Next Article in Journal
Effect of Breed Types and Castration on Carcass Characteristics of Boer and Large Frame Indigenous Veld Goats of Southern Africa
Next Article in Special Issue
Geographic Origin and Genetic Characteristics of Japanese Indigenous Chickens Inferred from Mitochondrial D-Loop Region and Microsatellite DNA Markers
Previous Article in Journal
Effect of Pre-Blended Phosphates on the Freezing Quality Characteristics of Ground Woody Breast Meat Compared to Normal Meat
Previous Article in Special Issue
Genomic Scan for Selection Signature Reveals Fat Deposition in Chinese Indigenous Sheep with Extreme Tail Types
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 10
Issue 10
10.3390/ani10101883
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Novel InDels of GHR, GHRH, GHRHR and Their Association with Growth Traits in Seven Chinese Sheep Breeds

by
Mingli Wu
1,
Haidong Zhao
1,
Xiaoqin Tang
1,
Qi Li
1,
Xiaohua Yi
1,
Shirong Liu
1 and
Xiuzhu Sun
2,*
1
College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China
2
College of Grassland Agriculture, Northwest A&F University, Yangling 712100, China
*
Author to whom correspondence should be addressed.
Animals 2020, 10(10), 1883; https://doi.org/10.3390/ani10101883
Submission received: 25 September 2020 / Revised: 8 October 2020 / Accepted: 12 October 2020 / Published: 15 October 2020
(This article belongs to the Special Issue Genetic and Phenotypic Diversity of Animal Breeds, Varieties and Strains)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

It is advantageous to find the potential molecular markers which are associated with the growth and development of mutton sheep through molecular breeding. In this study, four molecular markers were selected from growth hormone receptor (GHR), one was found on growth hormone releasing hormone (GHRH) and growth hormone releasing hormone receptor (GHRHR), respectively. The purposes of this paper were to screen molecular makers in the related genes of the growth hormone (GH) axis and provide theoretical basis for molecular breeding and genetic selection of mutton sheep. In this study, six molecular markers were selected from the genes for growth hormone receptor (GHR), growth hormone releasing hormone (GHRH), and growth hormone releasing hormone receptor (GHRHR). The three molecular markers in GHR and one in GHRHR could potentially be used for marker assisted selection of growing-related traits in mutton sheep.

Abstract

The GH growth axis plays an important role in the growth and development of animals and runs through the whole life of animals. Many studies have shown that molecular mutations in key genes of the GH axis will affect the growth and development of animals. The purpose of this study was to explore the distribution characteristics of InDels of GHR, GHRH, and GHRHR in seven Chinese sheep populations, and to further explore the relationship between InDels and sheep growth traits. GHR showed high variation in Chinese sheep, and GHR-53 showed the highest minimum allele frequency (MAF). There was only one InDel mutation site in both GHRH and GHRHR. The genotype frequencies of Hu sheep (HS), Tong sheep (TS), and Lanzhou fat-tail sheep (LFTS) were quite different from other breeds. The association between GHR, GHRH, and GHRHR InDels and body size traits in seven varieties were analyzed. The results showed that there was no significant relationship between GHRH and body size traits in the seven sheep populations. There was a positive association between GHR-21 and hip height of LFSH (p < 0.05). GHR-43 reduced body height and chest depth of Small tail han sheep (STHS) and hip width of TS. GHR-44 significantly affected the body weight of HS, the body height of STHS and the head depth of TS. GHR-53 significantly reduced cannon girth of HS, chest of STHS and forehead width of TS. GHRHR-2 significantly reduced the body weight of LFHS. To sum up, this study revealed the effects of GHR, GHRH, and GHRHR InDels on sheep phenotypic traits, which indicated their potential application prospects in the genetic improvement of mutton sheep.

1. Introduction

InDel is a phenomenon of vacancy caused by homologous alignment [1]. An InDel creates a length polymorphism marker and is one of the most abundant variation types in animal and plant genomes [2,3]. An InDel is defined as a variation in which an insertion or deletion is lower than 50 bp [4,5]. This sequence variation is important for disease susceptibility, phenotypic diversity, and evolutionary adaptation. It is achieved by promoting the initiation or extension of transcription, increasing the stability of mRNA in the nucleus, and enhancing gene expression [6]. As a high frequency genetic marker, InDel has been applied to population genetic analysis of animals and plants, molecular-assisted breeding, human forensic genetics, medical diagnosis, and other fields [7,8,9,10,11]. Molecular marker-assisted selection plays an important role in the process of molecular breeding of beef cattle and sheep in China [12,13,14]. With the development of InDel markers located on functional genes, some InDels have been identified as functional markers related to the growth of mutton sheep [15,16].
GH is one of the most important genes in the growth and development of vertebrates, and it produces effects by binding to its receptor GHR. It is reported that GH and GHR are important candidate genes for growth, carcass and lactation traits of domestic animals. GHRH was synthesized and secreted by the hypothalamus. For instance, GH, GHRH and its receptor GHRHR are the main regulators of the GH axis, which could regulate the generation and release of GH from the hypothalamus and promote the proliferation of growth cells. Excessive GHRH causes growth-promoting cell proliferation and increased GH secretion. GHRH deficiency is caused by GHRH mutation or inactivation, which can cause adverse symptoms such as poor growth promoting cell regeneration and single growth hormone deficiency (IGHD) [17]. GHRH plays a very important role in the growth and development of acquired animals. It has been reported that most mutations in GHRH and GHRHR lead to human IGHD. Similarly, mutations in GHRH and GHRHR in other mammals also affect the growth and development of animals [18]. The GH growth axis is an important endocrine and metabolic axis in animals, which regulates the growth and development of animals throughout their whole lives. In recent years, studies have found that the SNP of GHR, insulin-like growth factor binding protein (IGFBP), GHRHR, epidermal growth factor (EGF), and other genes had an impact on the growth axis of the hypothalamus GH, thus affecting the growth and development of the sheep. Gorlov et al. [19] found that InDel of GH was significantly associated with carcass weight, slaughter weight, slaughter yield of Salsk male lamb; Armstrong et al. [20] reported that SNP RS400358099 in GHRHR could regulate the growth traits of Texel lambs; Jia et al. [21] found that GH polymorphism was significantly correlated with growth traits of Tibetan sheep and Poll Dorset sheep; Valeh et al. [22] found that Baluchi sheep with genotype G/G of GHR had a superior daily Gain from Birth to Weaning (GBW). GH axis related gene InDel has also been reported to influence the growth of beef cattle, Ferraz et al. [23] identified six new polymorphisms of the bovine GH (one InDel and five SNPs), which could be used as molecular markers in genetic studies. Szmatoła [24] found that one of the most important detected genes was GHR, with a known influence on the milk and meat traits of the 11 cattle breeds maintained in Poland from the BovineSNP50 microarrays (Illumina).
The latitude and longitude span of China is large, and there are differences in breeding varieties in different regions. Therefore, we chose HS in the east, LFTS, STHS, and TS in the west, and three native breeds in Xinjiang. Among them, LFTS and TS belong to fat tail sheep, while STHS belong to small tail sheep. The seven breeds, all of which belong to mutton sheep, are well commonly farmed locally. In this study, we speculated that the InDel of GHR, GHRH, and GHRHR may affect the growth of seven Chinese local sheep breeds. Therefore, this study firstly investigated the distribution of seven Chinese local sheep varieties GHR, GHRH, GHRHR-InDel, and then carried out correlation analysis between all InDels and phenotypic traits of sheep, in order to explain the genetic effect of GHR, GHRH, GHRHR-InDel in Chinese local sheep varieties, so as to provide useful information for the genetic protection and improvement of Chinese sheep.

