Next Article in Journal
Sphingomonas sediminicola Dae20 Is a Highly Promising Beneficial Bacteria for Crop Biostimulation Due to Its Positive Effects on Plant Growth and Development
Next Article in Special Issue
Adenoviral Vector Codifying for TNF as a Co-Adjuvant Therapy against Multi-Drug-Resistant Tuberculosis
Previous Article in Journal
The Crosstalk between Gut Microbiota and Bile Acids Promotes the Development of Non-Alcoholic Fatty Liver Disease
Previous Article in Special Issue
Oral Myco- and Bacteriobiota and Yeast Infections in Mechanically Ventilated COVID-19 Patients
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CRISPR-Cas-Based Adaptive Immunity Mediates Phage Resistance in Periodontal Red Complex Pathogens

by
Pradeep Kumar Yadalam
1,*,
Deepavalli Arumuganainar
2,
Raghavendra Vamsi Anegundi
1,
Deepti Shrivastava
3,*,
Sultan Abdulkareem Ali Alftaikhah
4,
Haifa Ali Almutairi
4,
Muhanad Ali Alobaida
5,
Abdullah Ahmed Alkaberi
5 and
Kumar Chandan Srivastava
6,7
1
Department of Periodontics, Saveetha Institute of Medical and Technical Sciences (SIMATS), Saveetha Dental College and Hospitals, Saveetha University, Chennai 600077, India
2
Department of Periodontics, Ragas Dental College and Hospital, 2/102, East Coast Road, Uthandi, Chennai 600119, India
3
Periodontics Division, Preventive Dentistry Department, College of Dentistry, Jouf University, Sakaka 72345, Saudi Arabia
4
College of Dentistry, Jouf University, Sakaka 72345, Saudi Arabia
5
General Dentist, Ministry of Health, Riyadh 12613, Saudi Arabia
6
Oral Medicine & Maxillofacial Radiology Division, Department of Oral & Maxillofacial Surgery & Diagnostic Sciences, College of Dentistry, Jouf University, Sakaka 72345, Saudi Arabia
7
Department of Oral Medicine and Radiology, Saveetha Dental College, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai 602105, India
*
Authors to whom correspondence should be addressed.
Microorganisms 2023, 11(8), 2060; https://doi.org/10.3390/microorganisms11082060
Submission received: 13 June 2023 / Revised: 23 July 2023 / Accepted: 1 August 2023 / Published: 11 August 2023
(This article belongs to the Special Issue Infectious Diseases, New Approaches to Old Problems 2.0)

Abstract

:
Periodontal diseases are polymicrobial immune–inflammatory diseases that can severely destroy tooth-supporting structures. The critical bacteria responsible for this destruction include red complex bacteria such as Porphoromonas gingivalis, Tanerella forsythia and Treponema denticola. These organisms have developed adaptive immune mechanisms against bacteriophages/viruses, plasmids and transposons through clustered regularly interspaced short palindromic repeats (CRISPR) and their associated proteins (Cas). The CRISPR-Cas system contributes to adaptive immunity, and this acquired genetic immune system of bacteria may contribute to moderating the microbiome of chronic periodontitis. The current research examined the role of the CRISPR-Cas system of red complex bacteria in the dysbiosis of oral bacteriophages in periodontitis. Whole-genome sequences of red complex bacteria were obtained and investigated for CRISPR using the CRISPR identification tool. Repeated spacer sequences were analyzed for homologous sequences in the bacteriophage genome and viromes using BLAST algorithms. The results of the BLAST spacer analysis for T. denticola spacers had a 100% score (e value with a bacillus phage), and the results for T. forsthyia and P. gingivalis had a 56% score with a pectophage and cellulophage (e value: 0.21), respectively. The machine learning model of the identified red complex CRISPR sequences predicts with area an under the curve (AUC) accuracy of 100 percent, indicating phage inhibition. These results infer that red complex bacteria could significantly inhibit viruses and phages with CRISPR immune sequences. Therefore, the role of viruses and bacteriophages in modulating sub-gingival bacterial growth in periodontitis is limited or questionable.

