Morphological Features and Cold-Response Gene Expression in Mesophilic Bacillus cereus Group and Psychrotolerant Bacillus cereus Group under Low Temperature
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
2.2. Bacterial Growth Capability at Low Temperature
2.3. Field-Emission Scanning Electron Microscopy (FE-SEM)
2.4. RNA Sequencing
2.4.1. Cell Lysis and RNA Isolation
2.4.2. Illumina Sequencing
2.4.3. Differential Gene Expression Analysis
2.5. Gene Expression Analysis Using Reverse Transcription Quantitative PCR (RT-qPCR)
2.6. Statistical Analyses
3. Results
3.1. Growth Capability of Mesophilic B. cereus Group Strain and Psychrotolerant B. cereus Group Strain Activated at Low Temperature
3.2. Microscopic Observations of Mesophilic B. cereus Group Strain and Psychrotolerant B. cereus Group Strain at Low Temperature
3.3. Differential Expression Analysis of Cold-Response-Related Genes
3.3.1. Lipid Metabolism
3.3.2. Energy Metabolism
3.3.3. Amino Acid Metabolism
3.3.4. Carbohydrate Metabolism
3.3.5. Cell Wall/Membrane
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kim, M.J.; Han, J.K.; Park, J.S.; Lee, J.S.; Lee, S.H.; Cho, J.I.; Kim, K.S. Various Enterotoxin and Other Virulence Factor Genes Widespread among Bacillus cereus and Bacillus thuringiensis Strains. J. Microbiol. Biotechnol. 2015, 25, 872–879. [Google Scholar] [CrossRef]
- Moayeri, M.; Leppla, S.H.; Vrentas, C.; Pomerantsev, A.P.; Liu, S. Anthrax Pathogenesis. Annu. Rev. Microbiol. 2015, 69, 185–208. [Google Scholar] [CrossRef]
- Miller, R.A.; Beno, S.M.; Kent, D.J.; Carroll, L.M.; Martin, N.H.; Boor, K.J. Bacillus wiedmannii sp. nov., a Psychrotolerant and Cytotoxic Bacillus cereus Group Species Isolated from Dairy Foods and Dairy Environments. Int. J. Syst. Evol. Microbiol. 2016, 66, 4744–4753. [Google Scholar] [CrossRef] [PubMed]
- Ceuppens, S.; Boon, N.; Uyttendaele, M. Diversity of Bacillus cereus Group Strains is Reflected in Their Broad Range of Pathogenicity and Diverse Ecological Lifestyles. FEMS Microbiol. Ecol. 2013, 84, 433–450. [Google Scholar] [CrossRef] [Green Version]
- Ivy, R.A.; Ranieri, M.L.; Martin, N.H.; den Bakker, H.C.; Xavier, B.M.; Wiedmann, M.; Boor, K.J. Identification and Characterization of Psychrotolerant Sporeformers Associated with Fluid Milk Production and Processing. Appl. Environ. Microbiol. 2012, 78, 1853–1864. [Google Scholar] [CrossRef] [Green Version]
- Takahashia, N.; Satomi, N.; Akane, F.; Yousuke, I.; Kenji, K.; Ayumi, S.; Yuka, M.; Yumiko, T.; Naoko, K.; Yoshinori, T.; et al. Discrimination of Psychrotolerant Bacillus cereus Group Based on MALDITOF MS Analysis of Ribosomal Subunit Proteins. Food Microbiol. 2020, 91, 103542. [Google Scholar] [CrossRef]
- Guerin, A.; Rønning, H.T.; Dargaignaratz, C.; Clavel, T.; Broussolle, V.; Mahillon, J.; Granum, P.E.; Nguyen-The, C. Cereulide Production by Bacillus weihenstephanensis Strains during Growth at Different pH Values and Temperatures. Food Microbiol. 2017, 65, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Haque, M.A.; Russell, N.J. Strains of Bacillus cereus vary in the phenotypic adaptation of Their Membrane Lipid Composition in Response to Low Water Activity, Reduced Temperature and Growth in Rice Starch. Microbiology 2004, 150, 1397–1404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palonen, E.; Lindstrom, M.; Korkeala, H. Adaptation of Enteropathogenic Yersinia to Low Growth Temperature. Crit. Rev. Microbiol. 2010, 36, 54–67. [Google Scholar] [CrossRef]
- Becker, L.A.; Evans, S.N.; Hutkins, R.W.; Benson, A.K. Role of Sigma(B) in Adaptation of Listeria Monocytogenes to Growth at Low Temperature. J. Bacteriol. 2000, 182, 7083–7087. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cronan, J.E.; Rock, C.O. Biosynthesis of Membrane Lipids. EcoSal Plus 2008, 3, 1–44. [Google Scholar] [CrossRef] [PubMed]
- Beckering, C.L.; Steil, L.; Weber, M.H.; Volker, U.; Marahiel, M.A. Genome-Wide Transcriptional Analysis of the Cold Shock Response in Bacillus subtilis. J. Bacteriol. 2002, 184, 6395–6402. [Google Scholar] [CrossRef] [Green Version]
- Brillard, J.; Jehanno, I.; Dargaignaratz, C.; Barbosa, I.; Ginies, C.; Carlin, F.; Fedhila, S.; Nguyen-the, C.; Broussolle, V.; Sanchis, V. Identification of Bacillus cereus Genes Specifically Expressed during Growth at Low Temperatures. Appl. Environ. Microbiol. 2010, 76, 2562–2573. [Google Scholar] [CrossRef] [Green Version]
- Ermolenko, D.N.; Makhatadze, G.I. Bacterial Cold-Shock Proteins. Cell. Mol. Life Sci. 2002, 59, 1902–1913. [Google Scholar] [CrossRef]
- Goodchild, A.; Saunders, N.F.W.; Ertan, H.; Raftery, M.; Guilhaus, M.; Curmi, P.M.G. A Proteomic Determination of Cold Adaptation in the Antarctic Archaeon, Methanococcoides burtonii. Mol. Microbiol. 2004, 53, 309–321. [Google Scholar] [CrossRef]
- Prakash, J.S.S.; Sinetova, M.; Zorina, A.; Kupriyanova, E.; Suzuki, I.; Murata, N. DNA Supercoiling Regulates the Stress-Inducible Expression of Genes in the Cyanobacterium Synechocystis. Mol. BioSyst. 2009, 5, 1904. [Google Scholar] [CrossRef] [Green Version]
- Park, K.M.; Kim, H.J.; Jeong, M.; Koo, M. Enterotoxin Genes, Antibiotic Susceptibility, and Biofilm Formation of Low-Temperature-Tolerant Bacillus cereus Isolated from Lettuce in the Cold Chain. Foods 2020, 9, 249. [Google Scholar] [CrossRef] [Green Version]
- Clavel, T.; Carlin, F.; Lairon, D.; Nguyen-The, C.; Schmitt, P. Survival of Bacillus cereus Spores and Vegetative Cells in Acid Media Simulating Human Stomach. J. Appl. Microbiol. 2014, 97, 214–219. [Google Scholar] [CrossRef]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and Memory-Efficient Alignment of Short DNA Sequences to the Human Genome and the Expression Levels Were Estimated by RSEM. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Zhou, X.R.; Pang, B.P.; Zhang, Z.R.; Chang, J.; Shan, Y.M. Effects of Low Temperature Stress on the Super Cooling Capacity and Development of Galeruca daurica (Joannis) larvae (Coleoptera: Chrysomelidae). Chin. J. Appl. Entomol. 2015, 52, 434–439. [Google Scholar]
- Leng, N.; Dawson, J.A.; Thomson, J.A.; Ruotti, V.; Rissman, A.I.; Smits, B.M.; Haag, J.D.; Gould, M.N.; Stewart, R.M.; Kendziorski, C. EBSeq: An Empirical Bayes Hierarchical Model for Inference in RNA-seq Experiments. Bioinformatics 2013, 29, 1035–1043. [Google Scholar] [CrossRef] [Green Version]
- Benjamini, Y.; Yekutieli, D. The Control of the False Discovery Rate in Multiple Testing under Dependency. Ann. Stat. 2001, 29, 1165–1188. [Google Scholar] [CrossRef]