2. Material and Methods

2.1. DNA Samples and Data Collection

This research was approved by Northwest A&F University ethic committee on 20 May 2017 (ethic code: NWAFAC1019). A total of 969 sheep were used in this study. All animals were adults, healthy, and unrelated. All animals within a breed were managed in the same way, and sufficient feed was provided by total metabolic rate (TMR). Blood samples and body measurements were collected from seven breeds included STHS (n = 184, female), TS (n = 268, female), LFTS (n = 67, female), HS (n = 166, female), Duolang sheep (DLS, n = 92, female and male), Bashbay sheep (BBS, n = 96, female and male), and Altay sheep (ATS, n = 96, female and male), Table 1 gives sample details. The body weight (BW), body height (BH), body length (BL), chest circumference (ChC), chest depth (ChD), chest width (ChW), hucklebone width (HuW), hip width (HW), and cannon circumference (CaC) were reported using standard measurement method [25]. Consequently, body length index (BLI), chest circumference index (ChCI), chest width index (ChWI), cannon circumference index (CaCI), hucklebone width index (HuWI), and trunk index (TI) were calculated [26].

2.2. DNA Isolation and Genomic DNA Pools Construction

DNA was extracted from blood and musculature of ear margin using the proteinase-K-chloroform method. The DNA sample quality was tested by Nanodrop 1000 (Thermo Scientific, Waltham, MA, USA). All DNA samples were diluted to 50 ng/μL and stored at −20 °C [27]. DNA mixture was prepared by randomly selecting 20 individuals of each breed to mix DNA equally.

2.3. Primer Design and PCR Amplification

According to the potential InDel sites of GH, GHR, GHRH, and GHRHR published in Ensembl database, specific primers were designed with NC_040262.1, NC_040267.1, NC_040264.1, and NC_0402551.1 as reference genomes, respectively. Primer information, annealing temperature, and mutation types of mutation sites are shown in Table S1. Sites with variation base number greater than 5 bp were screened because it could not be identified by agarose gel electrophoresis when variation base number was less than 5 bp. The primers (Sangon Biotech, Co., Ltd., Shanghai, China.) were diluted to 10 ng/μL according to the instructions. The annealing temperature of the primers were determined by touch-down PCR with DNA pool as template. Each PCR was performed with 20 μL reaction, including 10 μL 2 × Taq PCR Master Mix (Sangon Biotech (Shanghai) Co., Ltd.), 1 μL genomic DNA (50 ng/μL), and 10 pmol primers. The PCR protocol was performed 5 min predegeneration, followed by 10 cycles of 95 °C at 30 s, 60 °C at 30 s (started at 60 °C and drops by 1 °C per cycle), 72 °C at 30 s, 25 cycles of 95 °C at 30 s, annealing temperature at 30 s, 72 °C at 30 s, finally extend for 10 min. The PCR products were genotyped by 3% agarose gel electrophoresis except GHRH for which individual genotypes were determined by Sanger sequencing. Ten samples of each genotype were randomly selected for Sanger sequencing verification at each site [14]. The primer information of the fragments identified as variants are shown in Table 2.

2.4. Statistical Analyses

Microsoft Excel software was used to collate all individual genotypes at each site and calculate genotype frequency and allele frequency. The Sanger Atlas sequence data and the reference genome were compared with Bioedit [28]. The online website www.Msrcall.com was used to calculate Hardy–Weinberg equilibrium (HWE), homozygosity (Ho), heterozygosity (He), effective allele numbers (Ne), and polymorphism information content (PIC), which was based on Nei’s method [29,30]. Chi-squared tests of different genotypic frequencies and breeds were performed by “χ2 calculator”. Linkage disequilibrium was performed by SHEsis online platform (http://analysis.bio-x.cn). Association analysis between InDel and body measurements were conducted by SPSS software (version 18.0) (IBM, Armonk, NY, USA) general linear mixed effects model [31], followed by least significant difference post hoc test, the structure of model was Yijk = μ + Gi (II, ID or DD genotype) + Aj + eijk, while Yijk was the phenotypic observations; μ was the mean of the phenotypic observations; Gi was fixed effect of the ith genotype of the InDel; Aj was the effect of age in ith; eijk was the residual effect, II was insertion and insertion, ID was insertion and deletion, DD was deletion and deletion [32].