1. Introduction

Periodontal diseases are polymicrobial immune–inflammatory diseases that can severely destroy the periodontal ligament and adjacent supportive alveolar bone [1,2]. They are prevalent worldwide, affecting large populations, and have become a public health concern. Dental biofilm is a forerunner in the development of periodontal disease. The sub-gingival microbiota contain more than 700 bacterial species [3,4]. However, the red complex includes Porphyromonas gingivalis, Treponema denticola and Tannerella forsythia (formerly Bacteroides forsythus), encompassing the most critical pathogens associated with human adult periodontal diseases [1,5]. Furthermore, the prevalence of potential periodontopathogens, including Fusobacterium nucleatum, Prevotella species, Eikenella corrodens, Peptostreptococcus micros and Campylobacter rectus, are enhanced in deep periodontal pockets [6], which leads to the spread of microorganisms to the distant site, causing cardiovascular disease, pulmonary infections, cancer initiation and promotion, pre-term low birth weight, Alzheimer’s disease and Parkinson’s disease [7].
Gingivitis and periodontitis destroy the surrounding structure of soft tissue and the hard tissues of teeth, leading to tooth mobility and loss. Diagnoses are based on clinical, radiographical and microbial investigations [8]. These investigations can identify and isolate specific microorganisms or whole metagenome profiles in infected oral cavities. However, isolating and identifying phages and viromes is not a regular clinical investigation. Additionally, the role of viruses and phages in periodontal disease is still debatable, as they have been proven clinically, but their exact role has not been discussed scientifically.
Virulent and temperate phages are two types of bacteriophages. They are viruses that infect bacteria and replicate using bacterial replication mechanisms. A virulent phage, or lytic phage, strictly follows a lytic cycle. In this cycle, the phage infects the bacterium, reproduces new phages using the bacterial machinery and ultimately causes the bacterial cell to lyse (break apart), releasing newly produced phages. This cycle eventually leads to the destruction of the bacterial cell. An example of a virulent phage is the T-even phage [9].
Temperate phages, conversely, can adopt either a lytic cycle similar to virulent phages or a lysogenic cycle. Instead of immediately killing the host cell in the lysogenic cycle, the phage integrates its DNA into the bacterial chromosome and becomes a prophage. The prophage DNA replicates passively along with the bacterial DNA during regular bacterial cell divisions. Under certain circumstances, such as when the bacterium is under stress, the prophage can be induced to switch to the lytic cycle [10].
Temperate phages can play a significant role in bacterial infection and in the ability of a bacterium to escape immunity and cause infection. One of the ways this occurs is through a process known as a lysogenic conversion, in which temperate phages integrate into the bacterial chromosome as prophages and can carry and express virulence factors. These virulence factors can enhance the bacterial host’s ability to cause disease, increasing their pathogenic potential [2].
Another mechanism by which temperate phages can enhance bacterial virulence is through phage induction. Phage induction is a process in which a prophage is excised from the bacterial chromosome and enters the lytic cycle, facilitating cell lysis and the production and release of virulence molecules. This not only leads to the spread of the phage but also aids in the dispersion of virulence factors, posing a potential risk to human health [1].
Emerging technologies such as genome sequencing and transcriptomics have helped researchers dig deeper into the complex interplay between temperate phages and bacterial virulence. They have revealed more subtle ways that prophages can contribute to bacterial pathogenicity, such as influencing bacterial gene expression or metabolic processes. However, research in this field is ongoing, and many intricate layers remain to be explored about the relationships between temperate phages and bacterial virulence.
Recent studies have reported the diversity of viruses in the oral cavity; most viromes contain bacteriophages [11]. Bacteriophage-based therapeutics are currently under investigation for different diseases, as they bypass the problem of antibiotic resistance. In periodontitis, bacteriophage-based therapy can also be applied, as it can overcome the bacteria’s multi-drug resistance and the disease’s recurrence [9]. However, acquired resistance against the phage limits the therapeutic potential of bacteriophages [12]. In most bacteria and archaea CRISPR-Cas (clustered regularly interspaced short palindromic repeats), the system contributes to adaptive immunity in most bacteria and archaea via a DNA-encoded, RNA-mediated and nucleic acid targeting mechanism [13]. Different types of CRISPR-Cas systems have been identified, each with unique characteristics. For instance, the CRISPR-Cas13a system, a type VI-A system, targets messenger RNA rather than DNA. This system effectively inhibits certain phages, protecting the bacterial cell from infection.
Similarly, the type I-C CRISPR-Cas system has shown activity in inhibiting phage antagonists, providing a certain level of immunity to the bacteria. However, this immunity was found to be limited in a study conducted on E. lenta, a species of bacteria, indicating that the efficacy of the CRISPR-Cas system can vary depending on specific factors, such as the type of bacteria and phage involved [14].
Although phages are the primary targets of CRISPR-Cas systems, these systems can also target other genetic elements, such as integrative conjugative elements (ICEs) [15]. It was found that more than 80% of isolates with an active CRISPR-Cas system have spacers (segments of foreign DNA stored in the bacterial genome) that target ICEs or similar elements.
Clustered regularly interspaced short palindromic repeats (CRISPR) belong to a family of DNA sequences derived from bacteriophages and are characterized by short, direct repeats separated by spacers. The CRISPR-Cas adaptive immune system, which provides immunological memory by introducing short DNA sequences from phage and other parasite DNA elements into CRISPR loci on the host genome, is present in about half of all bacteria. In contrast to the fast evolution of CRISPR loci in their natural environments, bacterial species normally develop phage resistance through phage receptor mutations or deletions [16]. CRISPR and CRISPR-associated (Cas) genes confer resistance to exogenous sequences of bacteriophages/viruses. Their recognition depends on the similarity between sequences of targeted phage DNA segments and the spacers [17]. CRISPR-Cas systems are present in about 45% of bacterial species and in 80% of archaea. Structurally, the CRISPR-Cas system consists of a group of repeats interspersed by spacers, which are short DNA stretches along with a set of Cas genes in proximity [18]. Immunity is built by gaining short stretches of interfering nucleic acids into CRISPR loci as ‘spacers’ [19]. These immune markers are transcribed and processed into small non-coding interfering CRISPR RNAs (crRNAs) that guide Cas proteins toward target nucleic acids for the specific cleavage of homologous sequences. A new spacer is always added to the AT-rich leader site of CRISPR, which is thought to include unique sequence features for direct spacer DNA insertion [20]. Although the search results provided do not explicitly mention the interaction between CRISPR systems and phages in the context of periodontal bacteria, it can be inferred that the CRISPR system functions as a defense mechanism against phages in these bacteria, similar to its role in other bacterial species. Moreover, developing CRISPR-based therapeutics against periodontal bacteria may also involve strategies that leverage this system’s anti-phage properties.
Machine learning has been used in multiple ways to improve the efficacy and accuracy of the CRISPR-Cas system. One such application is being developed with a deep learning model known as CRISPRon. A study utilized a machine learning model to classify CRISPR arrays. This step is part of a broader CRISPR identification pipeline, which is used to identify potential targets for CRISPR-Cas-mediated gene editing. The Extra Trees classifier from the Python Scikit-learn package was integrated into this pipeline to classify CRISPR candidates.
The current study aimed to investigate red complex bacteria’s acquired phage resistance marker profile via the genome analysis of patient samples. Further, this study attempted to identify spacer sequences, and spacers were BLASTED against the bacteriophage database to identify homologous sequences in phages with machine learning. Additionally, the present study aimed to identify the role of CRISPR-Cas in the phage resistance of periodontal red complex bacteria with a machine learning model.

2. Materials and Methods

The study protocol was approved by the institutional ethical committee (IHEC/SDC/FACULTY/PERIO/020), Saveetha Dental College. Five plaque samples of periodontitis patients were sent to a lab for identification. Later, whole-genome sequences were obtained from the NCBI NR sequence database of P. gingivalis, T. denticola and Tanerella [21].
The genomic query sequence, in FASTA format, was the input for the crispr.i2bc.paris-saclay.fr CRISPR tool. Potential locations of CRISPRs, including at least one motif, were identified by finding the maximal direct repeats. The CRISPR pattern of two direct repeats and one spacer was considered a maximal repeat, and repeated sequences were separated by a sequence of about the same length. Whole-genome sequences of red complex bacteria were crosschecked for similarities in the NCBI genomic database. Once matched, the sequences were analyzed for CRISPR using the CRISPR identification tool (University of Paris; CRISPR.i2bc.paris-saclay.fr, accessed on 2 April 2023) [20]. Homologous sequences were obtained and confirmed using the NCBI BLAST algorithm according to standards [21]. CRISPR sequences were identified using CRISPR identification tools [21]. After obtaining the results, spacer sequences were downloaded for each bacterium, analyzed and crosschecked for homologous sequences in phage and virus genomic databases using the BLAST algorithm.
Predicting CRISPR sequences from spacers using AI can improve the efficiency of identifying and characterizing CRISPR systems. The BLAST results were added to each sequence as a separate class if necessary [22,23]. This class prediction was made by using the Orange machine learning tool. Orange supports file loading, transformation and explorative analysis and addresses all the essential phases of necessary frameworks. The pre-processing process includes cleaning the data and preparing the data. In this stage or step, we cleaned and arranged the data that we obtained. We identified a set of missing data in these data, for which the missing features were removed and outliers were removed and normalized, and the data were split into training and test data with 80/20 percent and cross-validation of 20. Machine and deep learning algorithms, such as SVM, Random Forest and Neural Networks, were applied to the CRISPR sequence dataset.

2.1. Neural Network

Artificial neural networks (ANNs), modeled according to how biological nervous systems process information, comprise interconnected components called neurons that process and work together to find answers to particular problems. Similar to humans, ANNs base their learning on examples. Instead of a list of guidelines for carrying out a specific task, they are given examples to analyze and devise a solution.

2.2. SVM

Support Vector Machines (SVMs) are supervised learning models used in machine learning for classification and regression analysis. They are associated with learning algorithms that analyze data to find patterns and predict outcomes.
SVMs are particularly effective in high-dimensional spaces, where the volume of features (or variables) in the data is high. Even in cases in which the number of dimensions (features) exceeds the volume of samples (individual data points), SVMs can still provide an effective analysis.

2.3. Random Forest

Random Forest is a supervised learning method used for classification and regression tasks. It works by generating plenty of decision trees during training. The term “forest” in the name represents an ensemble of decision trees. The main principle behind Random Forest is that a combination of learning models (in this case, decision trees) increases the overall result. Hence, for a more precise and reliable forecast, Random Forest constructs and combines many decision trees [11]. An uncorrelated forest of decision trees is produced using the Random Forest algorithm, an extension of the bagging method that uses feature randomness and bagging. A random subset of features is produced with feature randomness, which adds to the diversity and robustness of the model.

2.4. AUC-ROC Curve

The classification model’s performance metric is AUC-ROC. The AUC-ROC metric shows a model’s class-distinguishing ability. As the AUC becomes higher, the model becomes better. AUC-ROC curves graphically show the trade-off between sensitivity and specificity for every possible cut-off for a test or combination of tests.
Classification models are evaluated using AUC-ROC. The AUC-ROC metric can determine a model’s ability to distinguish classes. Models with higher AUCs are better. AUC-ROC curves are widely used to visually depict the relationship between sensitivity and specificity for each conceivable cut-off for a test or collection of tests. One way to assess a model’s accuracy is the area under the curve. A good model has an AUC near 1. A model with a low AUC has the worst separability.
Precision should ideally be 1 (high) for a good classifier. Precision becomes 1 only when the numerator and denominator are equal, i.e., TP = TP + FP. This also means that FP is 0.
Precision = TP ÷ TP + FP
The recall should ideally be 1 (high) for a good classifier. The recall becomes 1 only when the numerator and denominator are equal, i.e., when TP = TP + FN, which means that FN is 0. As FN increases, the value of the denominator becomes more significant than the numerator, and the recall value decreases.
Recall = TP ÷ TP + FN
Therefore, the ideal precision and recall for a competent classifier are 1, implying that FP and FN are 0. Therefore, we need a statistic that considers both recall and precision. The F1-score is a statistic that considers both precision and recall: [(Precision × Recall)/(Precision + Recall)] × 2.

3. Results

3.1. Identification of CRISPR in P. gingivalis

P. gingivalis sequences were analyzed for CRISPR sequences with the identification tool, and the results show P. gingivalis TDC60 DNA and the complete-genome CRISPR ranking for the following sequence: 6 Crispr_begin_position: 218514 → Crispr_end_position: 2189300.

3.2. Treponema Denticola CRISPR

Treponema denticola chromosomes and the complete genome were analyzed for CRISPR sequences with the CRISPR identification tool (CRISPR ranking for the following sequence: 6 Crispr_begin_position: 367189 → Crispr_end_position: 370884).
BLAST—RESULTS Bacillus phage 34.2.
100% query cover; e value: 018, 100%.
The results of the above red complex organisms with the identified CRISPR query cover, spacers and BLAST were determined for sequence similarity and for the identification of microbes.

4. Discussion

The immune–inflammatory disease periodontitis can destroy periodontal ligaments and adjacent supportive alveolar bone. Increased oral biofilm buildup, oral inflammation, the recession of gingival tissues and the destruction of the periodontium are symptoms of periodontitis [2]. It is primarily caused by red complex bacterial infections. Red complex bacteria include Porphyromonas gingivalis, Treponema denticola and Tannerella forsythia, which are highly invasive and secrete huge amounts of proteases and proteinases that degrade the host’s collagen and destroy host immune cells, such as neutrophils [24]. These bacteria are located in periodontal pockets and lead to the destruction of periodontal tissues. Several treatment modalities have been employed to treat periodontitis, including antibiotics, pre and probiotics, lasers and ozone therapy, which have shown satisfying results [25,26]. Periodontal disease is also associated with many systemic diseases, including the risk of cardiovascular disease, rheumatoid arthritis and cancer [27,28,29].
Apart from the bacteria, the oral microbiome comprises several archaea, protozoa and viruses and is one of the most dynamic microbial communities in the human body. Dysbiosis of the oral microbiota can affect the host’s immune system and potentially increase periodontitis incidence. Phages are the most common virus in the oral cavity, as is well known. Even though some phages have the virulence to infect and eliminate the periodontitis pathogen, they can survive in the phage-rich environment. Understanding the molecular mechanism underlying phage resistance in periodontopathogens can enable the clinical management of periodontitis more effectively [30]. In the periodontal pocket, bacteriophages are prominent viruses, and the CRISPR-Cas system in the bacterial system might protect the red complex bacteria from these bacteriophages [31]. Clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated proteins (Cas) confer adaptive immunity systems in bacteria and archaea against foreign elements such as bacteriophages/viruses, plasmids and transposons. A CRISPR-Cas genetic structure comprises a series of repeats separated by spacers and a set of Cas genes nearby. In addition to defending against bacteriophages and mobile genetic elements, CRISPR-Cas appears to affect bacterial dormancy, stress, pathogenicity and immune system evasion [32,33]. The CSRISPR-Cas analysis revealed that P. gingivalis selectively acquire DNA sequences for their survival and provide protection against foreign RNA and DNA [34]. It has been shown that the virome from the sub-gingival biofilm is distinct from the healthy and periodontal disease state, which implies that the bacterial population might influence phage survival in the oral cavity [35]. We aimed to understand the role of CRISPR-Cas in mediating the phage resistance of red complex bacteria. We hypothesize that CRISPR-Cas systems in red complex bacteria could help protect themselves in the periodontal pocket environment, where bacteriophages are abundant. In addition, the system also helps the bacteria to inhibit the growth of bacteriophages/viruses implicated in the biofilm community.
Regarding CRISPR-Cas systems in the genomes of red complex bacteria from periodontally affected subjects, our study, which utilized a query sequence of all three bacteria with more than 50 percent, is sufficient to prove repeated attacks of bacteriophages in bacteria. CRISPR gained red complex bacteria sequences that constantly fought phage communities in the sub-gingival microenvironment [31]. More than 2000 oral phages have been reported or are expected to infect species of the phylas Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria, Proteobacteria and three more (few phages only). The role of phages in periodontal disease has been proven by various studies [36,37], especially cellulobacteria phages Figure 1 and Table 1, bacillus phages Figure 2 and Table 2 and pectobacteria phages Figure 3 and Table 3. Because the CRISPR space is complementary to these phages, the presence of cellulophages (e value: 0.2), (P. gingivalis), bacillus phages (e value: 0.18) (T. denticola) and pectophages (e value: 0.001) (Tannerella) indicate that these bacteria are in a constant fight with phage communities [19]. Zhou et al. found larger Shannon–Wiener diversities of DRs in periodontal disease than those in healthy periodontia, but not for spacer composition [32]. This may imply that healthy persons have a robust bacterial population resistant to phage invasion. The concept of viral modification in bacterial and host environments in the periodontal sub-gingival microenvironment must be revisited, as these bacteria have developed adaptive immune CRISPR spacer responses [38,39].
Machine learning is a rapidly developing technology today. It is used for image recognition, speech recognition, traffic predictions and product recommendation, and now, this technology is developing in medicine. CRISPR-Cas systems identify and destroy intruder DNA by matching spacers to viral protospacers [40]. These CRISPR array spacers can also be predicted. Modeling CRISPR sequences reveals accurate predictions of 100 percent for Random Forest, Neural Networks and Support Vector Machines. (Table 4, Figure 4) This prediction can help identify and classify red complex spacers in future studies.
The application of phage therapy in dentistry is still in its infancy and requires exploration. Bacteriophages are against many bacteria that are present in biofilms [41]. Understanding bacteria–bacteriophage interactions and specificity is the first step in expanding its applications in dentistry. In this study, we aimed to identify the bacteriophages interacting with red complex bacteria in periodontitis. The formulation of phage-based cocktails derived from different phages could surpass bacterial resistance against a single bacteriophage. Phage-based products can be developed based on the virulence of the phage against the bacteria and the profile of the CRISPR-Cas of the bacteria [42,43]. In that way, our study is the first step toward understanding the therapeutic possibilities to treat periodontitis. Our results show that the CRISPR-Cas of red complex bacteria target phages such as cellulophages (P. gingivalis), bacillus phages (T. denticola), and pectophages (Tannerella) in periodontitis. Our results suggest that red complex bacteria are resistant to phages such as cellulophages, bacillus phages, and pectophages in periodontitis. There are currently only a few clinical uses for CRISPR in periodontics. However, the possible clinical use of CRISPR is to target the periodontal biofilm and create new methods for lowering or getting rid of periodontal infections. Additionally, CRISPR can change the transcriptome and gene expression of genes that contribute to the development of periodontitis.

5. Conclusions

The current study highlights that viral phage communities cannot modify sub-gingival bacterial environments, as they have acquired immune mechanisms via CRISPR-Cas to kill the virus and competitively infect periodontal pockets. Future research can be simplified, reducing time and effort by using predictive modeling of red-complex-based spacer analyses.

Author Contributions

Conceptualization, P.K.Y., D.A., K.C.S. and D.S.; methodology, P.K.Y. and R.V.A.; software, P.K.Y., S.A.A.A. and H.A.A.; validation, D.A., M.A.A., K.C.S. and A.A.A.; formal analysis, P.K.Y. and K.C.S.; investigation, D.A. and D.S.; resources, P.K.Y., D.A., K.C.S. and D.S.; data curation, P.K.Y.; writing—original draft preparation, P.K.Y., D.S. and K.C.S.; writing—review and editing, P.K.Y., R.V.A., D.A., D.S., S.A.A.A., H.A.A., M.A.A., A.A.A. and K.C.S.; visualization, P.K.Y.; supervision, D.A.; project administration, P.K.Y. and D.S.; funding acquisition, P.K.Y. and K.C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

IHEC/SDC/FACULTY/PERIO/020.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sela, M.N. Role of Treponema denticola in periodontal diseases. Crit. Rev. Oral Biol. Med. 2001, 12, 399–413. [Google Scholar] [CrossRef] [PubMed]
  2. Könönen, E.; Gursoy, M.; Gursoy, U.K. Periodontitis: A multifaceted disease of tooth-supporting tissues. J. Clin. Med. 2019, 8, 1135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Bibi, T.; Khurshid, Z.; Rehman, A.; Imran, E.; Srivastava, K.C.; Shrivastava, D. Gingival crevicular fluid (GCF): A diagnostic tool for the detection of periodontal health and diseases. Molecules 2021, 26, 1208. [Google Scholar] [CrossRef] [PubMed]
  4. Shrivastava, D.; Srivastava, K.C.; Ganji, K.K.; Alam, M.K.; Al Zoubi, I.; Sghaireen, M.G. Quantitative assessment of gingival inflammation in patients undergoing nonsurgical periodontal therapy using photometric CIELab analysis. BioMed Res. Int. 2021, 2021, 6615603. [Google Scholar] [CrossRef]
  5. Ximénez-Fyvie, L.A.; Haffajee, A.D.; Socransky, S.S. Microbial composition of supra-and subgingival plaque in subjects with adult periodontitis. J. Clin. Periodontol. 2000, 27, 722–732. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Shrivastava, D.; Srivastava, K.C.; Dayakara, J.K.; Sghaireen, M.G.; Gudipaneni, R.K.; Al-Johani, K.; Baig, M.N.; Khurshid, Z. BactericidalActivity of Crevicular Polymorphonuclear Neutrophils in Chronic Periodontitis Patients and Healthy Subjects under the Influence of Areca Nut Extract: An In Vitro Study. Appl. Sci. 2020, 10, 5008. [Google Scholar] [CrossRef]
  7. Assiri, K.I.; Sandeepa, N.C.; Asiri, R.S.; Mulawi, S.A.; Najmi, S.M.; Srivastava, K.C. Assessment of Oral–Systemic Disease Association amongst Dental Patients: A Retrospective Panoramic Radiographic Study. J. Contemp. Dent. Pract. 2020, 21, 748–755. [Google Scholar] [PubMed]
  8. Shrivastava, D.; Natoli, V.; Srivastava, K.C.; Alzoubi, I.A.; Nagy, A.I.; Hamza, M.O.; Al-Johani, K.; Alam, M.K.; Khurshid, Z. Novel approach to dental biofilm management through guided biofilm therapy (Gbt): A review. Microorganisms 2021, 9, 1966. [Google Scholar] [CrossRef]
  9. Lin, D.M.; Koskella, B.; Lin, H.C. Phage therapy: An alternative to antibiotics in the age of multi-drug resistance. World J. Gastrointest. Pharmacol. Ther. 2017, 8, 162. [Google Scholar] [CrossRef]
  10. Gummalla, V.S.; Zhang, Y.; Liao, Y.-T.; Wu, V.C. The Role of Temperate Phages in Bacterial Pathogenicity. Microorganisms 2023, 11, 541. [Google Scholar] [CrossRef]
  11. Pinto, G.; Silva, M.D.; Peddey, M.; Sillankorva, S.; Azeredo, J. The role of bacteriophages in periodontal health and disease. Future Microbiol. 2016, 11, 1359–1369. [Google Scholar] [CrossRef]
  12. Egido, J.E.; Costa, A.R.; Aparicio-Maldonado, C.; Haas, P.-J.; Brouns, S.J. Mechanisms and clinical importance of bacteriophage resistance. FEMS Microbiol. Rev. 2022, 46, fuab048. [Google Scholar] [CrossRef]
  13. Yeh, T.-K.; Jean, S.-S.; Lee, Y.-L.; Lu, M.-C.; Ko, W.-C.; Lin, H.-J.; Liu, P.-Y.; Hsueh, P.-R. Bacteriophages and phage-delivered CRISPR-Cas system as antibacterial therapy. Int. J. Antimicrob. Agents 2022, 59, 106475. [Google Scholar] [CrossRef] [PubMed]
  14. Soto-Perez, P.; Bisanz, J.E.; Berry, J.D.; Lam, K.N.; Bondy-Denomy, J.; Turnbaugh, P.J. CRISPR-Cas system of a prevalent human gut bacterium reveals hyper-targeting against phages in a human virome catalog. Cell Host Microbe 2019, 26, 325–335.e325. [Google Scholar] [CrossRef] [PubMed]
  15. Johnson, C.M.; Grossman, A.D. Integrative and conjugative elements (ICEs): What they do and how they work. Annu. Rev. Genet. 2015, 49, 577–601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Alseth, E.O.; Pursey, E.; Luján, A.M.; McLeod, I.; Rollie, C.; Westra, E.R. Bacterial biodiversity drives the evolution of CRISPR-based phage resistance. Nature 2019, 574, 549–552. [Google Scholar] [CrossRef]
  17. Barrangou, R.; Fremaux, C.; Deveau, H.; Richards, M.; Boyaval, P.; Moineau, S.; Romero, D.A.; Horvath, P. CRISPR provides acquired resistance against viruses in prokaryotes. Science 2007, 315, 1709–1712. [Google Scholar] [CrossRef]
  18. Jansen, R.; van Embden, J.D.A.; Gaastra, W.; Schouls, L.M. Identification of genes that are associated with DNA repeats in prokaryotes. Mol. Microbiol. 2002, 43, 1565–1575. [Google Scholar] [CrossRef]
  19. Santiago-Rodriguez, T.M.; Naidu, M.; Abeles, S.R.; Boehm, T.K.; Ly, M.; Pride, D.T. Transcriptome analysis of bacteriophage communities in periodontal health and disease. BMC Genom. 2015, 16, 549. [Google Scholar] [CrossRef] [Green Version]
  20. Jore, M.M.; Brouns, S.J.; van der Oost, J. RNA in defense: CRISPRs protect prokaryotes against mobile genetic elements. Cold Spring Harb. Perspect. Biol. 2012, 4, a003657. [Google Scholar] [CrossRef]
  21. Coordinators, N.R. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2012, 41, D8–D20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Gussow, A.B.; Park, A.E.; Borges, A.L.; Shmakov, S.A.; Makarova, K.S.; Wolf, Y.I.; Bondy-Denomy, J.; Koonin, E.V. Machine-learning approach expands the repertoire of anti-CRISPR protein families. Nat. Commun. 2020, 11, 3784. [Google Scholar] [CrossRef] [PubMed]
  23. Konstantakos, V.; Nentidis, A.; Krithara, A.; Paliouras, G. CRISPR–Cas9 gRNA efficiency prediction: An overview of predictive tools and the role of deep learning. Nucleic Acids Res. 2022, 50, 3616–3637. [Google Scholar] [CrossRef]
  24. Mohanty, R.; Asopa, S.J.; Joseph, M.D.; Singh, B.; Rajguru, J.P.; Saidath, K.; Sharma, U. Red complex: Polymicrobial conglomerate in oral flora: A review. J. Fam. Med. Prim. Care 2019, 8, 3480. [Google Scholar]
  25. Butera, A.; Gallo, S.; Pascadopoli, M.; Taccardi, D.; Scribante, A. Home oral care of periodontal patients using antimicrobial gel with postbiotics, lactoferrin, and aloe barbadensis leaf juice powder vs. conventional chlorhexidine gel: A split-mouth randomized clinical trial. Antibiotics 2022, 11, 118. [Google Scholar] [CrossRef] [PubMed]
  26. Gallo, S.; Scribante, A. Ozone therapy in dentistry: From traditional applications towards innovative ones. A review of the literature. In Proceedings of the IOP Conference Series: Earth and Environmental Science, Sanya, China, 28–30 October 2020; p. 012001. [Google Scholar]
  27. Kim, J.; Amar, S. Periodontal disease and systemic conditions: A bidirectional relationship. Odontology 2006, 94, 10–21. [Google Scholar] [CrossRef] [Green Version]
  28. Martínez-García, M.; Hernández-Lemus, E. Periodontal inflammation and systemic diseases: An overview. Front. Physiol. 2021, 12, 709438. [Google Scholar]
  29. Hajishengallis, G. Periodontitis: From microbial immune subversion to systemic inflammation. Nat. Rev. Immunol. 2015, 15, 30–44. [Google Scholar]
  30. Radaic, A.; Kapila, Y.L. The oralome and its dysbiosis: New insights into oral microbiome-host interactions. Comput. Struct. Biotechnol. J. 2021, 19, 1335–1360. [Google Scholar]
  31. Chen, T.; Olsen, I. Porphyromonas gingivalis and its CRISPR-Cas system. J. Oral Microbiol. 2019, 11, 1638196. [Google Scholar] [CrossRef] [Green Version]
  32. Richter, C.; Chang, J.T.; Fineran, P.C. Function and regulation of clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated (Cas) systems. Viruses 2012, 4, 2291–2311. [Google Scholar]
  33. Hille, F.; Charpentier, E. CRISPR-Cas: Biology, mechanisms and relevance. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150496. [Google Scholar] [CrossRef] [Green Version]
  34. Sorek, R.; Kunin, V.; Hugenholtz, P. CRISPR—A widespread system that provides acquired resistance against phages in bacteria and archaea. Nat. Rev. Microbiol. 2008, 6, 181–186. [Google Scholar] [CrossRef] [PubMed]
  35. Ly, M.; Abeles, S.R.; Boehm, T.K.; Robles-Sikisaka, R.; Naidu, M.; Santiago-Rodriguez, T.; Pride, D.T. Altered oral viral ecology in association with periodontal disease. MBio 2014, 5, e01133-14. [Google Scholar] [CrossRef] [PubMed]
  36. Szafrański, S.P.; Slots, J.; Stiesch, M. The human oral phageome. Periodontol. 2000 2021, 86, 79–96. [Google Scholar] [PubMed]
  37. Shanmugasundaram, S.; Nayak, N.; Puzhankara, L.; Kedlaya, M.N.; Rajagopal, A.; Karmakar, S. Bacteriophages: The dawn of a new era in periodontal microbiology? Crit. Rev. Microbiol. 2023, 1–12. [Google Scholar] [CrossRef]
  38. Landsberger, M.; Gandon, S.; Meaden, S.; Rollie, C.; Chevallereau, A.; Chabas, H.; Buckling, A.; Westra, E.R.; van Houte, S. Anti-CRISPR phages cooperate to overcome CRISPR-Cas immunity. Cell 2018, 174, 908–916.e912. [Google Scholar]
  39. Marraffini, L.A. CRISPR-Cas immunity against phages: Its effects on the evolution and survival of bacterial pathogens. PLoS Pathog. 2013, 9, e1003765. [Google Scholar] [CrossRef] [Green Version]
  40. Mitrofanov, A.; Alkhnbashi, O.S.; Shmakov, S.A.; Makarova, K.S.; Koonin, E.V.; Backofen, R. CRISPRidentify: Identification of CRISPR arrays using machine learning approach. Nucleic Acids Res. 2021, 49, e20. [Google Scholar]
  41. Steier, L.; De Oliveira, S.D.; De Figueiredo, J.A.P. Bacteriophages in dentistry—State of the art and perspectives. Dent. J. 2019, 7, 6. [Google Scholar] [CrossRef] [Green Version]
  42. Abedon, S.T.; Danis-Wlodarczyk, K.M.; Wozniak, D.J. Phage cocktail development for bacteriophage therapy: Toward improving spectrum of activity breadth and depth. Pharmaceuticals 2021, 14, 1019. [Google Scholar] [CrossRef] [PubMed]
  43. Yang, Y.; Shen, W.; Zhong, Q.; Chen, Q.; He, X.; Baker, J.L.; Xiong, K.; Jin, X.; Wang, J.; Hu, F. Development of a bacteriophage cocktail to constrain the emergence of phage-resistant Pseudomonas aeruginosa. Front. Microbiol. 2020, 11, 327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. Given homologous cellulophagia query cover of 56.5%; e value: 0.2 s, 100% (BLAST RESULTS).
Figure 1. Given homologous cellulophagia query cover of 56.5%; e value: 0.2 s, 100% (BLAST RESULTS).
Microorganisms 11 02060 g001
Figure 2. BLAST results.
Figure 2. BLAST results.
Microorganisms 11 02060 g002
Figure 3. BLAST results similar to those of the pectobacterium phage with an e value of 0.001%; 100% query cover 60%.
Figure 3. BLAST results similar to those of the pectobacterium phage with an e value of 0.001%; 100% query cover 60%.
Microorganisms 11 02060 g003
Figure 4. ROC curve of CRISPR-predicted sequences.
Figure 4. ROC curve of CRISPR-predicted sequences.
Microorganisms 11 02060 g004
Table 1. CRISPR arrays with spacers of immunological memories that resist future infections using spacers, or viral DNA fragments for P. gingivalis. Homologous sequence. Identification using the BLAST algorithm with the bacteriophage database.
Table 1. CRISPR arrays with spacers of immunological memories that resist future infections using spacers, or viral DNA fragments for P. gingivalis. Homologous sequence. Identification using the BLAST algorithm with the bacteriophage database.
Spacer_Begin_PositionSpacer_LengthSpacer_Sequence
218151436AAACGAAATGAAAAAGACAACAAACAGAAGACCCTC
218158036GTGCCAGCTGCAGGGGGATGACATAGCCATTGACGA
218164636GTGCCAGCTGCAGGGGGATGACATAGCCATTGACGA
218171236TCCGCGCCGCGAGGTGGAGACCCTGCCGGAGGCGAA
218177837CCTGAGAAAGAGGGGAGGGAGGAGCGATAGACGAAGT
218184536CGAGAATCTATTGAGTAGCGAAGTCGTCACAAAGAT
218191136AGCCATAGCTCTTCAATTTCAATTTCTTCTTTTAAT
218197736CGAAAATAACAAAAATAGATATATTTATAAAAAAGA
218204334ACTCTTATCATCTACTATCTCAAAAGCTCTTTTT
218210738TCGCTATAACCCTATGTGATTCAGGAATCGGCTTGCTA
218217536GAAACATTCGAGCCGTATTCAATTACGCCATCAATG
218224138CACCCATTGTGCCGCCGTCCTGACCGAAAACTTCTTTA
218230938TCGCTATAACCCTATGTGATTCAGGAATCGGCTTGCTA
218237736GAAACATTCGAGCCGTATTCAATTACGCCATCAATG
218244338CACCCATTGTGCCGCCGTCCTGACCGAAAACTTCTTTA
218251138TCGCTATAACCCTATGTGATTCAGGAATCGGCTTGCTA
218257936GAAACATTCGAGCCGTATTCAATTACGCCATCAATG
218264538CACCCATTGTGCCGCCGTCCTGACCGAAAACTTCTTTA
218271336ATTTCTTCATCTCGCGCTTGCTCAAAAGCGCGTTCA
218277934TGCATCAAGTCACGAACTTTCTGCGAGATGGAAA
218284336CCGTCTCGAAAAAATATCGGGACGTTTTTGTTTTCT
218290935CTCCTTCACTTTGTCGACAATGTGCACTGTATTTG
218297436AGGCGGAGTATCTCTTTGCCACCCAGTCCGCGCGCA
218304036CGTAACCGCCTCGGTAGACCGCTCCGCACGGTCGTT
218310637GTGCATTCCGGACAGCTTTCGCTTAAAAAGTTAGCGG
218317337AAGAACGAACGCCTGCGCGATAAGCACCGCGAGCGTA
218324036ATTTACCTGCAGACTTGTGCCCACCCACTTGATAGA
218330636TGGTCACGGAGCGATACCATGAGTGTTTAGTAGATG
218337236CGGAGGAGATCAGCTATGCGGATGATACCACCCGTG
218343836TCAGAAAACTCGCGTCCATCTGATAGATGTACACGA
218350436TAAACGATCGAGGCGCGGAGACCCTCCTTGCCAGTA
218357037CCGTTCAGGAAAAAGTAACCGAGCTGAAGACCATGCT
218363735AGGTGCTATCGCAGGACTGCAGGACATCCTCAATC
218370236AGCCGCTCGACTTGACGCCATGCAAAAACAGATAGA
218376836TCTGCGAGTTGTGAGAGGCAATAAACTGCTGGGAGC
218383435ATTGCTGTTAATTCTGTCATCTCTTATTTCTTTTA
218389935TCTATCTGCGTATAGCCCTCGCCGTCCACGCCCTG
218396437GGGAAGCTGCTTTGCTCGCTGAGATAGCAGCACTTCA
218403136TTTATTGACGCCACCCCGCCGACGAAAAAAAATCAT
218409736TTTCGGTCTTTACGTTTGTCGCCACGGATACATGCT
218416337ATTGTAAATAAATTACATGGCTATTGAAAAACAAATT
218423036GATTGTACGACTTTGCTATAAAGTCTGAGTTATTAA
218429636TATCAACAATCACCGTCATATGTGTAATATACTTGA
218436236GGGCAGGCGTATTGCCCCACTTCTCCCCGAATGCAT
218442836TGAGGAATCATATCAGTGTTTATTTTTTCATCGATT
218449436TGGAAGTGGGTAGAAGAAAGCCCCAACGTGTTTAAG
218456036CATGACAAAGAGACGGTTATCGGTAGAGGACAGGCA
218462635CGCGTGGAAGGGGCATGTACACTTGTAGTTCGCCC
218469134TGACAGGCCCTGCAGCGTGTGAGAGCGGAAATGC
218475537ATTTTCAATCATGATATTTTATTTTTCCTGCAAACGC
218482236TCGCATGTGGGAGCGCGGCGGTCTCTGCTTTACGAA
218488836TCAGCGTGATGAGCGCTTGAGGCTCCTCCATCGAGT
218495436AAGGATGATTTGGAAAATTTAGTAAGATAGTTGATA
218502037TTCTTGGAGAAAGCGAAGACCATGAACCTAAGCGTCG
218508736GGAAATATAGTTATTGTATCTACTAAAAGACATAGT
218515334ACCCCATCTTGCAGAGTATATGCGAGCAAAATTT
218521734TAGTTAGCACAGTTGCTACTATCGTAGTAGCTGT
218528135AGATAAACTTTCTTCTCGAATTAAGAAAATCGAGA
218534636CCGCGGCCATCGAGGCCACCGCCTCCGTCCTCCGCG
218541237TATGAAAACAGAAAAGAACTTCTCAGCCCTGAGTTTG
218547937CAAACTCAATGATTATCTGTCAAGAAGCAAGAAACGA
218554637AGTAAAAATTACCCTAGATGCCGAAACGGACGGCCTT
218561336CAGAATTTGCACGAACAGTATGATGTTCGTGTTCTT
218567936AAGCGCGAGACAGGCCGAGCCGGCACAGCTTAGTGC
218574536AAAACGGCGATAAAATAGCGTTCGAGATTTTCCGCA
218581137TAGTTGTAGCGATTGTCTCAGTTGCATTACTCCTTAC
218587837AAATAACGAGAAAAAGAATGCTTAAATTGTTCTTCGT
218594536AGAAGAGGGTAAACTATTTGCTAATCTTGAATGCTT
218601136TCTCAATATCTTTCATAGCTACTAAAAATTTACGAA
218607735ATTGCTGTTAATTCTGTCATCTCTTATTTCTTTTA
218614235TCTATCTGCGTATAGCCCTCGCCGTCCACGCCCTG
218620736TGCCCCCTCACCCATCTAACCTCGAGCCGTTGAGCC
218627336GATTACATAATGATAGACGACAGAGATTGTGCAGAA
218633935GTACTGATAATTACGCTGCAAGGTCAGACGGTGAT
218640436TTGCCAGGGCTTGCTGATGCGCGCGCTCCAGCTGCT
218647036ACAGAACCAGCTCCGTCAAATCTCCCGCTTTTTGTC
218653636TGCCCCCTCACCCATCTAATCTCGAGCCGCTGAGCC
218660236TATTCATTCGCTCAAGCGAGGGCATCCTGCTGCAGC
218666836GCTCGCGGAGGGAGAGGGTGCCGGTATCCTGCCTCC
218673436AGAGTCTGTATGTGAAAGTGTAGTTCGAAACATTAT
218680034AGAATACTTTGAAGTTGTATTCAATTACTTTGAA
218686436CCGTTGTGACAGAGCTGCGCCGTCGTGGCTATGATG
218693036TGAAAGCCCGAAGATAATCTACACGCAAGATTGTTA
218699635CGTCATCAGGTGGATATTCTTACTGCTATCCACGA
218706136TCGTCTGCGACGTATCGCAGCTCTGCCAGCTCCGCG
218712736GCATCTTCGCAGGAAAGAAGAAGGCTCCGTCCTCGA
218719336AACAGTCAAGGGGGAGCCGACCTCTCCGGCGGATTT
218725936GCAGTGCGGCCGACAAGGCTAACCTCGCTCAGCTGA
218732536AATCCATGTTCATGAGGAGAGGATACGAGTTCTATT
218739135CCTTTTGCTATTGCAGCAAACATATACAATAATAA
218745636ACTTCATGGATTTAGCGAGATACTCATTATAATTAA
218752236TCTTCAAAGATAGTTGTTATCAAATATCGCGCTGAA
218758837ATCTTCAAAGATAGTTGTTATCAAATATCGCGCTGAA
218765536GCTCAAGCGTCCAAGAAAGTTCAAGAAATTGTACTA
218772137TACTATGGTGTCTGCATTTGAGATACGCAAATAGCAA
218778836CCTCAATATCTTTCATTGCGACGAGAAATTTGCGAA
218785436AATCTATGATGATATAGAAGAAGACGACTTGTTGTT
218792036ATTAATGATTTTCTGAAATAAAGAAGCAGTTGCATA
218798635CTCAATATCTTTCATTGCGACGAGGAACTTGCGAA
218805136CCCCGTGGTAACTCATACCACCGACTATTCCACCGT
218811736TTTGAGTAATCATCGAATAATTATCGATTAATCATT
218818336TTATATGCATCATATTCTTAAAGTATTTTATTTGAA
218824936GACGAATACGGCGTTCATCATCGATAGTCGCGATGC
218831536CGGGCGGCCAACCGGTCACAACAAGAATAGACCGAT
218838135TTCCTTCCAGTCGCAGCTTAAGATACTGCGACTAC
218844636AATTTTCATCAGAGCATAAAAAAGGGCAAACTTTTT
218851235GATACGAGCACCAAGGCTGCGATACCGATTGCGTA
218857736CCTCGAGCAGATCTTCCTGCTCTTTGATGAGTGAGG
218864335GCAGGTTGATTATAATGTTGAAGATGCTTTAAGGG
218870836CTCGTATCGACTTTCAAGCAGGCTGGAGTGCAGCCT
218877437AATATGAGATCGGAAACAATTATAGTTGCGTCGATAT
218884137TCACAATAACCGACAAAATGTCTCGCGTAACGTACAA
218890835GTCGCCTGTTTTCTTGAACTCCTCACTGATTCGTA
218897335GATGGTGTCGACATCATACGACAATAGATCGTCGA
218903835GATGGTGTCGACATCATACGACAATAGATCGTCGA
218910336AATATTTTTTCAAAAATTGTAAAACTTATTAAGTCA
218916936AAGTTGCTGATTGTCTTAGAATGAAAGGTTATGCTC
218923535ATAATATTACATAATGGCACACTGATGGTAAACTT
218930034CATGATGTACAAATATATCATGATCGTATACTAC
Table 2. The CRISPR array identified with sequences of T. denticola.
Table 2. The CRISPR array identified with sequences of T. denticola.
Spacer_Begin_PositionSpacer_LengthSpacer_Sequence
36718930TATAGGAGGTTTCAAAATGGAAAAATCGAA
36725530TATCAAGTTGAGCCTTCTTTAAAGCTCCGC
36732130TATAGGAGTTCCAGACCCAGCACCATCACC
36738730AAAATCGAATGTATCGCAAGATTCAAACCA
36745330TACAAAATCGAAGCAGAAGAAAGGAACTTC
36751930GGTTCCAATCTTTTTGGAATGATTAACAAT
36758530GATTCTGTATTTCAACGCGATGTTGCTAAT
36765130CTAACAAAAGGTGGAATTTTACCGAACAAT
36771729AATTAGTTGTCATTGAAGGTGAAGCCGGA
36778230GCGGAAAAACTATATCGTAATCTTCATAGA
36784830GCTGGAACGCCTATAGCGACGCAAGCTCCT
36791430CGCTGGAACGCCTATAGCGACGCAAGCTCC
36798030GGTTCCAATCTTTTTGGAATGATTAACAAT
36804630CATCTAGAATCCTATAAGGCACGAAGTAAT
36811230CCTTTTTTGTAACTCCTATTTGCAGCTATG
36817830ATTACTTTTCGAAAAAAAGCCGTATTATAG
36824430TCTTTGTATTATAAAGTTAGCAGAGGAAAA
36831030GAATCTACCACCCTCAATACTCCGCCTATT
36837630GTCAACATCACCGCGATCACTACAAACAGC
36844230GAATGAAAAGGACAAGGAAAAAGCTGCCCT
36850830TGATTATTTGGAAGGCATGAGTAAATGCTG
36857430GCAGTAACTCACAAGCCACTTTGAGAGTTG
36864030TTCGACGCTTGTCGAAAAGGCAATCAAGGC
36870630CGAGAAGTTATTATTCTGAACTTCACATCG
36877230CTTTGGTATCAATTAGGATTTCCTAAAGTC
36883830TACAATGATTGCTTGTTGTTCTGATGGAAC
36890430TAGCCTCACCATTATAAAGCAATTCGCATG
36897030TGTTACGTCAAAAAATCCAATAAGTTGAAG
36903630CCTGATAAGGAAGATTGGCGAAAGAAGGTA
36910230TGCTACATCAAATAACCCTACAAGTTGAAG
36916830CCAAAAGTTCACAGTCATCCGAGTAGACGT
36923430CTATCTACTTTTGGGAACCCTAATTGGTAC
36930030TTTCTTCTGTTTGTCCATGTCCAAACCTCC
36936630AACAATGTGTGATTTTTCGGACTTAGTCCC
36943230AAGGGAATAACCTTACCATTCTGTCTTATG
36949830TTCCCAAAAGTTGATGCTGATACGATTGGT
36956430AACAATCAGCCGTGAGGGAATACGCCGCGT
36963030AGGTTAATGATGAAAAAAATAATAACTACT
36969630GGGCATATTATGCAGATATGCAACGAAACG
36976230CTTGGAAAAGAATTTATAAAATGCGAAGTT
36982830GAACATATGCTCGCTCTTTCTCGAGTACTC
36989430AAACTTTGAGGTACTAAATAAAACAAGTCA
36996030ACCTTTCAATAGTAGCATCGGGCAAACCAG
37002630GTCTCTAGTTACTTTACGTATAAACTCTAT
37009230GGGCATATTATGCAGATATGCAACGAAACG
37015830CTTGGAAAAGAATTTATAAAATGCGAAGTT
37022430ATGCGATATATCTATGACTTTACCTATTCT
37029030AAACTTTGAGGTACTAAATAAAACAAGTCA
37035630ATATCTTTTGTCGTTAAAGTTAGTAAAAAA
37042230TTTGAAATTCCCCAAATGTCAATTGTTTTC
37048830GAAAATGCAGGCGGTTCCACTGGAGAGGTT
37055430TAATTCAAAAAAAGGTCTTGGTTTGAAAGG
37062030AGCCCGCCCTGCGGAATTGCACGGCCCGTT
37068630ATTGAGCGTCAAGCACCCGGTAAGCCCACC
37075230TTGGTTATTCGACTTTTGATTTGAGCTATC
37081830CTCGCTCGAGCACAACAGGTGGCTGTCCAC
37088430TTTCCAGCTAGAGCATCAAAGTTTATAGGG
Table 3. Identified CRISPR arrays with spacers of Tanerella forsythia.
Table 3. Identified CRISPR arrays with spacers of Tanerella forsythia.
SPACER IDPOSITIONSEQUENCE
250836836ACAGAAACTTCTTTTCCTGCAAGATTAAATAATACA
250843437GGTATGTATAAATCTACACGTCTTGGGTTTTCTAATA
250850140AAAATTATCTTTGATAACTTTAAGAATCTTTTTGTCTTCT
250857140CCATTACTGCGCGGGCGGCGATGCAGGAGAACCCGGACCG
250864139TAAAAGGTTAAAAGTTAAATGAAGAAAGACATAAAACGA
250871036GTCTTTGGAGGCCTTTACTCTTTTAAAAATGCCCGA
250877634TCTCTTGTGTAGTTATAACACACAATTGAGTCAT
250884035CCTCTTCGTAATACGGCTCTATATCGAGCTCTCTG
250890538CCCCGAAGGCGCGGCCGTTCCACTCTAAGGTGTCGACT
250897336GTTAGATGATAACTTCCGTCTTCTCCGAGCATCATC
250903936TTCACGGGGGTAAAGCCCGCCCCTTACGGGGAACTA
250910537AAAAGATTTGCTATATTGTGAAAAATTTAAAAAAAAG
250917239TTCACGGGGGTAAAGCCCGCCCCTTACGGGGAACTACTC
250924138TGCAGCCGTTGTCTCGCAAAAAGCAGCGCCTTCTAAAA
250930936CCTGCCCTGCGTGGGGGCTTTGGTGTGCGCAGCCTG
250937537CTTCAAAAGCGGCAGCGCGCTTTTTGAGAAGGCGCTG
250944237TTTGTGTTATACGGAGATTATACACGGTGGGTGTGGG
250950937TGCGCGCATACGTTCTTCTACGTACGCCTTTTTGGTT
250957638AAAAGATTTGCTATTTTGTAATAGCAAAGAACTATGAA
250964435TAAGAGGTTATCTCCGTCCGCACGAGTTCGGACGT
250970936CATACGTTGCACGAATGTCCGCATCAAAAGCGGCAG
250977536GTTATTCTCCCAATCACCGAACCTGTCAACAAAAGA
250984138CTATAACTGCAGCCCGCACGGCTGCACGGTTGGCGTAC
250990937GTCTGGTCGTTTTTTCTGTATTGGGGGGGGCGGCATT
250997636ACGTTAACACGTGCACCGCCAACGCGGGCAGAAAAG
251004235CGTATCTGAAACGTCCGAATTGGTGCGGACGGAGG
251010736GCCACCACCGACCCTGCACGGGCGGTTTGGCTCGCG
251017337ACATAGCAAACCTTGTTGGATAATATTCTTCGTCTAT
251024036GAACAATAACAAACAGGATTGGGCGATCATACTTTT
251030636CTCGGATTTATCCATTACGTCGGCCGCATCGATTTG
251037238CCAACGCGGGGAAGAAGGCGGATGAGGTTTCGGAACAA
251044037CGCCGAGAAGGTCTCCGTCCTCGTCAAAAACAGACTC
251050737GCTCGGGGATCGATATAATAGAATGGTAGAGGAGTGG
251057438TACGGGGTCACCTCCGTTCGCATGAGTTTGGACGTTTC
251064236CATATAACAGTGCGACGAGACAGGCTGCGCACACCA
251070837GGGGTAAATCATGTAAAACGAACAATTTTAGAATATA
251077536CGTAGCGCTATTATGCGCGGTATGGCGCGGCTCTGC
251084136CTTGCAGTAGGGGCAGTGAAAATTACACGACCCGAA
251090739CTATTACCGCCGCCCGCACGGGCGCACGGCTGGCGTACG
251097638GAATAAAAATCAGCGTAAAAACATATATGCTTACACGA
251104438TTTTTTGTGGCCGTTTCGGCCTTATCTGTATCTACTGT
251111236AGCCGACGCGATATATTCGTGCCCGGCAAACAAATC
251117836CGCCGTACACGTGGTGATATTTATGAAACAAATTTT
251124436GATATATTTTTCTAAACATTTTCATGACTTTATCGG
251131036TGATAACTTTTAAAGTCTTTTTATCCTCTGCATTCA
251137637ATTGTACACCTTGTCTACTTGCTCATCAGGGAAATTC
251144337GTAATCCTCACACTGCCGATTATGGCTGAGTAATCTA
251151036AGTTGATGCAAAAGGTTTATCGAAACACCTTCCTTC
251157637CCTTATCTCAATGGTTTAAGGAAGACGTTGCGCGCAT
251164336AGCCTATCTAAACGCCAAATAACTAATTTGTCTCCT
251170937TCGGTTTGGTGATAGTTGGTAACAAGATTTTAAAACA
251177634ATTACATCAGGATAGATGGTGTGGCGTATGAAAA
251184037GAAGCTGGTAACCGCGGATGTCGCCTTCGGCCTCGAA
251190738CCGCTACCCAAAAAACCCTCGACAAAATGCCCGAAATC
251197537CACTGGGGCACATAGTCCTGATCTCCTCGGCGAGTAT
251204237GAAAAGTGCTAATGGTAAAGTTAAACTTTCTCCTTTA
251210935TTAGATGATCTTGCGGACTACAGTGCCGAATTTGA
251217436GCAAACGGGGCCTTTTGTGCCATGTCACCAGTGCGG
251224037AGAGACGTTCCTCCTGCGTTGTACAAGATACTCTGTA
251230734AATTTAAGTGATGATGTAAAAACTGGTATTAATA
251237135TTAGATGATCTTGCGGACTACAGTGCCGAATTTGA
251243636TTCGCAATCGCTTCGACGGCAAAAGTGCCGCCCAGG
251250235TGTTTATGTACGACTCTTTCAGTTTTAACTGCTTT
251256739GATATAATGCTTACAATCGAGGCATTTAATAACATTAAA
251263639CAATGTGTACGTTGTCATTGCCGGTATATTAGGATTCTT
251270535AAGTGCCTTTGCCGTTAATTTTGTCAATGAGTTTC
251277038GCGAAATCCTGCTCGTGCAGGGTGGAAGCAAGAATATC
251283838AGCGTCATAGCATTCACACCGGCAGCACCAGTTACGAA
251290637GTCGGACACGATGGGCAGAAATTCTTCTTCGACCATG
251297335CCGTTAAATTGTCTGGCAAGGACGTGACGCCGGTA
251303836CGTTGTAGAAATCGTCTTCGTTGATAACAAGTGTTA
251310437GCTTCTTCGATTCTTCTTTTACCTCTCCGGTTTCCGT
Tannerella forsythia: complete genome length, 3405521; CRISPR rank in the sequence, 4; Crispr_begin_position: 2508368 → Crispr_end_position: 2513104.
Table 4. Accuracy of nearly 100% in all algorithms.
Table 4. Accuracy of nearly 100% in all algorithms.
ModelAUCCAF1PrecisionRecallLogLossSpecificity
Random Forest1.0001.0001.0001.0001.0000.0971.000
Neural Network1.0001.0001.0001.0001.0000.0211.000
SVM0.9381.0001.0001.0001.0000.3871.000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yadalam, P.K.; Arumuganainar, D.; Anegundi, R.V.; Shrivastava, D.; Alftaikhah, S.A.A.; Almutairi, H.A.; Alobaida, M.A.; Alkaberi, A.A.; Srivastava, K.C. CRISPR-Cas-Based Adaptive Immunity Mediates Phage Resistance in Periodontal Red Complex Pathogens. Microorganisms 2023, 11, 2060. https://doi.org/10.3390/microorganisms11082060

AMA Style

Yadalam PK, Arumuganainar D, Anegundi RV, Shrivastava D, Alftaikhah SAA, Almutairi HA, Alobaida MA, Alkaberi AA, Srivastava KC. CRISPR-Cas-Based Adaptive Immunity Mediates Phage Resistance in Periodontal Red Complex Pathogens. Microorganisms. 2023; 11(8):2060. https://doi.org/10.3390/microorganisms11082060

Chicago/Turabian Style

Yadalam, Pradeep Kumar, Deepavalli Arumuganainar, Raghavendra Vamsi Anegundi, Deepti Shrivastava, Sultan Abdulkareem Ali Alftaikhah, Haifa Ali Almutairi, Muhanad Ali Alobaida, Abdullah Ahmed Alkaberi, and Kumar Chandan Srivastava. 2023. "CRISPR-Cas-Based Adaptive Immunity Mediates Phage Resistance in Periodontal Red Complex Pathogens" Microorganisms 11, no. 8: 2060. https://doi.org/10.3390/microorganisms11082060

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop