin, Y. Hydrogen peroxide-induced oxidative stress activates NF-κB and Nrf2/Keap1 signals and triggers autophagy in piglets. RSC Adv. 2015, 5, 15479–15486. [Google Scholar] [CrossRef]
- Lecce, J.G.; Armstrong, W.D.; Crawford, P.C.; Ducharme, G.A. Nutrition and management of early weaned piglets: Liquid vs dry feeding. J. Anim. Sci. 1979, 48, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
- Itoh, K.; Ishii, T.; Wakabayashi, N.; Yamamoto, M. Regulatory mechanisms of cellular response to oxidative stress. Free. Radic. Res. 1999, 31, 319–324. [Google Scholar] [CrossRef]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Moeser, A.J.; Ryan, K.A.; Nighot, P.K.; Blikslager, A.T. Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am. J. Physiol. -Gastrointest. Liver Physiol. 2007, 293, G413–G421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, F.; Clark, J.E.; Overman, B.L.; Tozel, C.C.; Huang, J.H.; Rivier, J.E.; Blisklager, A.T.; Moeser, A.J. Early weaning stress impairs de-velopment of mucosal barrier function in the porcine intestine. Am. J. Physiol. -Gastrointest. Liver Physiol. 2010, 298, G352–G363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, X.; Lv, M.; Yu, B.; He, J.; Zheng, P.; Yu, J.; Wang, Q.; Chen, D. The effect of dietary tryptophan levels on oxidative stress of liver induced by diquat in weaned piglets. J. Anim. Sci. Biotechnol. 2014, 5, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shimada, K.; Crother, T.R.; Karlin, J.; Dagvadorj, J.; Chiba, N.; Chen, S.; Ramanujan, V.K.; Wolf, A.J.; Vergnes, L.; Ojcius, D.M.; et al. Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis. Immunity 2012, 36, 401–414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, X.; Zhang, Y.; Wu, X.; Wan, D.; Yin, Y. Effects of Dietary Serine Supplementation on Intestinal Integrity, Inflammation and Oxidative Status in Early-Weaned Piglets. Cell. Physiol. Biochem. 2018, 48, 993–1002. [Google Scholar] [CrossRef]
- Nguyen, P.; Leray, V.; Diez, M.; Serisier, S.; Bloc’h, J.L.; Siliart, B.; Dumon, H. Liver lipid metabolism. J. Anim. Physiol. Anim. Nutr. 2008, 92, 272–283. [Google Scholar] [CrossRef]
- Limdi, J.K.; Hyde, G.M. Evaluation of abnormal liver function tests. Postgrad. Med J. 2003, 79, 307–312. [Google Scholar] [CrossRef] [Green Version]
- Lu, T.; Harper, A.F.; Zhao, J.; Estienne, M.J.; Dalloul, R.A. Supplementing antioxidants to pigs fed diets high in oxidants: I. Effects on growth performance, liver function, and oxidative status. J. Anim. Sci. 2014, 92, 5455–5463. [Google Scholar] [CrossRef] [Green Version]
- Çelik, S.; Özkaya, A. Effects of intraperitoneally administered lipoic acid, vitamin E, and linalool on the level of total lipid and fatty acids in guinea pig brain with oxidative stress induced by H2O2. J. Biochem. Mol. Biol. 2002, 35, 547–552. [Google Scholar]