3. Results

3.1. InDel Identification and Distribution

InDel loci were not detected for GH. Six InDel loci were confirmed from 62 potential loci within GHR, GHRH, and GHRHR by 3% gel electrophoresis and Sanger sequencing. Four InDel loci detected in GHR and one InDel locus within GHRH and GHRHR were identified (Table 2). Sanger sequencing revealed that 23 bases were missing at the GHR-21, which was located at NC_040267.1 g.33844815-33844837, and the missing bases were GGCGTAAAAAGCCCATTCTCCCC. At GHR-43 locus, 23 bases were inserted at NC_040267.1 g.33800014-33800015, and the inserted bases were GTACCTCGATTAATGGTAGAATA. The GCCCATGGTCATGTGGATAAGAAGTAATTTG fragment was deleted from the GHR-44 at NC_040267.1 g.33888451-33888481. The above three loci were all located in the upstream region of GHR. In addition, a 23 bp insertion mutation, GHR-53, was found in the first intron region of GHR. The GHR-53 was located in NC_040267.1 g.33778607-33778608, and the insertion sequence was CCCATGGACAGAGGGGCCTGACG. TATTAT fragment were inserted in GHRH promoter region NC_040264.1 g.69001073-69001074. The TCTTTAGGGACTGCCAGTTTA fragment were missing from the 12th intron NC_040255.1 g.72166920-7216692 of GHRHR (Figure 1).

3.2. Population Genetic Analysis of Six Mutation Sites in Seven Varieties

Six loci of all samples were amplified by PCR and genotyping was performed by 3% agarose gel electrophoresis. The DD genotype at GHR-21, GHR-43, and GHR-44 was the dominant genotype, and the deletion (D) allele frequency was much higher than the I allele frequency. The ID genotype at GHR-53 was the dominant genotype. The D allele frequency was similar to the insertion (I) allele. Only TS had higher I allele frequency than the D allele. For the GHR-21 locus, except HS and TS population, the rest were in Hardy–Weinberg equilibrium (Table S2); for the GHR-44 site, the population ATS and LFTS were not in genetic balance; for the GHR-53 locus, except the STHS and TS population, the other groups were in Hardy–Weinberg equilibrium. Population genetic analysis revealed that the Ho and He of GHR-53 were close to 0.5, and the Ho of the remaining four loci was higher than the He; the Ne of GHR-53 was close to 2; the PIC about four loci were between 0.2 and 0.4, GHR-53 was moderate PIC in all the populations (0.25 < PIC < 0.5), while some populations at the other three loci achieved intermediate PIC (0 < PIC < 0.25) and others achieved moderate PIC (0.25 < PIC < 0.5). The dominant genotype of GHRH was DD, and the frequency of the D allele was much higher than the I allele. HS, ATS, BBS, and DLS were in genetic balance (p > 0.05), and the Ho was higher than He. As for PIC, except ATS and DLS achieving low polymorphism (0 < PIC < 0.25), the other five sheep breeds were all intermediate polymorphism (0.25 < PIC < 0.5) (Table 3). Chi-square was used to analyze the differences of genotypes and allele distributions among populations. The distribution of alleles and genotypes of HS, TS, and DLS were significantly different from other populations (p < 0.05) (Figure 2).

3.3. InDel Association Analyses

Linkage analysis of the four GHR mutation sites revealed that the four sites were not linked (strong linkage was indicated when D’ > 0.95 or r2 > 0.33), as shown in Figure 3. Therefore, only the relationship between a single mutation site and growth traits was analyzed, without haplotype analysis. Table 4 lists all the significant associations between the variation at each locus and the production traits of interest. It was found that hip height in the ID genotype of LFHS population was significantly reduced on account of GHR-21 (p < 0.05), and DD genotype was beneficial for LFHS. GHR-43 mutation significantly reduced the body height and chest depth of the STHS population (p < 0.05), but significantly increased hip width in the TS population (p < 0.01), DD genotype was beneficial for STHS and HS. For GHR-44, the body weight of the HS population and the STHS population changed in exactly the opposite direction due to the presence of fragment deletion (p < 0.05). At the same time, the head depth of TS group is reduced (p < 0.05). Mutations at GHR-53 reduced cannon girth and chest of the HS population and forehead width of TS population (p < 0.05), DD genotype was beneficial for STHS and HS. DD genotype of GHRHR mutation resulted in significant decrease of body weight of LFHS population (p < 0.05). The GHRH mutation was not significantly associated with sheep growth traits (Table S3).

4. Discussion

InDel variation could affect animal growth traits, which has been reported in many studies, for example, InDel on FTO were associated with tail length and growth trait in the Tong sheep [33]. A 4 bp InDel in Sox9 3′ UTR was significantly correlated with goat body length, heart girth, and hip width. Sox9, HIAT1, MSTN, and CSN1S1 strongly effect growth traits in goats [29,34,35]. There have been many reports on the effects of the GH axis related gene mutation on animal growth. The heterozygous haplotype C261G/G263C, in exon 21 of the IGF1R was found that associated with the average daily gain during the early stages of life (from birth to six moon of age) and could be used as a genetic marker for selection of growth traits in Egyptian buffalo [36]. Results of Mullen et al. [37] demonstrated the multifaceted influences of IGF-1 on milk production and growth traits in cattle. However, there are few studies on the relationship between InDel and mutton sheep growth.
In this study, InDel were investigated as molecule markers that might be associated with important economic traits and therefore potentially useful in marker-assisted breeding programmes. Three of them were located in GHR-5′ UTR, and the other was located in the first intron region of GHR. GH is a macromolecular substance, which cannot directly pass through the cell membrane, but must activate the signal transduction pathway by binding to GHR to transmit the information into the cell, so that GH can play its biological function. GH combines with GHR, catalyzes GHR dimerization, and activates GHR. GHR dimerization exposes the binding sites of receptors and ligands, increasing the affinity between receptors and ligands, and ensuring the smooth progress of downstream signal transduction. GHR has multiple first exons to choose from, so there are also multiple 5 ’UTRs, which also leads to the molecular diversity of GHR. GHR includes the extracellular region, transmembrane region, and intracellular region. The receptor and ligand-binding regions are located in two conserved sequences in the intracellular region, so the intracellular region plays a crucial role in the binding of GH. GHRH is a polypeptide secreted by the hypothalamus. As a positive regulator of GH, GHRH mainly promotes the synthesis and secretion of GH by the pituitary gland. GHRHR, as the GHRH receptor, binds to GHRH and promotes the release of GH by increasing intracellular cAMP and Ca2+, thus promoting the growth and development of the body. GH, GHR, GHRH, and GHRHR are the most critical genes in the GH axis, their diversity plays an important role in the growth regulation of animals. Maj et al. [38] studied four SNPs of GHR 5’UTR and the meat production performance of Holstein cattle in Poland, and found that a single genotype had no effect on the production performance. Combined genotype analysis found that polymorphism had a significant effect on feed utilization and carcass weight of cattle. Zhang et al. [39] used PCR-SSCP to detect the polymorphism of GHR 3’UTR regulation region in 392 Nanjiang yellow sheep and 49 Boer goats, and carried out correlation analysis with the body weight traits. According to the least-squares analysis, the genotype effect in the two goat populations had no significant effect on the initial birth weight, but had a significant effect on the first-year body weight. Human IGHD is a family genetic disease with GHRHR mutation leading to GH deficiency. Seventeen mutations have been reported in GHRHR, and these mutations will lead to severe growth disorders in patients [40]. At present, there are few studies on the association between SNP of GH, GHR, and GHRHR with sheep growth traits, and only one breed of sheep was tested and analyzed [18,19,20,21,22,41,42]. The association between InDel of GH and sheep growth has only been reported in Luxi Blackhead sheep [15]. For the first time, this study examined the distribution of the InDel loci of the GH axis key genes in multiple breeds of Chinese sheep and the association analysis with different population growth traits. In this study, we found that GHR and GHRHR were associated with growth traits of four sheep breeds. GHR-InDel had a great effect on STHS and TS product traits, which could affect body height, chest depth of STHS, chest, hip width, head depth, and forehead width of TS, and could also regulate STHS body height, chest and LFHS hip height. In conclusion, GHR-InDel may regulate the important growth indicators of four sheep breeds, and the selection of dominant genotypes can be used as the theoretical basis for molecular breeding about improving the production traits and meat yield of the four sheep breeds. GHGH-InDel had almost no association with the growth of Chinese sheep, and GHRHR-InDel had a strong correlation with the weight of LFHS, the DD genotype group gained 33% more weight than the II genotype group. A growing number of studies have demonstrated that intron regions and 5′ UTR regions of genes play an important role in regulating gene expression levels [43]. Introns can regulate gene transcription rate, gene transcription length, gene structure, and provide binding sites for binding proteins. For example, Lu et al. [44] found that the human β-Globin is a highly intron-dependent gene, and the amount of its mature mRNA and the utilization rate of translation decreased significantly in the absence of splicing. Chang et al. [45] found that there was an important regulatory element in pig MyHC introns that regulated the initiation of transcription and enhanced gene expression. Introns have positional effects and directional dependence in gene expression [6]. We hypothesized that this mutation caused the structure and function of GHRHR, which further affected the binding of GHRHR and GHRH or the sensitivity of GHRH to activate cAMP.

5. Conclusions

In summary, we identified six InDels from 62 potential loci within the GH axis in 969 individuals from seven Chinese sheep populations, including four InDels in GHR, one InDel in GHRH, and one InDel in GHRHR. InDel in GHRHR was associated with LFHS production trait, and three mutations of GHR were strongly associated with HS, TS, LFHS, and STHS growth traits. Our findings implied that GHR-InDel could be used as a promising marker for beef sheep breeding by selecting the advantageous genotype.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-2615/10/10/1883/s1, Table S1: PCR primer sequences of InDels in sheep GH, GHR, GHRH, and GHRHR genes, Table S2: Hardy–Weinberg equilibrium test for gene frequency and genotype frequency of six mutant sites in seven populations, Table S3: Relationship between variations of GHR, GHRH, and GHRHR and their growth traits (p < 0.1).

Author Contributions

Data analysis, H.Z. and Q.L.; Manuscript writing, M.W. and X.T.; experimental design, X.S.; Writing—review and editing: X.Y. and S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported the Shaanxi Provincial Key Research and Development Program (2018ZDXM-NY-040) and China Agriculture Research System (CARS-34).

Conflicts of Interest

We confirm that this manuscript has not been published in whole or in part and is not being considered for publication elsewhere. There are no any ethical conflict of interest for all authors.