- Den Besten, H.M.W.; Mols, R.; Moezelaar, M.H.; Zwietering, T. Phenotypic and Transcriptomic Analyses of Mildly and Severely Salt-Stressed Bacillus cereus ATCC 14579 Cells. Appl. Environ. Microbiol. 2009, 75, 4111–4119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Sarrau, B.; Clavel, T.; Bornard, I.; Nguyen-the, C. Low Temperatures and Fermentative Metabolism Limit Peptidoglycan Digestion of Bacillus cereus. Impact on Colony Forming Unit Counts. Food Microbiol. 2013, 33, 213–220. [Google Scholar] [CrossRef]
- Madigan, M.; Martinko, J.; Parker, J. Brock Biology of Microorganisms; Prentice Hall: Upper Saddle River, NJ, USA, 2006. [Google Scholar]
- Bisson-Filho, A.W.; Hsu, Y.-P.; Squyres, G.R.; Kuru, E.; Wu, F. Treadmilling by FtsZ Filaments Drives Peptidoglycan Synthesis and Bacterial Cell Division. Science 2017, 355, 739–743. [Google Scholar] [CrossRef] [Green Version]
- Bassolé, I.H.N.; Juliani, H.R. Essential Oils in Combination and Their Antimicrobial Properties. Molecules 2012, 17, 3989–4006. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McGivney, E.; Han, L.; Avellan, A.; VanBriesen, J.; Gregory, K.B. Disruption of Autolysis in Bacillus subtilis using TiO2 Nanoparticles. Sci. Rep. 2017, 7, 44308. [Google Scholar] [CrossRef]
- De Maayer, P.; Anderson, D.; Cary, C.; Cowan, D.A. Some Like It Cold: Understanding the Survival Strategies of Psychrophiles. EMBO Rep. 2014, 15, 508–517. [Google Scholar] [CrossRef] [PubMed]
- Ingenbleek, Y.; Kimura, H. Nutritional Essentiality of Sulfur in Health and Disease. Nutr. Rev. 2013, 71, 413–432. [Google Scholar] [CrossRef]
- Brown, K.A. Sulphur in the environment: A review. Environ. Pollut. Ser. 1982, B3, 47–80. [Google Scholar] [CrossRef]
- Aguilar-Barajas, E.; Diaz-Perez, C.; Ramirez-Diaz, M.I.; Riveros-Rosas, H.; Cervantes, C. Bacterial Transport of Sulfate, Molybdate, and Related Oxyanions. Biometals 2011, 24, 687–707. [Google Scholar] [CrossRef] [PubMed]
- Sirko, A.; Zatyka, M.; Sadowy, E.; Hulanicka, D. Sulfate and Thiosulfate Transport in Escherichia coli K-12: Evidence for a Functional Overlapping of Sulfate- and Thiosulfate-Binding Proteins. J. Bacteriol. 1995, 177, 4134–4136. [Google Scholar] [CrossRef] [Green Version]
- Eichhorn, E.; van der Ploeg, J.R.; Leisinger, T. Characterization of a Two-Component Alkanesulfonate Monooxygenase from Escherichia coli. J. Biol. Chem. 1999, 274, 26639–26646. [Google Scholar] [CrossRef] [Green Version]
- Van der Ploeg, J.R.; Iwanicka-Nowicka, R.; Bykowski, T.; Hryniewicz, M.M.; Leisinger, T. The Escherichia coli ssuEADCB Gene Cluster is Required for the Utilization of Sulfur from Aliphatic Sulfonates and Is Regulated by the Transcriptional Activator Cbl. J. Biol. Chem. 1999, 274, 29358–29365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mansilla, M.C.; Albanesi, D.; de Mendoza, D. Transcriptional Control of the Sulfur-Regulated cysH Operon, Containing Genes Involved in L-cysteine Biosynthesis in Bacillus subtilis. J. Bacteriol. 2000, 182, 5885–5892. [Google Scholar] [CrossRef] [Green Version]
- Huillet, E.; Tempelaars, M.H.; André-Leroux, G.; Wanapaisan, P.; Bridoux, L.; Makhzami, S. PlcRa, a New Quorum-Sensing Regulator from Bacillus cereus, Plays a Role in Oxidative Stress Responses and Cysteine Metabolism in Stationary Phase. PLoS ONE 2012, 7, e51047. [Google Scholar] [CrossRef] [PubMed]
- Maghnouj, A.; de Sousa Cabral, T.F.; Stalon, V.; Vander Wauven, C. The arcABDC Gene Cluster, Encoding the Arginine Deiminase Pathway of Bacillus licheniformis, and Its Activation by the Arginine Repressor ArgR. J. Bacteriol. 1998, 180, 6468–6475. [Google Scholar] [CrossRef] [Green Version]
- Ryan, S.; Begley, M.; Gahan, C.G.; Hill, C. Molecular Characterization of the Arginine Deiminase System in Listeria monocytogenes: Regulation and Role in Acid Tolerance. Environ. Microbiol. 2009, 11, 432–445. [Google Scholar] [CrossRef]
- Senouci-Rezkallah, K.; Schmitt, P.; Jobin, M.P. Amino acids Improve Acid Tolerance and Internal pH Maintenance in Bacillus cereus ATCC14579 Strain. Food Microbiol. 2011, 28, 364–372. [Google Scholar] [CrossRef]
- Alcázar, R.; Marco, F.; Cuevas, J.C.; Patron, M.; Ferrando, A.; Carrasco, P. Involvement of Polyamines in Plant Response to Abiotic Stress. Biotechnol. Lett. 2006, 28, 1867–1876. [Google Scholar] [CrossRef]
- Culham, D.E.; Vernikovska, Y.; Tschowri, N.; Keates, R.A.; Wood, J.M.; Boggs, J.M. Periplasmic Loops of Osmosensory Transporter ProP in Escherichia Coli Are Sensitive to Osmolality. Biochemistry 2008, 47, 13584–13593. [Google Scholar] [CrossRef]
- Lobritz, M.A.; Belenky, P.; Porter, C.B.; Gutierrez, A.; Yang, J.H.; Schwarz, E.G.; Dwyer, D.J.; Khalil, A.S.; Collins, J.J. Antibiotic Efficacy is Linked to Bacterial Cellular Respiration. Proc. Natl. Acad. Sci. USA 2015, 112, 8173–8180. [Google Scholar] [CrossRef] [Green Version]
- Link, H.; Fuhrer, T.; Gerosa, L.; Zamboni, N.; Sauer, U. Real-Time Metabolome Profiling of the Metabolic Switch between Starvation and Growth. Nat. Methods 2015, 12, 1091–1097. [Google Scholar] [CrossRef] [PubMed]
- Mykytczuk, N.C.S.; Foote, S.J.; Omelon, C.R.; Southam, G.; Greer, C.W.; Whyte, L.G. Bacterial Growth at −15 °C; Molecular Insights from the Permafrost Bacterium Planococcus halocryophilus Or1. ISME J. 2013, 7, 1211–1226. [Google Scholar] [CrossRef] [Green Version]
- Franchini, A.G.; Ihssen, J.; Egli, T. Effect of Global Regulators RpoS and Cyclic- AMP/CRP on the Catabolome and Transcriptome of Escherichia coli K12 during Carbon- and Energy-Limited Growth. PLoS ONE 2015, 10, e01337934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piette, F.; Leprince, P.; Feller, G. Is There a Cold Shock Response in the Antarctic Psychrophile Pseudoalteromonas haloplanktis? Extremophiles 2012, 16, 681–683. [Google Scholar] [CrossRef]
- López, C.S.; Alice, A.F.; Heras, H.; Rivas, E.A.; Sánchez-Rivas, C. Role of Anionic Phospholipids in the Adaptation of Bacillus subtilis to High Salinity. Microbiology 2006, 152, 605–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dominguez-Escobar, J.; Chastanet, A.; Crevenna, A.H.; Fromion, V.; Wedlich-Soldner, R.; Carballido-Lopez, R. Processive Movement of Mreb-Associated Cell Wall Biosynthetic Complexes in Bacteria. Science 2011, 333, 225–228. [Google Scholar] [CrossRef] [Green Version]
- Daniel, R.A.; Errington, J. Control of Cell Morphogenesis in Bacteria: Two Distinct Ways to Make a Rod-Shaped Cell. Cell 2003, 113, 767–776. [Google Scholar] [CrossRef] [Green Version]
- Wong, L.S.; Johnson, M.S.; Sandberg, L.B.; Taylor, B.L. Amino Acid Efflux in Response to Chemotactic and Osmotic Signals in Bacillus subtilis. J. Bacteriol. 1995, 177, 4342–4349. [Google Scholar] [CrossRef] [Green Version]
- Houry, R.; Briandet, S.; Aymerich, M. Involvement of Motility and Flagella in Bacillus cereus Biofilm Formation. A. Microbiology 2010, 156, 1009–1018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guttenplan, S.B.; Shaw, S.; Kearns, D.B. The Cell Biology of Peritrichous Flagella in Bacillus subtilis. Mol. Microbiol. 2013, 87, 211–229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mattila, M.; Lindström, M.; Somervuo, P.; Markkula, A.; Korkeala, H. Role of flhA and motA in Growth of Listeria monocytogenes at Low Temperatures. Int. J. Food Microbiol. 2011, 148, 177–183. [Google Scholar] [CrossRef] [PubMed]
- Eshwar, A.K.; Guldimann, C.; Oevermann, A.; Tasara, T. Cold-Shock Domain Family Proteins (Csps) are Involved in Regulation of Virulence, Cellular Aggregation, and Flagella-Based Motility in Listeria monocytogenes. Front. Cell. Infect. Microbiol. 2017, 7, 453. [Google Scholar] [CrossRef] [PubMed]
- Bresolin, G.; Neuhaus, K.; Scherer, S.; Fuchs, T.M. Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth. J. Bacteriol. 2006, 188, 2945–2958. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kawamoto, J.; Kurihara, T.; Kitagawa, M.; Kato, I.; Esaki, N. Proteomic Studies of an Antarctic Cold-Adapted Bacterium, Shewanella livingstonensis Ac10, for Global Identification of Cold-Inducible Proteins. Extremophiles 2007, 11, 819–826. [Google Scholar] [CrossRef]
- Raymond-Bouchard, I.; Julien, T.; Ianina, A.; Charles, W.G.; Lyle, G.W. Comparative Transcriptomics of Cold Growth and Adaptive Features of a Eury- and Steno-Psychrophile. Front. Microbiol. 2018, 9, 1565. [Google Scholar] [CrossRef]
Gene | Primer | Sequence (5′→3′) | Tm (°C) | GC (%) | Product Size (bp) |
---|---|---|---|---|---|
uppP | uppP -F | TCCAGCAGGTGTTATTGGTG | 60.1 | 50.0 | 186 |
uppP -R | GCTTGTGCTAATCCGACGAT | 60.0 | 50.0 | ||
murG | murG -F | GGTACAGCCGGACACGTTAT | 59.9 | 50.0 | 155 |
murG -R | CTCCTAAGCTTTCCCGTTGA | 59.4 | 55.0 | ||
mraY | mraY -F | AGCTTTAGGTGGAGCCATTG | 59.3 | 60.0 | 210 |
mraY -R | GTCACAACAACACGCCACTC | 60.2 | 55.0 | ||
fabG | fabG -F | GCAGCGAAAGTAGGACTTGT | 57.2 | 60.0 | 182 |
fabG -R | TCACCTGTTCCAGATCTACC | 55.0 | 50.0 | ||
fabH | fabH -F | GAATTAGGAGCAGACGGAAG | 56.6 | 55.0 | 211 |
fabH -R | ACCTCTCTCTTGCAGATTCC | 56.0 | 50.0 | ||
fadE | fadE -F | AAGAAGGAGAGCAAGCTAGG | 55.7 | 50.0 | 152 |
fadE -R | GCAATACCGTTACGACCTC | 55.7 | 52.6 | ||
rpoB | rpoB-F | CGGAGCTTGGTTAGAGTATG | 55.2 | 50.0 | 230 |
rpoB-R | CAGGACGTAGACGCTCATAA | 56.6 | 50.0 |
Name | Raw | Clean | Mapped | Uniquely Mapped | Splice | Gene |
---|---|---|---|---|---|---|
BCGT_C * | 28,665,486 | 27,171,092 (94.8%) | 26,397,864 (97.2%) | 24,064,848 (88.6%) | 758 (0.0%) | 5015 |
BCGT_T | 32,167,584 | 30,479,776 (94.8%) | 29,567,793 (97.0%) | 28,795,121 (94.5%) | 2599 (0.0%) | 5089 |
BCG34_C ** | 26,733,232 | 25,381,698 (94.9%) | 23,359,519 (92.0%) | 22,653,509 (89.3%) | 4025 (0.0%) | 4901 |
BCG34_T | 36,039,900 | 34,424,698 (95.5%) | 30,175,814 (87.7%) | 14,568,814 (42.3%) | 4051 (0.0%) | 5047 |
Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) | Psychrotolerant B. cereus Group Strain (BCG34) | ||
---|---|---|---|---|---|---|---|
Fold Change (Log2) | p-Value | Fold Change (Log2) | p-Value | ||||
Lipid metabolism | TBIG004756 | menE | 2-succinylbenzoate-CoA ligase | −2.79 | 0.037 | 2.97 | 0.219 |
TBIG001316 | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase | 4.61 | 0.004 | −0.57 | 0.044 | |
TBIG001751 | fabH2 | 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 | 3.09 | 0.024 | −0.83 | 0.039 | |
TBIG001966 | lcfA | Long-chain-fatty-acid-CoA ligase | 3.08 | 0.033 | 0.41 | 0.383 | |
TBIG005175 | fabZ | 3-hydroxyacyl-[acyl-carrier-protein] dehydratase | 2.85 | 0.040 | - * | - | |
TBIG004904 | fadE | Probable acyl-CoA dehydrogenase | 4.63 | 0.039 | 3.05 | 0.027 | |
TBIG002725 | fadR | Fatty acid metabolism regulator protein | 6.84 | 0.016 | 0.75 | 0.272 | |
Biotin metabolism | TBIG002459 | accC2 | Biotin carboxylase 2 | 5.15 | 0.025 | −1.29 | 0.245 |
TBIG002460 | yngHB | Biotin/lipoyl attachment protein | 4.64 | 0.013 | −0.82 | 0.472 |
Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) | Psychrotolerant B. cereus Group Strain (BCG34) | ||
---|---|---|---|---|---|---|---|
Fold Change (Log2) | p-Value | Fold Change (Log2) | p-Value | ||||
Energy Metabolism | TBIG001419 | sat | Sulfate adenylyltransferase | 5.48 | 0.0001 | −3.51 | 0.127 |
TBIG001420 | CYSC1_ BACHD | Probable adenylyl-sulfate kinase | 5.68 | 0.0001 | −3.09 | 0.184 | |
TBIG001418 | cysH | Phosphoadenosine phosphosulfate reductase | 4.12 | 0.003 | −1.01 | 0.624 | |
TBIG002870 | ssuA | Putative aliphatic sulfonates-binding protein | 7.71 | 0.009 | - * | - | |
TBIG001323 | cysA2 | Sulfate/thiosulfate import ATP-binding protein | 3.66 | 0.010 | −1.76 | 0.432 | |
TBIG001098 | cysW | Sulfate transport system permease protein | 3.76 | 0.018 | - | - | |
TBIG001323 | cysA | Sulfate/thiosulfate import ATP-binding protein | 3.37 | 0.019 | −1.76 | 0.432 | |
TBIG001324 | fbpB | Ferric transport system permease protein | 3.33 | 0.019 | −1.27 | 0.558 | |
TBIG001097 | cysU | Sulfate transport system permease protein | 3.29 | 0.033 | - | - | |
Cysteine metabolism | TBIG001873 | abrB | Transition state regulatory protein | −2.85 | 0.047 | −2.26 | 0.331 |
TBIG003929 | metE | 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase | 3.82 | 0.035 | −2.98 | 0.027 | |
TBIG005298 | OAH sulfhydrylase | O-acetylhomoserine (thiol)-lyase | 4.43 | 0.037 | 0.98 | 0.388 | |
TBIG002703 | yosT | SPBc2 prophage-derived putative transcriptional regulator | 4.44 | 0.032 | - | - | |
Glutathione metabolism | TBIG002097 | bsaA | Glutathione peroxidase homolog | 3.16 | 0.020 | 1.67 | 0.469 |
Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) | Psychrotolerant B. cereus Group Strain (BCG34) | ||
---|---|---|---|---|---|---|---|
Fold Change (Log2) | p-Value | Fold Change Log2) | p-Value | ||||
Arginine metabolism | TBIG000429 | arcC | Carbamate kinase | −7.04 | 0.0002 | - * | - |
TBIG000427 | arcB | Ornithine carbamoyltransferase | −8.65 | 0.001 | - | - | |
TBIG003492 | argH | Argininosuccinate lyase | −6.94 | 0.012 | 0.99 | 0.560 | |
TBIG000426 | arcA | Arginine deiminase | −6.09 | 0.012 | - | - | |
TBIG004050 | argF | Ornithine carbamoyltransferase | −3.08 | 0.019 | 0.50 | 0.811 | |
TBIG004053 | argJ | Arginine biosynthesis bifunctional protein | −2.95 | 0.044 | 4.00 | 0.048 | |
TBIG002004 | bltD | Spermine/spermidine acetyltransferase | −3.51 | 0.035 | 0.77 | 0.734 | |
TBIG000205 | rocF | Arginase | 3.27 | 0.030 | −1.58 | 0.031 | |
BCAA metabolism | TBIG000890 | alsS | Acetolactate synthase | −6.57 | 0.008 | 2.64 | 0.262 |
TBIG001396 | ilvC1 | Ketol-acid reductoisomerase 1 | −2.83 | 0.032 | −3.31 | 0.177 | |
TBIG002461 | yngG | Hydroxymethylglutaryl-CoA lyase | 5.24 | 0.0003 | −0.57 | 0.753 | |
TBIG001913 | LIVB5_ BRUME | Leu/Ile/Val-binding protein homolog 5 | 3.23 | 0.016 | 5.31 | 0.047 | |
Histidine metabolism | TBIG003587 | hutH | Histidine ammonia-lyase | 5.27 | 0.022 | −2.61 | 0.226 |
TBIG000514 | hutI | Imidazolonepropionase | 5.09 | 0.025 | −2.69 | 0.254 | |
Tryptophan metabolism | TBIG004527 | Y4613_ BACCR | UPF0173 metal-dependent hydrolase | 3.25 | 0.040 | ||
TBIG002724 | kynU | Kynureninase | 0.39 | 0.086 | 3.46 | 0.027 | |
TBIG002723 | kynB | Kynurenine forma midase | 0.30 | 0.096 | 3.06 | 0.021 |
Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) | Psychrotolerant B. cereus Group Strain (BCG34) | ||
---|---|---|---|---|---|---|---|
Fold Change (Log2) | p-Value | Fold Change (Log2) | p-Value | ||||
Glycolysis/ Gluconeogenesis | TBIG005105 | licH | Probable 6-phospho-beta-glucosidase | −6.04 | 0.014 | −1.42 | 0.533 |
TBIG003111 | colA | Colossin-A | −5.54 | 0.017 | −0.96 | 0.655 | |
TBIG002269 | Hgd | 2-(hydroxymethyl) glutarate dehydrogenase | 4.67 | 0.004 | −0.41 | 0.822 | |
TBIG002742 | acoC | Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system | −1.02 | 0.044 | −5.99 | 0.026 | |
TBIG004774 | ldh2 | L-lactate dehydrogenase 2 | −1.74 | 0.036 | −6.63 | 0.012 | |
TBIG002741 | acoL | Dihydrolipoyl dehydrogenase | −2.29 | 0.073 | −6.51 | 0.017 | |
TBIG005034 | eno | Enolase | −3.99 | 0.187 | −4.05 | 0.049 | |
TBIG005229 | fba | Fructose-bisphosphate aldolase | −1.76 | 0.041 | −3.89 | 0.031 | |
TBIG003899 | pdhA | Pyruvate dehydrogenase E1 component subunit alpha | −0.24 | 0.091 | −3.86 | 0.044 | |
TBIG004898 | ldh3 | L-lactate dehydrogenase 3 | 0.37 | 0.076 | −7.88 | 0.042 | |
TBIG005308 | cstA | Carbon starvation protein A | 1.95 | 0.160 | 4.29 | 0.018 | |
TBIG003044 | adhB | Alcohol dehydrogenase 2 | −1.26 | 0.298 | 4.39 | 0.044 | |
TBIG002744 | acoA | 2,6-dichlorophenolindophenol oxidoreductase subunit alpha | −0.70 | 0.058 | −5.82 | 0.033 | |
TBIG003898 | pdhB | Pyruvate dehydrogenase E1 component subunit beta | −0.70 | 0.755 | −4.67 | 0.047 | |
TBIG002743 | acoB | 2,6-dichlorophenolindophenol oxidoreductase subunit beta | −1.79 | 0.052 | −6.29 | 0.027 | |
TBIG001043 | glpD | Aerobicglycerol−3-phosphate dehydrogenase | −0.83 | 0.516 | −4.39 | 0.069 | |
TBIG000510 | pflA | Pyruvate formate-lyase-activating enzyme | −5.44 | 0.141 | −8.17 | 0.009 | |
TBIG002789 | ppaC | Probable manganese-dependent inorganic pyrophosphatase | −0.65 | 0.600 | −4.08 | 0.079 | |
TBIG001499 | gpsA | Glycerol−3-phosphate dehydrogenase | −2.36 | 0.195 | −3.91 | 0.085 | |
Citrate cycle (TCA cycle) | TBIG001253 | odhA | 2-oxoglutarate ehydrogenase E1 component | −0.64 | 0.759 | −4.08 | 0.048 |
TBIG003896 | pdhD | Dihydrolipoyl dehydrogenase | −0.84 | 0.684 | −4.06 | 0.033 | |
TBIG001252 | odhB | Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex | −0.84 | 0.704 | −3.59 | 0.033 | |
Butanoate metabolism | TBIG000891 | alsD | Alpha-acetolactate decarboxylase | −6.96 | 0.007 | 1.78 | 0.428 |
TBIG004083 | buk | Probable butyrate kinase | −1.27 | 0.548 | −3.38 | 0.045 | |
Inositol phosphate metabolism | TBIG003692 | PI-PLC | 1-phosphatidylinositol phosphodiesterase | −3.69 | 0.008 | −4.5 | 0.004 |
TBIG002621 | Inos | Inositol−3-phosphate synthase | 3.49 | 0.027 | - * | - | |
Pentose phosphate pathway | TBIG000359 | pcrB | Heptaprenylglyceryl phosphate synthase | −3.18 | 0.029 | 0.79 | 0.970 |
TBIG003617 | tkt | Transketolase | −1.77 | 0.292 | −4.96 | 0.031 | |
TBIG004012 | deoB | Phosphopentomutase | −1.27 | 0.548 | −3.38 | 0.045 | |
Starch and sucrose metabolism | TBIG000435 | mapP | Maltose 6′-phosphate phosphatase | −2.82 | 0.033 | 2.05 | 0.368 |
TBIG003312 | ydzE | Putative permease-like protein | 3.53 | 0.014 | 0.98 | 0.993 | |
Pyruvate metabolism | TBIG000509 | pflB | Formate acetyltransferase | −3.97 | 0.039 | −8.65 | 0.251 |
TBIG002463 | yngE | Uncharacterized carboxylase | 4.49 | 0.042 | −1.84 | 0.381 | |
Propanoate metabolism | TBIG002267 | prpB | Methylisocitrate lyase | 4.34 | 0.003 | −2.18 | 0.244 |
Glyoxylate and dicarboxylate metabolism | TBIG002265 | mmgD | 2-methylcitrate synthase | 5.32 | 0.024 | −1.07 | 0.524 |
TBIG003865 | amiF | Formamidase | 3.04 | 0.033 | 2.28 | 0.240 | |
Amino sugar and nucleotide sugar metabolism | TBIG003557 | nodB | Chitooligosaccharide deacetylase | 2.72 | 0.038 | 3.49 | 0.200 |
Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) | Psychrotolerant B. cereus Group Strain (BCG34) | ||
---|---|---|---|---|---|---|---|
Fold Change (Log2) | p-Value | Fold Change (Log2) | p-Value | ||||
Peptidoglycan biosynthesis | TBIG003837 | murG | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | −6.79 | 0.012 | 2.21 | 0.033 |
TBIG000690 | uppP | Undecaprenyl-diphosphatase | −5.03 | 0.018 | 1.27 | 0.047 | |
TBIG003840 | mraR | Phospho-N-acetylmuramoyl- pentapeptide-transferase | −1.81 | 0.047 | 1.76 | 0.030 | |
TBIG005169 | epsC | UDP-N-acetylglucosamine 4,6-dehydratase | −3.14 | 0.033 | 2.67 | 0.036 | |
Cell growth factor | TBIG002125 | spoVS | Stage V sporulation protein S | 2.97 | 0.046 | 3.05 | 0.191 |
TBIG002015 | cotH | Inner spore coat protein H | 2.63 | 0.042 | 2.79 | 0.241 | |
TBIG001634 | flgB | Flagellar basal body rod protein | 3.57 | 0.030 | - * | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, K.-M.; Kim, H.-J.; Kim, M.-S.; Koo, M. Morphological Features and Cold-Response Gene Expression in Mesophilic Bacillus cereus Group and Psychrotolerant Bacillus cereus Group under Low Temperature. Microorganisms 2021, 9, 1255. https://doi.org/10.3390/microorganisms9061255
Park K-M, Kim H-J, Kim M-S, Koo M. Morphological Features and Cold-Response Gene Expression in Mesophilic Bacillus cereus Group and Psychrotolerant Bacillus cereus Group under Low Temperature. Microorganisms. 2021; 9(6):1255. https://doi.org/10.3390/microorganisms9061255
Chicago/Turabian StylePark, Kyung-Min, Hyun-Jung Kim, Min-Sun Kim, and Minseon Koo. 2021. "Morphological Features and Cold-Response Gene Expression in Mesophilic Bacillus cereus Group and Psychrotolerant Bacillus cereus Group under Low Temperature" Microorganisms 9, no. 6: 1255. https://doi.org/10.3390/microorganisms9061255