- Ming, D.; Wang, W.; Huang, C.; Wang, Z.; Shi, C.; Ding, J.; Liu, H.; Wang, F. Effects of weaning age at 21 and 28 days on growth performance, intestinal morphology and redox status in piglets. Animals 2021, 11, 2169. [Google Scholar] [CrossRef]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant. Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Rhoads, D.M.; Umbach, A.L.; Subbaiah, C.C.; Siedow, J.N. Mitochondrial reactive oxygen species. contribution to oxidative stress and interorganellar signaling. Plant. Physiol. 2006, 141, 357–366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poli, G. Pathogenesis of liver fibrosis: Role of oxidative stress. Mol. Asp. Med. 2000, 21, 49–98. [Google Scholar] [CrossRef]
- Cederbaum, A.I.; Lu, Y.; Wu, D. Role of oxidative stress in alcohol-induced liver injury. Arch. Toxicol. 2009, 83, 519–548. [Google Scholar] [CrossRef]
- Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative stress and antioxidant defense. World Allergy Organ. J. 2012, 5, 9–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, W.L.; Luo, Z.; Xu, X.; Zhao, S.; Li, S.H.; Sho, T.; Yao, J.; Zhang, J.; Xu, W.N.; Xu, J.X. The Effect of maternal diet with fish oil on ox-idative stress and inflammatory response in sow and new-born piglets. Oxidative Med. Cell. Longev. 2019, 2019, 6765803. [Google Scholar] [CrossRef] [PubMed]
- Matés, J.M.; Pérez-Gómez, C.; De Castro, I.N. Antioxidant enzymes and human diseases. Clin. Biochem. 1999, 32, 595–603. [Google Scholar] [CrossRef]
- Yin, J.; Wu, M.M.; Xiao, H.; Ren, W.K.; Duan, J.L.; Yang, G.; Li, T.J.; Yin, Y.L. Development of an antioxidant system after early weaning in piglets. J. Anim. Sci. 2014, 92, 612–619. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.L.; Wang, Y.Z.; Guo, J.; Liu, J.X.; Feng, J. Comparison of age-related differences in expression of antioxidant enzyme mRNA and activity in various tissues of pigs. Comp. Biochem. Physiol. Part. B Biochem. Mol. Biol. 2007, 147, 445–451. [Google Scholar] [CrossRef]
- Feng, C.; Bai, K.; Wang, A.; Ge, X.; Zhao, Y.; Zhang, L.; Wang, T. Effects of dimethylglycine sodium salt supplementation on growth performance, hepatic antioxidant capacity, and mitochondria-related gene expression in weanling piglets born with low birth weight1. J. Anim. Sci. 2018, 96, 3791–3803. [Google Scholar] [CrossRef] [PubMed]
- Theys, N.; Clippe, A.; Bouckenooghe, T.; Reusens, B.; Remacle, C. Early low protein diet aggravates unbalance between antiox-idant enzymes leading to islet dysfunction. PLoS ONE 2009, 4, e6110. [Google Scholar] [CrossRef]
- Girard, P.M.; Peynot, N.; Lelièvre, J.M. Differential correlations between changes to glutathione redox state, protein ubiquitination, and stress-inducible HSPA chaperone expression after different types of oxidative stress. Cell Stress Chaperones 2018, 23, 985–1002. [Google Scholar] [CrossRef]
- Ma, Q. Role of Nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef] [Green Version]
- Dhakshinamoorthy, S.; Long, D.J.; Jaiswal, A.K. Antioxidant regulation of genes encoding enzymes that detoxify xenobiotics and carcinogens. Curr. Top. Cell. Regul. 2001, 36, 201–216. [Google Scholar]
- Zhang, D.D. Mechanistic Studies of the Nrf2-Keap1 Signaling Pathway. Drug Metab. Rev. 2006, 38, 769–789. [Google Scholar] [CrossRef]
- Kobayashi, M.; Yamamoto, M. Nrf2–Keap1 regulation of cellular defense mechanisms against electrophiles and reactive oxygen species. Adv. Enzyme Regul. 2006, 46, 113–140. [Google Scholar] [CrossRef] [PubMed]
- Kaspar, J.W.; Niture, S.K.; Jaiswal, A.K. Nrf2: INrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009, 47, 1304–1309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayashi, A.; Suzuki, H.; Itoh, K.; Yamamoto, M.; Sugiyama, Y. Transcription factor Nrf2 is required for the constitutive and inducible expression of multidrug resistance-associated protein1 in mouse embryo fibroblasts. Biochem. Biophys. Res. Commun. 2003, 310, 824–829. [Google Scholar] [CrossRef] [PubMed]
- Osburn, W.O.; Wakabayashi, N.; Misra, V.; Nilles, T.; Biswal, S.; Trush, M.A.; Kensler, T.W. Nrf2 regulates an adaptive response pro-tecting against oxidative damage following diquat-mediated formation of superoxide anion. Arch. Biochem. Biophys. 2006, 454, 7–15. [Google Scholar] [CrossRef] [Green Version]
- Xun, W.; Fu, Q.; Shi, L.; Cao, T.; Jiang, H.; Ma, Z. Resveratrol protects intestinal integrity, alleviates intestinal inflammation and oxidative stress by modulating AhR/Nrf2 pathways in weaned piglets challenged with diquat. Int. Immunopharmacol. 2021, 99, 107989. [Google Scholar] [CrossRef]
Ingredient | Content (%) | Nutrition Levels | Content (%) |
---|---|---|---|
Corn | 60.50 | DE (MJ/kg) | 14.11 |
Fish meal | 5.00 | CP | 20.21 |
Corn gluten meal | 5.00 | Ca | 0.76 |
Soybean oil | 1.00 | AP | 0.45 |
Soybean meal | 24.00 | Lys | 1.25 |
Limestone | 1.18 | Met | 0.43 |
CaHPO4 | 1.30 | Thr | 0.71 |
L-Lys | 0.60 | Trp | 0.16 |
Met | 0.13 | ||
Thr | 0.17 | ||
Ser | 0.02 | ||
Choline chloride | 0.10 | ||
NaCl | 0.40 | ||
Premix 1 | 0.60 | ||
Total | 100.00 |
Gene. | Accession No | Primer Sequence (5′-3′) | Amplicon Size/bp |
---|---|---|---|
β-Actin | DQ845171.1 | AGGCCAACCGTGAGAAGATG CATGACAATGCCAGTGGTGC | 122 |
CAT | NM_214301 | GCTGAGTCCGAAGTCGTCTA CATGGTGTCCGACTAGCCTT | 93 |
SOD | NM_214127 | TGTAACTGAGCGATACGCCG GGTATTCGGCGCTCCTACAA | 99 |
Nrf2 | NM_001185152.1 | TCCAAGTGAGCCATCGTTCG TGGCAGCTCATAAGGTGGTG | 133 |
PRDX3 | NM_001244531.1 | CGAGACTACGGTGTGCTGTT GAGGGTCTCTTCCACGCTTC | 132 |
HO-1 | NM_001004027.1 | GCCATGTGAATGCAACCCTG GCCAGTCAAGAGACCATCCC | 88 |
Keap1 | XM_021076667.1 | GTGTGGAGAGGAGTCTGTGT TCCACGTTTCTGTCTCCACG | 112 |
NQO1 | NM_001159613.1 | GATCATACTGGCCCACTCCG CATGGCATACAGGTCCGACA | 115 |
Items | Time | Groups | Mean | SEM | p-Value | |||
---|---|---|---|---|---|---|---|---|
S | W | G | T | G × T | ||||
Body weight (kg) | 3 d | 5.86 ** | 5.08 | 5.47 | 0.18 | <0.01 | <0.01 | 0.14 |
7 d | 7.34 ** | 5.77 | 6.56 | |||||
Mean | 6.60 | 5.43 | 6.02 | |||||
Liver weight (g) | 3 d | 155.43 * | 115.02 | 135.23 | 5.30 | <0.01 | 0.01 | 0.11 |
7 d | 195.63 ** | 129.95 | 162.79 | |||||
Mean | 175.53 | 122.49 | 149.01 | |||||
Liver index (g/kg) | 3 d | 26.47 | 22.79 | 24.63 | 0.18 | <0.01 | <0.01 | 0.14 |
7 d | 27.12 * | 22.52 | 24.82 | |||||
Mean | 26.80 | 22.66 | 24.73 |
Items | Time | Groups | Mean | SEM | p-Value | |||
---|---|---|---|---|---|---|---|---|
S | W | G | T | G × T | ||||
Particle size (μm) | 3 d | 6.51 * | 4.26 | 5.39 | 0.93 | 0.04 | 0.08 | 0.88 |
7 d | 8.02 * | 6.06 | 7.04 | |||||
Mean | 7.27 | 5.16 | 6.22 | |||||
area (μm2) | 3 d | 87.85 * | 80.6 | 84.23 | 1.73 | 0.01 | 0.06 | 0.72 |
7 d | 91.02 | 86.06 | 88.54 | |||||
Mean | 89.44 | 83.33 | 86.39 |
Items | Time | Groups | Mean | SEM | p-Value | |||
---|---|---|---|---|---|---|---|---|
S | W | G | T | G × T | ||||
T-AOC (U/mg prot) | 3 d | 3.52 | 3.29 | 3.41 | 0.09 | 0.13 | 0.84 | 0.73 |
7 d | 3.62 | 3.27 | 3.45 | |||||
Mean | 3.57 | 3.28 | 3.43 | |||||
SOD (U/mg prot) | 3 d | 5.80 * | 5.63 | 5.72 | 0.02 | <0.01 | 0.73 | 0.76 |
7 d | 5.80 * | 5.60 | 5.70 | |||||
Mean | 5.80 | 5.62 | 5.71 | |||||
CAT (U/mg prot) | 3 d | 12.92 | 11.64 | 12.28 | 0.33 | 0.02 | 0.65 | 0.50 |
7 d | 13.06 * | 10.89 | 11.98 | |||||
Mean | 12.99 | 11.27 | 12.13 | |||||
GSH-Px (U/mg prot) | 3 d | 209.46 | 188.83 | 199.15 | 9.26 | 0.10 | 0.12 | 0.55 |
7 d | 191.09 | 147.68 | 169.39 | |||||
Mean | 200.28 | 168.26 | 184.27 | |||||
MDA (nmol/mg prot) | 3 d | 1.83 | 2.29 | 2.06 | 0.13 | 0.11 | 0.31 | 0.87 |
7 d | 1.61 | 1.99 | 1.80 | |||||
Mean | 1.72 | 2.14 | 1.93 |
Items | Time | Groups | Mean | SEM | p-Value | |||
---|---|---|---|---|---|---|---|---|
S | W | G | T | G × T | ||||
PRDX | 3 d | 1.00 | 1.02 | 1.01 | 0.09 | 0.71 | 0.04 | 0.95 |
7 d | 1.46 | 1.41 | 1.44 | |||||
Mean | 1.23 | 1.22 | 1.22 | |||||
SOD | 3 d | 1.00 | 0.83 | 0.92 | 0.39 | 0.46 | 0.04 | 0.60 |
7 d | 3.10 | 2.08 | 1.70 | |||||
Mean | 2.05 | 1.46 | 2.59 | |||||
CAT | 3 d | 1.00 | 0.89 | 0.95 | 0.24 | 0.78 | 0.12 | 0.92 |
7 d | 1.79 | 1.70 | 1.75 | |||||
Mean | 1.40 | 1.30 | 1.35 | |||||
GSH-Px | 3 d | 1.00 * | 0.44 | 0.72 | 0.22 | 0.57 | <0.01 | 0.42 |
7 d | 2.43 | 2.54 | 2.49 | |||||
Mean | 1.72 | 1.49 | 1.61 |
Items | Time | Groups | Mean | SEM | p-Value | |||
---|---|---|---|---|---|---|---|---|
S | W | G | T | G × T | ||||
Nrf2 | 3 d | 1.00 ** | 0.31 | 0.66 | 0.66 | 0.71 | 0.07 | 0.87 |
7 d | 3.31 | 3.04 | 3.18 | |||||
Mean | 2.16 | 1.68 | 1.92 | |||||
HO-1 | 3 d | 1.00 | 1.08 | 1.04 | 0.54 | 0.93 | 0.19 | 0.27 |
7 d | 1.17 | 0.86 | 1.02 | |||||
Mean | 1.09 | 0.97 | 1.03 | |||||
NQO1 | 3 d | 1.00 | 0.87 | 0.94 | 0.52 | 0.65 | 0.07 | 0.06 |
7 d | 2.40 * | 0.16 | 1.28 | |||||
Mean | 1.70 | 0.52 | 1.11 | |||||
Keap1 | 3 d | 1.00 | 1.21 | 1.11 | 0.51 | 0.05 | 0.19 | 0.78 |
7 d | 1.36 | 1.69 | 1.53 | |||||
Mean | 1.18 | 1.45 | 1.32 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, L.; Li, H.; Peng, Z.; Ge, Y.; Liu, J.; Wang, T.; Wang, H.; Dong, L. Early Weaning Affects Liver Antioxidant Function in Piglets. Animals 2021, 11, 2679. https://doi.org/10.3390/ani11092679
Yu L, Li H, Peng Z, Ge Y, Liu J, Wang T, Wang H, Dong L. Early Weaning Affects Liver Antioxidant Function in Piglets. Animals. 2021; 11(9):2679. https://doi.org/10.3390/ani11092679
Chicago/Turabian StyleYu, Lihuai, Hongmin Li, Zhong Peng, Yuzhu Ge, Jun Liu, Tianlong Wang, Hongrong Wang, and Li Dong. 2021. "Early Weaning Affects Liver Antioxidant Function in Piglets" Animals 11, no. 9: 2679. https://doi.org/10.3390/ani11092679