References

  1. Yang, J.; He, J.; Wang, D.; Shi, E.; Yang, W.; Geng, Q.; Wang, Z. Progress in research and application of InDel markers. Sheng Wu Duo Yang Xing 2016, 24, 237–243. [Google Scholar] [CrossRef] [Green Version]
  2. Hyten, D.; Cannon, S.; Song, Q.; Weeks, N.; Fickus, E.; Shoemaker, R.; Specht, J.; Farmer, A.; May, G.; Cregan, P. High-throughput SNP discovery through deep rese-quencing of a reduced representation library to anchor and orient scaffolds in the soybean whole genome sequence. BMC Genom. 2010, 11, 38. [Google Scholar] [CrossRef]
  3. Fan, Y.; Wang, W.; Ma, G.; Liang, L.; Shi, Q.; Tao, S. Patterns of insertion and deletion in mammalian genomes. Curr. Genom. 2007, 8, 370–378. [Google Scholar]
  4. Alkan, C.; Coe, B.; Eichler, E. Genome structural variation discovery and genotyping. Nat. Rev. Genet. 2011, 12, 363–376. [Google Scholar] [CrossRef]
  5. Tuzun, E.; Sharp, A.; Bailey, J.; Kaul, R.; Morrison, V.; Pertz, L.; Haugen, E.; Hayden, H.; Albertson, D.; Pinkel, D.; et al. Fine-scale structural variation of the human genome. Nat. Genet. 2005, 37, 727–732. [Google Scholar] [CrossRef]
  6. Zhang, K. Function and Application of Intron. China Anim. Husb. Vet. Med. 2012, 39, 80–83. [Google Scholar]
  7. Lv, H.; Yang, L.; Kang, J.; Wang, Q.; Wang, X.; Fang, Z.; Liu, Y.; Zhuang, M.; Zhang, Y.; Lin, Y.; et al. Development of InDel markers linked to Fusarium wilt resistance in cabbage. Mol. Breed. 2013, 32, 961–967. [Google Scholar] [CrossRef]
  8. Vasemägi, A.; Gross, R.; Palm, D.; Paaver, T.; Primmer, C. Discovery and application of insertion-deletion (INDEL) polymorphisms for QTL mapping of early life-history traits in Atlantic salmon. BMC Genom. 2010, 11, 156. [Google Scholar] [CrossRef] [Green Version]
  9. Santos, N.; Ribeiro-Rodrigues, E.; Ribeiro-Dos-Santos, A.; Pereira, R.; Gusmão, L.; Amorim, A.; Guerreiro, J.; Zago, M.; Matte, C.; Hutz, M.; et al. Assessing individual interethnic admixture and population substructure using a 48-insertion-deletion (INSERTION) ancestry-informative marker (AIM) panel. Hum. Mutat. 2010, 31, 184–190. [Google Scholar] [CrossRef]
  10. Pereira, R.; Phillips, C.; Alves, C.; Amorim, A.; Carracedo, A.; Gusmão, L. A new multiplex for human identification using insertion/deletion polymorphisms. Electrophoresis 2009, 30, 3682–3690. [Google Scholar] [CrossRef]
  11. Lee, T.; Chafets, D.; Reed, W.; Wen, L.; Yang, Y.; Chen, J.; Utter, G.; Owings, J.; Busch, M. Enhanced ascertainment of microchimerism with real-time quantitative polymerase chain reaction amplification of insertion-deletion polymor-phisms. Transfusion 2006, 46, 1870–1878. [Google Scholar] [CrossRef]
  12. Wu, M.; Li, S.; Zhang, G.; Fan, Y.; Gao, Y.; Huang, Y.; Lan, X.; Lei, C.; Ma, Y.; Dang, R. Exploring insertions and deletions (indels) of MSRB3 gene and their association with growth traits in four Chinese indigenous cattle breeds. Arch. Anim. Breed. 2019, 62, 465–475. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Zhong, J.; Xu, J.; Wang, J.; Wen, Y.; Niu, H.; Zheng, L.; He, H.; Peng, K.; He, P.; Shi, S.; et al. A novel SNP of PLAG1 gene and its association with growth traits in Chinese cattle. Gene 2019, 689, 166–171. [Google Scholar] [CrossRef] [PubMed]
  14. Zhou, Z.; Huang, B.; Lai, Z.; Li, S.; Wu, F.; Qu, K.; Jia, Y.; Hou, J.; Liu, J.; Lei, C.; et al. The Distribution Characteristics of a 19-bp Indel of the PLAG1 Gene in Chinese Cattle. Animals 2019, 9, 1082. [Google Scholar] [CrossRef] [Green Version]
  15. Akhatayeva, Z.; Li, H.; Mao, C.; Cheng, H.; Zhang, G.; Jiang, F.; Meng, X.; Yao, Y.; Lan, X.; Song, E.; et al. Detecting novel Indel variants within the GHR gene and their associations with growth traits in Luxi Blackhead sheep. Anim. Biotechnol. 2020, 31, 1–9. [Google Scholar] [CrossRef]
  16. Li, J.; Erdenee, S.; Zhang, S.; Wei, Z.; Zhang, M.; Jin, Y.; Wu, H.; Chen, H.; Sun, X.; Xu, H.; et al. Genetic effects of PRNP gene insertion/deletion (indel) on phenotypic traits in sheep. Prion 2018, 12, 42–53. [Google Scholar] [CrossRef] [Green Version]
  17. Hernández, L.; Lee, P.; Camacho-Hübner, C. Isolated growth hormone deficiency. Pituitary 2007, 10, 351–357. [Google Scholar] [CrossRef] [Green Version]
  18. Carakushansky, M.; Whatmore, A.J.; Clayton, P.E.; Shalet, S.; Gleeson, H.; Price, D.; Levine, M.; Salvatori, R. A new missense mutation in the growth hormone-releasing hormone receptor gene in familial isolated GH deficiency. Eur. J. Endocrinol. 2003, 148, 25–30. [Google Scholar] [CrossRef] [Green Version]
  19. Gorlov, I.; Kolosov, Y.; Shirokova, N.; Getmantseva, L.; Slozhenkina, M.; Mosolova, N.; Bakoev, N.; Leonova, M.; Kolosov, A.; Zlobina, E. Association of the growth hormone gene polymorphism with growth traits in Salsk sheep breed. Small Rumin. Res. 2017, 150, 11–14. [Google Scholar] [CrossRef]
  20. Armstrong, E.; Ciappesoni, G.; Iriarte, W.; Da Silva, C.; Macedo, F.; Navajas, E.A.; Brito, G.; San Julián, R.; Gimeno, D.; Postiglioni, A. Novel genetic polymorphisms associated with carcass traits in grazing Texel sheep. Meat Sci. 2018, 145, 202–208. [Google Scholar] [CrossRef]
  21. Jia, J.; Zhang, L.; Wu, J.; Ha, Z.; Li, W. Study of the correlation between GH gene polymorphism and growth traits in sheep. Genet. Mol. Res. 2014, 13, 7190–7200. [Google Scholar] [CrossRef]
  22. Valeh, M.; Tahmoorespour, M.; Ansari, M.; Nassiry, M.R. Association of growth traits with sscp polymorphisms at the growth hormone receptor (ghr) and growth hormone releasing hormone receptor (ghrhr) genes in the baluchi sheep. J. Anim. Vet. Adv. 2012, 8, 1063–1069. [Google Scholar]
  23. Ferraz, A.; Bortolossi, J.; Curi, R.; Ferro, M.; Ferro, J.; Furlan, L. Identification and characterization of polymorphisms within the 5’ flanking region, first exon and part of first intron of bovine GH gene. J. Anim. Breed. Genet. 2006, 123, 208–212. [Google Scholar] [CrossRef]
  24. Szmatoła, T.; Gurgul, A.; Jasielczuk, I.; Ząbek, T.; Ropka-Molik, K.; Litwińczuk, Z.; Bugno-Poniewierska, M. A Comprehensive Analysis of Runs of Homozygosity of Eleven Cattle Breeds Representing Different Production Types. Animals 2019, 9, 1024. [Google Scholar] [CrossRef] [Green Version]
  25. Zhang, L.; Wu, P.; Xuan, C.; Liu, Y.; Wu, J. Advances in body size measurement and conformation appraisal for sheep. Trans. Chin. Soc. Agric. Eng. 2016, 32, 190–197. [Google Scholar]
  26. Zhao, H.; He, S.; Wang, S.; Zhu, Y.; Xu, H.; Luo, R.; Lan, X.; Cai, Y.; Sun, X. Two New Insertion/Deletion Variants of the PITX2 Gene and their Effects on Growth Traits in Sheep. Anim. Biotechnol. 2018, 29, 276–282. [Google Scholar] [CrossRef]
  27. Gao, Y.; Huang, B.; Bai, F.; Wu, F.; Zhou, Z.; Lai, Z.; Li, S.; Qu, K.; Jia, Y.; Lei, C.; et al. Two Novel SNPs in RET Gene Are Associated with Cattle Body Measurement Traits. Animals 2019, 9, 836. [Google Scholar] [CrossRef] [Green Version]
  28. Zhao, H.; He, S.; Zhu, Y.; Cao, X.; Luo, R.; Cai, Y.; Xu, H.; Sun, X. A novel 29 bp insertion/deletion (indel) variant of the LHX3 gene and its influence on growth traits in four sheep breeds of various fecundity. Arch. Anim. Breed. 2017, 60, 79–85. [Google Scholar] [CrossRef] [Green Version]
  29. He, L.; Bi, Y.; Wang, R.; Pan, C.; Chen, H.; Lan, X.; Qu, L. Detection of a 4 bp Mutation in the 3’UTR Region of Goat Sox9 Gene and Its Effect on the Growth Traits. Animals 2020, 10, 672. [Google Scholar] [CrossRef] [Green Version]
  30. Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef] [Green Version]
  31. Liu, M.; Li, B.; Shi, T.; Huang, Y.; Liu, G.; Lan, X.; Lei, C.; Chen, H. Copy number variation of bovine SHH gene is associated with body conformation traits in Chinese beef cattle. J. Appl. Genet. 2019, 60, 199–207. [Google Scholar] [CrossRef]
  32. Shi, T.; Peng, W.; Yan, J.; Cai, H.; Lan, X.; Lei, C.; Bai, Y.; Chen, H. A novel 17 bp indel in the SMAD3 gene alters transcription level, contributing to phenotypic traits in Chinese cattle. Arch. Anim. Breed. 2016, 59, 151–157. [Google Scholar] [CrossRef] [Green Version]
  33. Wang, S.; Liu, S.; Yuan, T.; Sun, X. Genetic effects of FTO gene insertion/deletion (InDel) on fat-tail measurements and growth traits in Tong sheep. Anim. Biotechnol. 2019, 30, 1–11. [Google Scholar] [CrossRef]
  34. Bi, Y.; Feng, B.; Wang, Z.; Bi, Y.; Feng, B.; Wang, Z.; Zhu, H.; Qu, L.; Lan, X.; Pan, C.; et al. Myostatin (MSTN) Gene Indel Variation and Its Associations with Body Traits in Shaanbei White Cashmere Goat. Animals 2020, 10, 168. [Google Scholar] [CrossRef] [Green Version]
  35. Zhang, Y.; Wang, K.; Liu, J.; Zhu, H.; Qu, L.; Chen, H.; Lan, X.; Pan, C.; Song, X. An 11-bp Indel Polymorphism within the CSN1S1 Gene Is Associated with Milk Performance and Body Measurement Traits in Chinese Goats. Animals 2019, 9, 1114. [Google Scholar] [CrossRef] [Green Version]
  36. El-Magd, M.; Abbas, H.; El-kattawy, A.; Mokhbatly, A. Novel polymorphisms of the IGF1R gene and their association with average daily gain in Egyptian buffalo (Bubalus bubalis). Domest. Anim. Endocrinol. 2013, 45, 105–110. [Google Scholar] [CrossRef]
  37. Mullen, M.; Berry, D.; Howard, D.; Diskin, M.; Lynch, C.; Giblin, L.; Kenny, D.; Magee, D.; Meade, K.; Waters, S. Single Nucleotide Polymorphisms in the Insulin-Like Growth Factor 1 (IGF-1) Gene are Associated with Performance in Holstein-Friesian Dairy Cattle. Front. Genet. 2011, 2, 3. [Google Scholar] [CrossRef] [Green Version]
  38. Maj, A.; Oprządek, J.; Dymnicki, E.; Zwierzchowski, L. Association of the polymorphism in the 5’-noncoding region of the bovine growth hormone receptor gene with meat production traits in Polish Black-and-White cattle. Meat Sci. 2006, 72, 539–544. [Google Scholar] [CrossRef]
  39. Zhang, C.; Luo, H.; Chen, Y.; Zhang, G.; Jia, Z. Correlation between Polymorphisms of 5′-Flanking Region of GHR Gene and Body Weight of Nanjiang Huang Goats. Chin. J. Anim. Sci. 2007, 43, 4–7. [Google Scholar]
  40. Wang, Q.; Diao, Y.; Xu, Z.; Li, X.; Luo, X.; Xu, H.; Ouyang, P.; Liu, M.; Hu, Z.; Wang, Q.; et al. Identification of a novel splicing mutation in the growth hormone (GH)-releasing hormone receptor gene in a Chinese family with pituitary dwarfism. Mol. Cell. Endocrinol. 2009, 313, 50–56. [Google Scholar] [CrossRef]
  41. Dettori, M.; Pazzola, M.; Paschino, P.; Amills, M.; Vacca, G. Association between the GHR, GHRHR, and IGF1 gene polymorphisms and milk yield and quality traits in Sarda sheep. J. Dairy Sci. 2018, 101, 9978–9986. [Google Scholar] [CrossRef] [Green Version]
  42. Sahu, A.R.; Jeichitra, V.; Rajendran, R.; Raja, A. Polymorphism of growth hormone receptor (GHR) gene in Nilagiri sheep. Trop. Anim. Health Prod. 2017, 49, 281–285. [Google Scholar] [CrossRef]
  43. Greenwood, T.; Kelsoe, J. Promoter and intronic variants affect the transcriptional regulation of the human dopamine transporter gene. Genomics 2003, 82, 511–520. [Google Scholar] [CrossRef]
  44. Lu, S.; Cullen, B. Analysis of the stimulatory eddect of splicing on mRNA production and utilization in mammalian cells. RNA 2003, 9, 618–630. [Google Scholar] [CrossRef] [Green Version]
  45. Chang, K. Critical regulatory domains in intron 2 of a porcine sarcomericmyosin heavy chain gene. J. Muscle Res. Cell Motil. 2000, 21, 451–461. [Google Scholar] [CrossRef] [PubMed]
Animals 10 01883 g001 550
Figure 1. The electrophoresis diagram and sequence diagrams of six loci in GHR, GHRH, and GHRHR.
Figure 1. The electrophoresis diagram and sequence diagrams of six loci in GHR, GHRH, and GHRHR.
Animals 10 01883 g001
Animals 10 01883 g002 550
Figure 2. Difference analysis of InDel (insertion/deletion) distribution among populations.
Figure 2. Difference analysis of InDel (insertion/deletion) distribution among populations.
Animals 10 01883 g002
Animals 10 01883 g003 550
Figure 3. Linkage analysis of four variation sites of GHR in seven populations. (a) D’ analysis of seven sheep breeds in four GHR loci; (b) r2 analysis of seven sheep breeds in four GHR loci.
Figure 3. Linkage analysis of four variation sites of GHR in seven populations. (a) D’ analysis of seven sheep breeds in four GHR loci; (b) r2 analysis of seven sheep breeds in four GHR loci.
Animals 10 01883 g003
Table
Table 1. Information of seven sheep breeds in this study.
Table 1. Information of seven sheep breeds in this study.
BreedAbbreviationSampling LocationnSample Form
Small tail hanSTHSLanzhou city
(Gansu province)		184Musculature of ear margin
TongTSBaishui county
(Shanxi province)		268Venous blood
Lanzhou fat-tailLFTSLanzhou city
(Gansu province)		67Musculature of ear margin
HuHSHuzhou city
(Zhejiang province)		166Venous blood
DuolangDLSShihezi city
(Xinjiang autonomous region)		92Venous blood
BashbayBBSShihezi city
(Xinjiang autonomous region)		96Venous blood
AltayATSAltay city
(Xinjiang autonomous region)		96Venous blood
Total 969
Notes: n—sample size.
Table
Table 2. PCR primer sequences of sheep GHR, GHRH, and GHRHR.
Table 2. PCR primer sequences of sheep GHR, GHRH, and GHRHR.
Gene(Gene ID)NamePrimer Sequences (5′-3′)Product Size (bp)Notes
GHR
(443333)		GHR-21F: CGGTCCAATTCACCAGAT202 − 23Upstream
R: AGAATCCCACGGACAAAG
GHR-43F: CTGTGAAGTCTCACCAGTGC77 + 23Upstream
R: GGATAGGCAGAATGCTAAAG
GHR-44F: GAAATACCCTTGTGGACAGA245 − 31Upstream
R: CTGGATTTATTGTTATTGTCTATTG
GHR-53F: ATGTTAGGCAGCCAAAAGG200 + 231st intron
R: GCCCAACCCAATGTTAATAGA
GHRH
(100101237)		GHRHF: ACGACTGAAGCGATTTAGCAC159 + 6Promoter region
R: TCCATCTGTAAAATGGGCATG
GHRHR
(443511)		GHRHR-2F: AACCCCTGTCTCAGTTTCTCC129 + 2112th intron
R: GATCTCAGTCCTCACCTCCAA
Notes: GH: growth hormone; GHR: growth hormone receptor; GHRH: growth hormone releasing hormone; GHRHR: growth hormone releasing hormone receptor; F: forward primer; R: reverse primer; −: deletion; +: insertion.
Table
Table 3. Genotypes, alleles, He, Ne, and PIC for InDels of the sheep GHR, GHRH, and GHRHR.
Table 3. Genotypes, alleles, He, Ne, and PIC for InDels of the sheep GHR, GHRH, and GHRHR.
LocusBreedSizeGenotypic FrequencyAllelic FrequencyPopulation Parameters
nIIIDDDIDHoHeNePIC
GHR-21HS1841611850.9240.0760.8590.1411.1640.131
STHS2682035780.8640.1360.7650.2351.3080.208
LFTS67521320.8730.1270.7780.2221.2850.197
TS1661462000.9400.0600.8870.1131.1280.107
ATS92533630.7720.2280.6480.3521.5440.290
BBS96781530.8910.1090.8050.1951.2420.176
DLS96633120.8180.1820.7020.2981.4250.254
GHR-43HS1841324750.8450.1550.7380.2621.3550.228
STHS268133111240.7030.2970.5830.4171.7160.330
LFTS67371640.6720.3280.6210.3891.6100.307
TS1651144920.8390.1610.7300.2701.3690.233
ATS92761600.9130.0870.8410.1591.1890.146
BBS96414780.6720.3280.5590.4411.7890.344
DLS96662820.8330.1670.7220.2781.3850.239
GHR-44HS1841423840.8750.1250.7810.2191.2800.377
STHS2681847680.8280.1720.7160.2841.3970.244
LFTS67451930.8130.1870.6960.3041.4360.257
TS1666283210.6230.3770.5310.4691.8850.359
ATS925426120.7280.2720.6040.3961.6550.317
BBS96533940.7550.2450.6300.3701.5870.301
DLS96821130.9110.0890.8390.1611.1920.148
GHR-53HS1844997380.5300.4700.5020.4981.9930.374
STHS26870114840.4740.5260.5010.4991.9940.374
LFTS671729210.4700.5300.5020.4981.9930.374
TS1661698520.3920.6080.5240.4761.9100.363
ATS922546210.5220.4780.5010.4991.9960.375
BBS961944330.4270.5730.5110.4891.9580.301
DLS962157180.5160.4840.5000.5001.9980.374
GHRHHS1846731050.2310.7690.6450.3551.5500.292
STHS26824681760.2160.7840.6610.3391.5130.282
LFTS67411520.1420.8580.7570.2431.3220.408
TS1662353900.2980.7020.5810.4191.7200.331
ATS92324650.1630.8370.7270.2731.3750.236
BBS96634560.2400.7600.6360.3641.5730.298
DLS96113820.0780.9220.8560.1441.1680.134
GHRHR-2HS1841671520.9480.0520.9020.0971.1090.093
STHS26817380150.7950.2050.6730.3261.4840.273
LFTS67421780.7540.2460.5020.4981.9930.374
TS166827680.7230.2770.6290.3711.5900.302
ATS92662420.8480.1520.7420.2581.3480.225
BBS96613140.7970.2030.6760.3241.4890.271
DLS9686910.9430.0570.8920.1081.1210.102
Notes: GHR: growth hormone receptor; GHRH: growth hormone releasing hormone; GHRHR: growth hormone releasing hormone receptor; Ho: homozygosity; He: heterozygosity; Ne: effective allele numbers; PIC: polymorphism information content; STHS: Small tail han sheep; TS: Tong sheep; LFTS: Lanzhou fat-tail sheep: HS: Hu sheep; DLS: Duolang sheep; BBS: Bashbay sheep; ATS: Altay sheep; II: insertion/insertion; ID: insertion/deletion; DD: deletion/deletion.
Table
Table 4. Relationship between variations of GHR, GHRH, and GHRHR and their growth traits.
Table 4. Relationship between variations of GHR, GHRH, and GHRHR and their growth traits.
LociBreedsGrowth TraitsObserved Genotypes (LSM a ± SE)p Values
IIIDDD
GHR-21LFHSHip height (cm)77.92 a ± 1.27 (n = 25)71.50 b ± 2.07 (n = 7)84.50 a ± 3.50 (n = 2)0.019
GHR-43STHSBody height (cm)62.60 b ± 0.45 (n = 90)64.26 a ± 0.46 (n = 80)62.37 a,b ± 0.85 (n = 20)0.023
STHSChest depth (cm)27.17 b ± 0.29 (n = 90)27.89 a,b ± 0.27 (n = 80)28.66 a ± 0.61 (n = 20)0.036
TSHip width (cm)13.88 b ± 0.27 (n = 48)15.10 a,b ± 0.30 (n = 27)16.50 a ± 0.50 (n = 2)0.005
GHR-44HSBody weight (kg)32.73 a ± 0.36 (n = 141)31.03 b ± 0.83 (n = 38)27.18 b ± 1.94 (n = 4)0.009
STHSBody height (cm)62.82 b ± 0.36 (n = 129)64.00 a,b ± 0.62 (n = 54)66.14 a ± 1.30 (n = 7)0.044
TSHead depth (cm)14.53 b ± 1.32 (n = 26)14.94 a ± 0.11 (n = 42)14.20 b ± 0.32 (n = 10)0.007
GHR-53HSCannon girth (cm)6.96 b ± 0.09 (n = 49)7.12 a,b ± 0.05 (n = 97)7.25 a ± 0.10 (n = 38)0.049
STHSChest circumference (cm)72.20 a,b ± 0.78 (n = 52)71.00 b ± 0.61 (n = 83)73.60 a ± 0.91 (n = 55)0.043
TSForehead width (cm)12.00 b ± 0.27 (n = 5)12.86 a ± 0.11 (n = 47)12.90 a ± 0.15 (n = 25)0.049
GHRHR-2LFHSBody weight (kg)47.27 b ± 2.96 (n = 23)58.95 a,b ± 4.88 (n = 8)62.87 a ± 3.68 (n = 3)0.050
Notes: STHS: Small tail han sheep; TS: Tong sheep; LFTS: Lanzhou fat-tail sheep: HS: Hu sheep; LSM: least squares technique; SE: standard error; STHS: Small tail han sheep; TS: Tong sheep; LFTS: Lanzhou fat-tail sheep: HS: Hu sheep; II: insertion/insertion; ID: insertion/deletion; DD: deletion/deletion. a,b Values with different superscript letters in the same row differ at p < 0.05 for lower-case.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wu, M.; Zhao, H.; Tang, X.; Li, Q.; Yi, X.; Liu, S.; Sun, X. Novel InDels of GHR, GHRH, GHRHR and Their Association with Growth Traits in Seven Chinese Sheep Breeds. Animals 2020, 10, 1883. https://doi.org/10.3390/ani10101883

AMA Style

Wu M, Zhao H, Tang X, Li Q, Yi X, Liu S, Sun X. Novel InDels of GHR, GHRH, GHRHR and Their Association with Growth Traits in Seven Chinese Sheep Breeds. Animals. 2020; 10(10):1883. https://doi.org/10.3390/ani10101883

Chicago/Turabian Style

Wu, Mingli, Haidong Zhao, Xiaoqin Tang, Qi Li, Xiaohua Yi, Shirong Liu, and Xiuzhu Sun. 2020. "Novel InDels of GHR, GHRH, GHRHR and Their Association with Growth Traits in Seven Chinese Sheep Breeds" Animals 10, no. 10: 1883. https://doi.org/10.3390/ani10101883

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop